BI275304 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: BI275304

Symbol: BI275304
Also known as:
RGD ID: 5083203
Expected Size: 166 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.21232,229,695 - 32,229,861 (+)MAPPERmRatBN7.2
mRatBN7.2162,441,525 - 2,441,691 (-)MAPPERmRatBN7.2
mRatBN7.21232,229,695 - 32,229,861 (-)MAPPERmRatBN7.2
mRatBN7.2162,441,525 - 2,441,691 (+)MAPPERmRatBN7.2
Rnor_6.01237,648,574 - 37,648,739NCBIRnor6.0
Rnor_6.0162,884,301 - 2,884,466NCBIRnor6.0
Rnor_5.0162,855,294 - 2,855,459UniSTSRnor5.0
Rnor_5.01239,519,562 - 39,519,727UniSTSRnor5.0
RGSC_v3.4162,525,046 - 2,525,211UniSTSRGSC3.4
RGSC_v3.41233,344,844 - 33,345,009UniSTSRGSC3.4
Celera1233,917,663 - 33,917,828UniSTS
Celera162,406,487 - 2,406,652UniSTS
Cytogenetic Map12q15UniSTS
Is Marker For: Genes:   Sbno1  


Annotation


References - curated
1. RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer ACTCAAGTACGGTTTCCGGTTC
Reverse Primer TAATTTGTGCTGCAAACATGGC
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
1310005Sbno1strawberry notch homolog 1123217517632234200Rat
1310672Arhgef3Rho guanine nucleotide exchange factor 31623015732581951Rat

Nucleotide Sequences
RefSeq Transcripts NM_001107138 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
GenBank Nucleotide BC091433 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
1598855Bp294Blood pressure QTL 2943.5arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)12134851688Rat
7411660Foco28Food consumption QTL 2810.90.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)12142110980Rat
9590086Insglur6Insulin/glucose ratio QTL 618.970.001blood insulin amount (VT:0001560)calculated plasma insulin level (CMO:0002170)12142110980Rat
8694179Bw150Body weight QTL 1502.90.001body mass (VT:0001259)body weight gain (CMO:0000420)12142110980Rat
7411586Foco5Food consumption QTL 55.40.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)12142110980Rat
7411595Foco9Food consumption QTL 940.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)12142110980Rat
7411545Bw128Body weight QTL 1285.20.001body mass (VT:0001259)body weight gain (CMO:0000420)12142110980Rat
9590147Scort7Serum corticosterone level QTL 713.610.001blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)12142110980Rat
2303575Insul14Insulin level QTL 144blood insulin amount (VT:0001560)blood insulin level (CMO:0000349)12142450532Rat
737979Pia22Pristane induced arthritis QTL 2253.1joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)12144465750Rat
634351Apr5Acute phase response QTL 56.7blood interleukin-6 amount (VT:0008595)plasma interleukin-6 level (CMO:0001927)12144503507Rat
2302042Pia38Pristane induced arthritis QTL 383.50.001blood immunoglobulin amount (VT:0002460)serum immunoglobulin G1 level (CMO:0002115)12144503507Rat
634350Apr4Acute phase response QTL 46orosomucoid 1 amount (VT:0010541)plasma orosomucoid 1 level (CMO:0001467)12117200546172005Rat
8552918Pigfal7Plasma insulin-like growth factor 1 level QTL 7blood insulin-like growth factor amount (VT:0010479)plasma insulin-like growth factor 1 level (CMO:0001299)12556449546669029Rat
7411547Bw129Body weight QTL 1290.001body mass (VT:0001259)body weight gain (CMO:0000420)6556449546669029Rat
7411597Foco10Food consumption QTL 100.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)12556449546669029Rat
7411641Foco19Food consumption QTL 1927.70.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)12556449546669029Rat
8552964Pigfal17Plasma insulin-like growth factor 1 level QTL 173.5blood insulin-like growth factor amount (VT:0010479)plasma insulin-like growth factor 1 level (CMO:0001299)12556449546669029Rat
7411588Foco6Food consumption QTL 60.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)12556449546669029Rat
8552912Pigfal6Plasma insulin-like growth factor 1 level QTL 65blood insulin-like growth factor amount (VT:0010479)plasma insulin-like growth factor 1 level (CMO:0001299)12556449846669029Rat
10059594Kidm46Kidney mass QTL 463.790.025kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)12610757946669029Rat
1302792Scl21Serum cholesterol level QTL 213.80.0011blood cholesterol amount (VT:0000180)plasma total cholesterol level (CMO:0000585)12719673046669029Rat
1549829Scl48Serum cholesterol level QTL 485blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)12960327746669029Rat
2293699Bss49Bone structure and strength QTL 495.610.0001lumbar vertebra size trait (VT:0010518)lumbar vertebra trabecular cross-sectional area (CMO:0001692)121047413746669029Rat
2300186Bmd59Bone mineral density QTL 597.10.0001lumbar vertebra mineral mass (VT:0010511)volumetric bone mineral density (CMO:0001553)121047413746669029Rat
1331761Bp218Blood pressure QTL 2182.973arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)121107382545055165Rat
61404Bw120Body weight QTL 1205.1body mass (VT:0001259)body mass index (BMI) (CMO:0000105)121235161946669029Rat
1641928Alcrsp5Alcohol response QTL 5response to alcohol trait (VT:0010489)duration of loss of righting reflex (CMO:0002289)121281238546669029Rat
2303569Gluco44Glucose level QTL 442blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)121281238546669029Rat
1549902Bp269Blood pressure QTL 269arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)121318273646669029Rat
1549912Bp268Blood pressure QTL 268arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)101318273646669029Rat
2302060Pia37Pristane induced arthritis QTL 376.10.001blood immunoglobulin amount (VT:0002460)serum immunoglobulin G1 level (CMO:0002115)121319815746669029Rat
61421Cia12Collagen induced arthritis QTL 124.6joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)121363552335682913Rat
631543Bp83Blood pressure QTL 835.8arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)121555082638478808Rat
2293684Bmd26Bone mineral density QTL 264.40.0002femur mineral mass (VT:0010011)total volumetric bone mineral density (CMO:0001728)121587265332974238Rat
631560Apr1Acute phase response QTL 16.1orosomucoid 1 amount (VT:0010541)plasma orosomucoid 1 level (CMO:0001467)121914436246669029Rat
737822Alc10Alcohol consumption QTL 102.2consumption behavior trait (VT:0002069)ethanol drink intake rate (CMO:0001407)121961087040218516Rat
5684888Pia42Pristane induced arthritis QTL 42joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)121961087042828880Rat
61324Eae5Experimental allergic encephalomyelitis QTL 514nervous system integrity trait (VT:0010566)percentage of study population developing relapsing-remitting experimental autoimmune encephalomyelitis during a period of time (CMO:0001402)121961087046669029Rat
1298081Cia25Collagen induced arthritis QTL 254.7joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)121961088935682913Rat
70213Niddm27Non-insulin dependent diabetes mellitus QTL 273.72blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)121983578938193007Rat
7411643Foco20Food consumption QTL 200.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)122032881946669029Rat
70169Eae13Experimental allergic encephalomyelitis QTL 130.032nervous system integrity trait (VT:0010566)experimental autoimmune encephalomyelitis incidence/prevalence measurement (CMO:0001046)122413920236638073Rat
1556747Calcic1Intracellular calcium level QTL 13.6platelet calcium amount (VT:0010500)platelet intracellular calcium level (CMO:0000922)122806443340130419Rat
1300175Cm5Cardiac mass QTL 53.78heart mass (VT:0007028)heart left ventricle weight to body weight ratio (CMO:0000530)122806443345899022Rat
1600386Calcic2Intracellular calcium level QTL 20.001platelet physiology trait (VT:0005464)platelet intracellular calcium level (CMO:0000922)122806443346669029Rat
1331787Rf41Renal function QTL 412.998kidney blood vessel physiology trait (VT:0100012)absolute change in renal blood flow rate (CMO:0001168)122806455740218380Rat
631829Alc6Alcohol consumption QTL 64.7consumption behavior trait (VT:0002069)ethanol drink intake rate (CMO:0001407)122860752637691617Rat
1300162Bp188Blood pressure QTL 1883.19arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)123210317445899022Rat
2325838Bp347Blood pressure QTL 3470.001arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)1613080679Rat
1357403Slep4Serum leptin concentration QTL 43.91blood leptin amount (VT:0005667)serum leptin level (CMO:0000780)1619639137Rat
1600369Hcas8Hepatocarcinoma susceptibility QTL 8liver integrity trait (VT:0010547)liver tumorous lesion number (CMO:0001068)16122477621Rat
631830Alc7Alcohol consumption QTL 72.9consumption behavior trait (VT:0002069)ethanol drink intake rate (CMO:0001407)16126727669Rat
634355Rends4Renal damage susceptibility QTL 40.05kidney blood vessel morphology trait (VT:0000530)organ lesion measurement (CMO:0000677)16126727669Rat
1582235Insul8Insulin level QTL 83.30.0063blood insulin amount (VT:0001560)calculated serum insulin level (CMO:0000359)16126727669Rat
9590151Scort8Serum corticosterone level QTL 88.450.001blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)16130836262Rat
2302380Slep6Serum leptin concentration QTL 63.36blood leptin amount (VT:0005667)serum leptin level (CMO:0000780)16132139025Rat
2307172Activ4Activity QTL 43.710.00023locomotor behavior trait (VT:0001392)number of entries into a discrete space in an experimental apparatus (CMO:0000960)16133418960Rat
1354584Despr6Despair related QTL 63.10.0067locomotor behavior trait (VT:0001392)amount of time spent in voluntary immobility (CMO:0001043)16139533930Rat
2303566Bw90Body weight QTL 902body mass (VT:0001259)body weight (CMO:0000012)16139533930Rat
631561Hcuc2Hepatic copper content QTL 22.8hepatic copper amount (VT:0003065)liver total copper weight (CMO:0001507)16139533949Rat
6903319Bw114Body weight QTL 1142.70.0037body mass (VT:0001259)body weight (CMO:0000012)16143534949Rat
7411664Foco30Food consumption QTL 30110.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)16144588133Rat
1354625Despr7Despair related QTL 73.160.016locomotor behavior trait (VT:0001392)amount of time spent in voluntary immobility (CMO:0001043)16144977551Rat
1549842Bp248Blood pressure QTL 2480.01arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)163802452995463Rat
1600378Arunc4Aerobic running capacity QTL 40.03exercise endurance trait (VT:0002332)maximum distance run on treadmill (CMO:0001406)1638024580345693Rat
2293343Glom16Glomerulus QTL 167.4kidney glomerulus integrity trait (VT:0010546)kidney sclerotic glomeruli count to total glomeruli count ratio (CMO:0001269)1683223646053497Rat
2312660Bw95Body weight QTL 950.05inguinal fat pad mass (VT:0010424)inguinal fat pad weight to body weight ratio (CMO:0001253)1683223659492508Rat
2312663Slep9Serum leptin concentration QTL 90.001blood leptin amount (VT:0005667)serum leptin level (CMO:0000780)1683223659492508Rat
2312666Insul16Insulin level QTL 160.01blood insulin amount (VT:0001560)serum insulin level (CMO:0000358)1683223659492508Rat
2312669Stl23Serum triglyceride level QTL 230.01blood triglyceride amount (VT:0002644)serum triglyceride level (CMO:0000360)1683223659492508Rat
12903278Am16Aortic mass QTL 160.019aorta mass (VT:0002845)aorta weight to aorta length to body weight ratio (CMO:0002722)168323802995225Rat
12903279Cm115Cardiac mass QTL 1150.001heart mass (VT:0007028)heart wet weight to body weight ratio (CMO:0002408)168323802995225Rat
12903281Cm116Cardiac mass QTL 1160.001heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)168323802995225Rat
12903952Cm117Cardiac mass QTL 1170.001heart right ventricle mass (VT:0007033)heart right ventricle weight to body weight ratio (CMO:0000914)168323802995225Rat
12903954Bw186Body weight QTL 1860.011body mass (VT:0001259)body weight (CMO:0000012)168323802995225Rat
2301404Bp321Blood pressure QTL 3210.05arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)168323802995225Rat
12903955Kidm69Kidney mass QTL 690.001kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)168323804227609Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 304470 UniSTS
UniSTS 249625 UniSTS