RH140649 Marker Search Result - Rat Genome Database
Submit Data |  Help |  Video Tutorials |  News |  Publications |  FTP Download |  REST API |  Citing RGD |  Contact   

Marker: RH140649

Symbol: RH140649
Also known as: AA859258; 
RGD ID: 5078956
Expected Size: 211 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
Rnor_6.01482,118,751 - 82,118,961NCBIRnor6.0
Rnor_5.01482,802,991 - 82,803,201UniSTSRnor5.0
RGSC_v3.41482,527,754 - 82,527,964UniSTSRGSC3.4
Celera1475,757,383 - 75,757,593UniSTS
Cytogenetic Map14q21UniSTS
Is Marker For: Genes:   Nsd2  


Annotation


References - curated
1. RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer AAATCTGAGGTGATGGCCTTTC
Reverse Primer TAGGGAACACCCTGTCTGGTTT
 

Region

Nucleotide Sequences


QTLs in Region (Rnor_6.0)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
631839Niddm37Non-insulin dependent diabetes mellitus QTL 373.37blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)1412680424106641756Rat
70187Pancm5Pancreatic morphology QTL 516.7pancreas mass (VT:0010144)pancreas weight to body weight ratio (CMO:0000630)143259392686191589Rat
2313048Bss84Bone structure and strength QTL 843.10.0001tibia strength trait (VT:1000284)tibia total energy absorbed before break (CMO:0001736)144031561085315610Rat
2313084Bss83Bone structure and strength QTL 832.90.0001tibia size trait (VT:0100001)tibia midshaft endosteal cross-sectional area (CMO:0001716)144031561085315610Rat
2313089Bss81Bone structure and strength QTL 813.40.0001body length (VT:0001256)body length, nose to rump (CMO:0000079)144031561085315610Rat
2313100Bss82Bone structure and strength QTL 8230.0001tibia size trait (VT:0100001)tibia midshaft cross-sectional area (CMO:0001717)144031561085315610Rat
631523Pia13Pristane induced arthritis QTL 133.3joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1442442731108833671Rat
1300136Rf22Renal function QTL 223.9renal blood flow trait (VT:2000006)absolute change in renal vascular resistance (CMO:0001900)1443910761105074364Rat
1549834Scl45Serum cholesterol level QTL 455.8blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)1451818462105074364Rat
9590294Uminl4Urine mineral level QTL 45.660.001urine mineral amount (VT:0015086)urine electrolyte level (CMO:0000593)1460980905105980905Rat
9589034Epfw11Epididymal fat weight QTL 1160.001epididymal fat pad mass (VT:0010421)epididymal fat pad weight to body weight ratio (CMO:0000658)1460980905105980905Rat
738037Hcas6Hepatocarcinoma susceptibility QTL 62.93liver integrity trait (VT:0010547)liver nonremodeling tumorous lesion volume to total liver volume ratio (CMO:0001464)146187332388870994Rat
2317879Alcrsp27Alcohol response QTL 273.30.63response to alcohol trait (VT:0010489)duration of loss of righting reflex (CMO:0002289)1461993178106993178Rat
634328Hc5Hypercalciuria QTL 52.3urine calcium amount (VT:0002985)urine calcium excretion rate (CMO:0000763)1463548095108548095Rat
70153Bp59Blood pressure QTL 593.2arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)147339146788870994Rat
1582236Gluco22Glucose level QTL 223.30.0164blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)1478172765102549388Rat
1582255Gluco29Glucose level QTL 293.10.0025blood glucose amount (VT:0000188)absolute change in blood glucose level area under curve (CMO:0002034)1478172765102549388Rat
1582197Gluco27Glucose level QTL 273.40.0006blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)1478172765102549388Rat
1582209Gluco20Glucose level QTL 203.80.0005blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)1478172765102549388Rat
1582250Gluco26Glucose level QTL 263.30.0009blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)1478172765106641756Rat
2300197Scl59Serum cholesterol level QTL 59blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)1478446303110402569Rat
1582259Gluco23Glucose level QTL 233.10.0008blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)1480049285115493446Rat
1641900Alcrsp11Alcohol response QTL 11alcohol metabolism trait (VT:0015089)blood ethanol level (CMO:0000535)1480049285115493446Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 680537 UniSTS
UniGene Rn.199098 UniSTS
UniSTS 222718 UniSTS