RH141187 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: RH141187

Symbol: RH141187
Previously known as: AA924588; BF398038; 
RGD ID: 5079760
Expected Size: 212 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.21599,969,819 - 99,970,031 (+)MAPPERmRatBN7.2
Rnor_6.015109,308,430 - 109,308,641NCBIRnor6.0
Rnor_5.015112,689,340 - 112,689,551UniSTSRnor5.0
RGSC_v3.415108,030,480 - 108,030,691UniSTSRGSC3.4
Celera1598,740,282 - 98,740,493UniSTS
RH 3.4 Map15716.8UniSTS
Cytogenetic Map15q25UniSTS
Is Marker For: Genes:   Ggact  


Annotation


References - curated
# Reference Title Reference Citation
1. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer TGGGCCCTCAGAATCATAGTTT
Reverse Primer ATGAGGTGGATGAGCAGATGTT
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
1304748Ggactgamma-glutamylamine cyclotransferase159996924699998343Rat

Nucleotide Sequences
RefSeq Transcripts NM_001025634 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
GenBank Nucleotide BC098699 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
631655Bp126Blood pressure QTL 1264arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1558156477101769107Rat
2317055Aia10Adjuvant induced arthritis QTL 103.41joint integrity trait (VT:0010548)left rear ankle joint diameter (CMO:0002149)1575788062101769107Rat
731177Uae26Urinary albumin excretion QTL 262.40.025urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)1567588667101769107Rat
1549844Bss7Bone structure and strength QTL 76.4femur strength trait (VT:0010010)femur midshaft polar moment of inertia (CMO:0001669)1575788062101769107Rat
2300326Plaw1Placental weight QTL 1150.005placenta mass (VT:0004257)placenta wet weight (CMO:0002088)1568327165100062518Rat
70155Gcs1Gastric cancer susceptibility QTL13.8stomach morphology trait (VT:0000470)stomach tumor susceptibility score (CMO:0002043)1576306099101769107Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 290500 UniSTS
UniSTS 223183 UniSTS