RH141095 Marker Search Result - Rat Genome Database

Send us a Message



 Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Search RGD Grant Resources Citing RGD About Us Contact Us
Genes QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data
OntoMate (Literature Search) JBrowse (Genome Browser) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) RatMine GViewer (Genome Viewer) Overgo Probe Designer ACP Haplotyper Genome Scanner VCMap
Aging & Age-Related Disease Cancer Cardiovascular Disease COVID-19 Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease
Find Models   new Genetic Models Autism Models PhenoMiner (Quantitative Phenotypes) Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes GERRC (Gene Editing Rat Resource Center) Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive
Pathways
Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Poster Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources

Marker: RH141095

Symbol: RH141095
Also known as: AA875232; 
RGD ID: 5079602
Expected Size: 204 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
Rnor_6.01383,805,400 - 83,805,603NCBIRnor6.0
Rnor_5.01388,685,566 - 88,685,769UniSTSRnor5.0
RGSC_v3.41381,321,311 - 81,321,514UniSTSRGSC3.4
Celera1377,565,498 - 77,565,701UniSTS
Cytogenetic Map13q23UniSTS
Is Marker For: Genes:   Mpzl1  


Annotation


References - curated
1. RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer CTCAAATCGCATGCACTCTTCT
Reverse Primer CTGAGTCTGCAGCCTGGTTCTA
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
1359140Mpzl1myelin protein zero-like 1138380524483842074Rat



QTLs in Region (Rnor_6.0)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
1354666Bp244Blood pressure QTL 2444.9arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)131107975663Rat
1354666Bp244Blood pressure QTL 2444.9arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)131107975663Rat
1354666Bp244Blood pressure QTL 2444.9arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)131107975663Rat
1581570Eae17Experimental allergic encephalomyelitis QTL 174.1nervous system integrity trait (VT:0010566)experimental autoimmune encephalomyelitis incidence/prevalence measurement (CMO:0001046)1312193394108478121Rat
7207885Glom27Glomerulus QTL 273.9kidney glomerulus integrity trait (VT:0010546)kidney crescentic glomeruli count to kidney normal glomeruli count ratio (CMO:0002139)1324502279108770533Rat
1354621Rf47Renal function QTL 473.7kidney renin amount (VT:0010559)kidney renin level (CMO:0002166)1335301263107975663Rat
70181BpQTLcluster11Blood pressure QTL cluster 116.922arterial blood pressure trait (VT:2000000)absolute change in mean arterial blood pressure (CMO:0000533)133614753399968921Rat
70181BpQTLcluster11Blood pressure QTL cluster 116.922arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)133614753399968921Rat
70181BpQTLcluster11Blood pressure QTL cluster 116.922arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)133614753399968921Rat
70181BpQTLcluster11Blood pressure QTL cluster 116.922arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)133614753399968921Rat
61340Bp25Blood pressure QTL 254.20.004arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)133937292784372927Rat
10755495Bp387Blood pressure QTL 3873.78arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)133950130093652524Rat
4889861Pur29Proteinuria QTL 2913.80.005total urine protein amount (VT:0000032)urine total protein excretion rate (CMO:0000756)134231074486833540Rat
1331750Bp220Blood pressure QTL 2202.98arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)134231074487310744Rat
70220Bp55Blood pressure QTL 555.75arterial blood pressure trait (VT:2000000)blood pressure measurement (CMO:0000003)134250834587508345Rat
61349Bp31Blood pressure QTL 315.75arterial blood pressure trait (VT:2000000)blood pressure measurement (CMO:0000003)134250834587508345Rat
1549897Stresp12Stress response QTL 123.35stress-related behavior trait (VT:0010451)number of approaches toward negative stimulus before onset of defensive burying response (CMO:0001960)134357571788575717Rat
619615Bp80Blood pressure QTL 800.0354arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)134567662990676629Rat
12879441Bp396Blood pressure QTL 396arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)135108098996080989Rat
1298066Bp159Blood pressure QTL 1590.004arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)135156924896569248Rat
71119Thym2Thymus enlargement QTL 23.8thymus mass (VT:0004954)thymus weight to body weight ratio (CMO:0000612)135157782490675199Rat
1641901Alcrsp6Alcohol response QTL 6response to alcohol trait (VT:0010489)duration of loss of righting reflex (CMO:0002289)1357903612102903612Rat
1354655Bp241Blood pressure QTL 2413.9arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1362975663107975663Rat
738026Lnnr5Liver neoplastic nodule remodeling QTL 53.29liver integrity trait (VT:0010547)liver remodeling tumorous lesion number (CMO:0001461)136500824591629354Rat
12879475Bp400Blood pressure QTL 400arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)1366971778111971778Rat
2293687Bss26Bone structure and strength QTL 264.60.0001femur morphology trait (VT:0000559)femur cross-sectional area (CMO:0001661)1371230858114033958Rat
2293702Bss34Bone structure and strength QTL 344.610.0001femur strength trait (VT:0010010)femur midshaft polar moment of inertia (CMO:0001669)1371230858114033958Rat
7387280Uae43Urinary albumin excretion QTL 435.690.4174urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)1372583716114033958Rat
1300166Kidm6Kidney mass QTL 63.93kidney mass (VT:0002707)single kidney wet weight to body weight ratio (CMO:0000622)137456837892916783Rat
1331783Bp221Blood pressure QTL 2213.72886arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)137456837892916783Rat
8655945Rf61Renal function QTL 613.6blood creatinine amount (VT:0005328)creatinine clearance (CMO:0000765)137456837892916783Rat
10755455Coatc13Coat color QTL 130coat/hair pigmentation trait (VT:0010463)pigmented ventral coat/hair area to total ventral coat/hair area ratio (CMO:0001812)777694986114033958Rat
11530006Niddm72Non-insulin dependent diabetes mellitus QTL 720.001blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)137956708186833540Rat
8655959Pur32Proteinuria QTL 328.4total urine protein amount (VT:0000032)urine total protein excretion rate (CMO:0000756)1379567081103613733Rat
738027Lnnr6Liver neoplastic nodule remodeling QTL 63.3liver integrity trait (VT:0010547)liver remodeling tumorous lesion number (CMO:0001461)138040355991629354Rat
2293341Glom15Glomerulus QTL 159.1kidney glomerulus integrity trait (VT:0010546)kidney sclerotic glomeruli count to total glomeruli count ratio (CMO:0001269)1380403559108770687Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 360871 UniSTS
UniSTS 223093 UniSTS