RH142046 Marker Search Result - Rat Genome Database
Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Search RGD Grant Resources Citing RGD About Us Contact Us
Genes QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data
OntoMate (Literature Search) JBrowse (Genome Browser) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) RatMine GViewer (Genome Viewer) Overgo Probe Designer ACP Haplotyper Genome Scanner
Aging & Age-Related Disease Cancer Cardiovascular Disease COVID-19 Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease
Find Models   new Genetic Models Autism Models PhenoMiner (Quantitative Phenotypes) Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes GERRC (Gene Editing Rat Resource Center) Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive
Pathways
Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Poster Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources

Marker: RH142046

Symbol: RH142046
Also known as: AI556226; 
RGD ID: 5081240
Expected Size: 213 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
Rnor_6.0741,754,713 - 41,754,925NCBIRnor6.0
Rnor_6.0343,001,983 - 43,002,195NCBIRnor6.0
Rnor_5.0741,784,911 - 41,785,123UniSTSRnor5.0
Rnor_5.0348,075,358 - 48,075,570UniSTSRnor5.0
RGSC_v3.4737,180,646 - 37,180,858UniSTSRGSC3.4
Celera731,386,249 - 31,386,461UniSTS
RH 3.4 Map7293.7UniSTS
Is Marker For: Genes:   LOC687939   LOC100361258  


Annotation


References - curated
1. RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer ATGGTTTATCTGTTTGGTCGGC
Reverse Primer CAGAGACAGACAGAAACCTGGC
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
9126689LOC103692840uncharacterized LOC10369284074175211741858963Rat

Nucleotide Sequences
GenBank Nucleotide JH614101 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (Rnor_6.0)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
2290452Scl56Serum cholesterol level QTL 562.26blood cholesterol amount (VT:0000180)plasma total cholesterol level (CMO:0000585)3195176874Rat
10401810Kidm53Kidney mass QTL 53kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)3263142148562146Rat
70191BpQTLcluster4Blood pressure QTL cluster 43arterial blood pressure trait (VT:2000000)absolute change in systolic blood pressure (CMO:0000607)3600074851687917Rat
70191BpQTLcluster4Blood pressure QTL cluster 43arterial blood pressure trait (VT:2000000)absolute change in mean arterial blood pressure (CMO:0000533)3600074851687917Rat
1358905Hrtrt17Heart rate QTL 175.90.000014heart pumping trait (VT:2000009)heart rate (CMO:0000002)31009408193415837Rat
2298542Neuinf11Neuroinflammation QTL 113.9nervous system integrity trait (VT:0010566)spinal cord complement component 1, q subcomponent, B chain mRNA level (CMO:0002126)31011931879772001Rat
1358885Bp251Blood pressure QTL 2513.8arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)310639528127023997Rat
1358888Bp264Blood pressure QTL 2644.43arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)310639528127023997Rat
731172Bp151Blood pressure QTL 1510.04arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)31409041148562146Rat
12879849Bw180Body weight QTL 1800.037body mass (VT:0001259)body weight (CMO:0000012)31409041148562146Rat
12879850Cm91Cardiac mass QTL 910.001heart mass (VT:0007028)heart wet weight to body weight ratio (CMO:0002408)31409041148562146Rat
12879851Cm92Cardiac mass QTL 920.001heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)31409041148562146Rat
12879852Cm93Cardiac mass QTL 930.001heart right ventricle mass (VT:0007033)heart right ventricle weight to body weight ratio (CMO:0000914)31409041148562146Rat
12879853Am5Aortic mass QTL 50.001aorta mass (VT:0002845)aorta weight to aorta length to body weight ratio (CMO:0002722)31409041148562146Rat
12879854Kidm63Kidney mass QTL 630.001kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)31409041148562146Rat
631676Cm8Cardiac mass QTL 87.030.0001aorta mass (VT:0002845)aorta weight (CMO:0000076)31802366463023664Rat
10450794Scl69Serum cholesterol level QTL 696.30.001blood LDL cholesterol amount (VT:0000181)blood low density lipoprotein cholesterol level (CMO:0000053)32122380366223803Rat
10450804Scl70Serum cholesterol level QTL 704.70.001blood LDL cholesterol amount (VT:0000181)blood low density lipoprotein cholesterol level (CMO:0000053)32122380366223803Rat
631685Bp118Blood pressure QTL 1183.2arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)32465522569655225Rat
631832Sach1Saccharin preference QTL 12.70.02consumption behavior trait (VT:0002069)calculated saccharin drink intake volume (CMO:0001600)32813672845772990Rat
2313049Bss72Bone structure and strength QTL 722.60.0001tibia area (VT:1000281)tibia midshaft cross-sectional area (CMO:0001717)32813672851687917Rat
2313076Bss74Bone structure and strength QTL 7420.0001tibia strength trait (VT:1000284)tibia total energy absorbed before break (CMO:0001736)32813672851687917Rat
2313079Bss73Bone structure and strength QTL 731.5tibia size trait (VT:0100001)tibia midshaft cross-sectional area (CMO:0001717)32813672851687917Rat
2313093Bmd77Bone mineral density QTL 772.20.0001tibia mineral mass (VT:1000283)cortical volumetric bone mineral density (CMO:0001730)32813672851687917Rat
2313101Bmd76Bone mineral density QTL 763.60.0001tibia mineral mass (VT:1000283)total volumetric bone mineral density (CMO:0001728)32813672851687917Rat
2302055Pia30Pristane induced arthritis QTL 303.50.001blood autoantibody amount (VT:0003725)serum immunoglobulin M-type rheumatoid factor level relative to an arbitrary reference serum (CMO:0002111)32932171474321714Rat
9590286Uminl1Urine mineral level QTL 13.50.001urine mineral amount (VT:0015086)urine electrolyte level (CMO:0000593)32968273274682732Rat
9590136Scort3Serum corticosterone level QTL 323.370.001blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)32968273274682732Rat
8552950Pigfal12Plasma insulin-like growth factor 1 level QTL 127.3blood insulin-like growth factor amount (VT:0010479)plasma insulin-like growth factor 1 level (CMO:0001299)32968273274682732Rat
8694196Abfw2Abdominal fat weight QTL 216.580.001visceral adipose mass (VT:0010063)abdominal fat pad weight to body weight ratio (CMO:0000095)32968273274682732Rat
8694386Bw159Body weight QTL 1594.520.001body lean mass (VT:0010483)lean tissue morphological measurement (CMO:0002184)32968273274682732Rat
1354590Despr11Despair related QTL 110.000031locomotor behavior trait (VT:0001392)amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)32990825574908255Rat
2303593Gluco46Glucose level QTL 463blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)32990825574908255Rat
737818Hcar12Hepatocarcinoma resistance QTL 122.6liver integrity trait (VT:0010547)volume of individual liver tumorous lesion (CMO:0001078)330114912123700444Rat
70216Cm14Cardiac mass QTL 142.1heart mass (VT:0007028)heart wet weight (CMO:0000069)330846101172879276Rat
2301400Cm68Cardiac mass QTL 680.001heart mass (VT:0007028)heart wet weight to body weight ratio (CMO:0002408)33110358972989078Rat
11565451Bw177Body weight QTL 1770.002body mass (VT:0001259)body weight (CMO:0000012)33110358972989078Rat
11565452Kidm57Kidney mass QTL 570.001kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)33110358972989078Rat
12879866Cm94Cardiac mass QTL 940.001heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)33110358972989078Rat
12879867Cm95Cardiac mass QTL 950.047heart right ventricle mass (VT:0007033)heart right ventricle weight to body weight ratio (CMO:0000914)33110358972989078Rat
12879868Am6Aortic mass QTL 60.001aorta mass (VT:0002845)aorta weight to aorta length to body weight ratio (CMO:0002722)33110358972989078Rat
61356Bp37Blood pressure QTL 373blood pressure trait (VT:0000183)systolic blood pressure (CMO:0000004)33213099777130997Rat
631647Bp122Blood pressure QTL 1226.2arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)33213099777130997Rat
1300169Bp177Blood pressure QTL 1772.96arterial blood pressure trait (VT:2000000)blood pressure time series experimental set point of the baroreceptor response (CMO:0002593)33347735462922975Rat
1354589Bw31Body weight QTL 313.3body mass (VT:0001259)body weight (CMO:0000012)33347735481136227Rat
1354604Bw36Body weight QTL 362.9body mass (VT:0001259)body weight (CMO:0000012)333477354108914061Rat
61419Cia11Collagen induced arthritis QTL 115.6joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)334394121103141944Rat
10450813Scl74Serum cholesterol level QTL 745.80.001blood LDL cholesterol amount (VT:0000181)blood low density lipoprotein cholesterol level (CMO:0000053)33924839152182792Rat
10450852Stl33Serum triglyceride level QTL 333.40.05blood LDL triglyceride amount (VT:0010699)blood lipoprotein triglyceride level (CMO:0002685)33924839152182792Rat
10450816Scl75Serum cholesterol level QTL 754.40.001blood LDL cholesterol amount (VT:0000181)blood low density lipoprotein cholesterol level (CMO:0000053)33924839152182792Rat
1358362Srcrt2Stress Responsive Cort QTL 22.78blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)339248391140271184Rat
4889975Bmd81Bone mineral density QTL 814.3tibia mineral mass (VT:1000283)total volumetric bone mineral density (CMO:0001728)33977324751687917Rat
738019Anxrr10Anxiety related response QTL 103.9exploratory behavior trait (VT:0010471)number of entries into a discrete space in an experimental apparatus (CMO:0000960)34042292185422921Rat
634317Bw117Body weight QTL 1173.58abdominal fat pad mass (VT:1000711)abdominal fat pad weight to body weight ratio (CMO:0000095)34052359354745780Rat
2302276Bw82Body weight QTL 824.32body mass (VT:0001259)body weight (CMO:0000012)34052359364880586Rat
1331777Bw24Body weight QTL 243.503body mass (VT:0001259)body weight (CMO:0000012)34052359392654473Rat
1331795Rf30Renal function QTL 303.708urine potassium amount (VT:0010539)urine potassium level (CMO:0000128)34052359392654473Rat
634336Anxrr17Anxiety related response QTL 173.66locomotor behavior trait (VT:0001392)number of entries into a discrete space in an experimental apparatus (CMO:0000960)72920071124838025Rat
61410Bw19Body weight QTL 196.20.001body mass (VT:0001259)body weight (CMO:0000012)7591147750911477Rat
631503Bp102Blood pressure QTL 1021.9arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)7595196950951969Rat
10755438Coatc9Coat color QTL 90coat/hair pigmentation trait (VT:0010463)pigmented ventral coat/hair area to total ventral coat/hair area ratio (CMO:0001812)7975804554758045Rat
9590102Sffal5Serum free fatty acids level QTL 58.620.001blood free fatty acid amount (VT:0001553)plasma free fatty acids level (CMO:0000546)71164710256647102Rat
2298547Neuinf5Neuroinflammation QTL 53.7nervous system integrity trait (VT:0010566)spinal cord Cd74 protein level (CMO:0002131)71232846767193263Rat
1643004Pain2Pain QTL 21mechanical nociception trait (VT:0002734)self mutilation severity score (CMO:0002145)712328467106995532Rat
1578652Bmd15Bone mineral density QTL 155.2femur mineral mass (VT:0010011)trabecular volumetric bone mineral density (CMO:0001729)71268785067801690Rat
10755440Coatc10Coat color QTL 100coat/hair pigmentation trait (VT:0010463)pigmented ventral coat/hair area to total ventral coat/hair area ratio (CMO:0001812)71395217958952179Rat
10059592Kidm45Kidney mass QTL 453.950.025kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)71444568559445685Rat
1582260Bw72Body weight QTL 723.20.0043body mass (VT:0001259)body weight (CMO:0000012)72021558344668493Rat
1582261Bw69Body weight QTL 693.20.0048body mass (VT:0001259)body weight (CMO:0000012)72021558344668493Rat
1582262Bw75Body weight QTL 7530.0038body mass (VT:0001259)body weight (CMO:0000012)72021558344668493Rat
738033Anxrr6Anxiety related response QTL 64.1exploratory behavior trait (VT:0010471)percentage of entries into a discrete space in an experimental apparatus (CMO:0000961)72216841267168412Rat
10755451Coatc11Coat color QTL 110coat/hair pigmentation trait (VT:0010463)pigmented ventral coat/hair area to total ventral coat/hair area ratio (CMO:0001812)72473146569731465Rat
1354644Spl4Serum phospholipid level QTL 44.9blood phospholipid amount (VT:0006084)blood phospholipid level (CMO:0001169)72536563357064364Rat
1354637Scl30Serum cholesterol level QTL 303.7blood cholesterol amount (VT:0000180)blood total cholesterol level (CMO:0000051)72536563357064364Rat
1354639Spl5Serum phospholipid level QTL 53.9blood LDL phospholipid amount (VT:0010505)blood low density lipoprotein phospholipid level (CMO:0001568)72536563360317612Rat
1300132Bp182Blood pressure QTL 1823.49arterial blood pressure trait (VT:2000000)blood pressure time series experimental set point of the baroreceptor response (CMO:0002593)72536563393155402Rat
7411569Bw137Body weight QTL 1370.001body mass (VT:0001259)body weight gain (CMO:0000420)72820465373204653Rat
1641885Alcrsp9Alcohol response QTL 9alcohol metabolism trait (VT:0015089)blood ethanol level (CMO:0000535)73138152976381529Rat
1549840Bss5Bone structure and strength QTL 59.8femur strength trait (VT:0010010)femur midshaft polar moment of inertia (CMO:0001669)73203505377035053Rat
61439Cia8Collagen induced arthritis QTL 85.1joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)73257294277572942Rat
70190Mcs6Mammary carcinoma susceptibility QTL 62.29mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)73304444971352127Rat
1300138Hrtrt9Heart rate QTL 94.72heart pumping trait (VT:2000009)heart rate (CMO:0000002)73586772961047824Rat
10402855Bp379Blood pressure QTL 3790.21arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)73586772980867729Rat
1300127Srn1Serum renin concentration QTL 13.87blood renin amount (VT:0003349)plasma renin activity level (CMO:0000116)73586772993155402Rat
10755453Coatc12Coat color QTL 120coat/hair pigmentation trait (VT:0010463)pigmented ventral coat/hair area to total ventral coat/hair area ratio (CMO:0001812)73854770683547706Rat
631534Lnnr1Liver neoplastic nodule remodeling QTL 13.850.001liver integrity trait (VT:0010547)liver remodeling tumorous lesion number to liver total tumorous lesion number ratio (CMO:0001705)74087268285872682Rat
7411605Foco14Food consumption QTL 1424.10.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)74087268285872682Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 100361258 UniSTS
  687939 UniSTS
UniSTS 224036 UniSTS