AI227702 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: AI227702

Symbol: AI227702
Previously known as:
RGD ID: 5084640
Expected Size: 217 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.2X129,070,018 - 129,070,235 (+)MAPPERmRatBN7.2
Rnor_6.0X136,792,765 - 136,792,981NCBIRnor6.0
Rnor_5.0X136,852,346 - 136,852,562UniSTSRnor5.0
RGSC_v3.4X136,291,315 - 136,291,531UniSTSRGSC3.4
CeleraX127,999,917 - 128,000,133UniSTS
Cytogenetic MapXq36UniSTS
Is Marker For: Genes:   Igsf1  


Annotation


References - curated
# Reference Title Reference Citation
1. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer CTTGTCACTCCCAGAACCCTCT
Reverse Primer ACTGCCACCAATTCTCCTTCAT
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
631402Igsf1immunoglobulin superfamily, member 1X129069891129085331Rat



QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
1598837Memor13Memory QTL 133.2exploratory behavior trait (VT:0010471)difference between time of physical contact/close proximity of test subject and social stimulus during sample phase and test phase (CMO:0002678)X41052407146860749Rat
1598872Memor14Memory QTL 144.5exploratory behavior trait (VT:0010471)difference between time of physical contact/close proximity of test subject and social stimulus during sample phase and test phase (CMO:0002678)X93956491138956491Rat
738025Stresp3Stress response QTL 34.610.0066stress-related behavior trait (VT:0010451)defensive burying - approachX100567703150256146Rat
1598809Memor15Memory QTL 154.4exploratory behavior trait (VT:0010471)difference between time of physical contact/close proximity of test subject and social stimulus during sample phase and test phase (CMO:0002678)X103312877148312877Rat
1598856Memor1Memory QTL 11.9exploratory behavior trait (VT:0010471)total horizontal distance resulting from voluntary locomotion in an experimental apparatus (CMO:0001443)X103312877148312877Rat
738029Stresp2Stress response QTL 23.40.0004stress-related behavior trait (VT:0010451)defensive burying - approachX112934952138400867Rat
10059603Bw174Body weight QTL 1743.40.025body mass (VT:0001259)body weight (CMO:0000012)X113937816152453651Rat
634346Insul4Insulin level QTL 40blood insulin amount (VT:0001560)serum insulin level (CMO:0000358)X126975089152453651Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 302822 UniSTS
UniSTS 250458 UniSTS