RH140071 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: RH140071

Symbol: RH140071
Previously known as: AI102513; 
RGD ID: 5077978
Expected Size: 220 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.21456,628,186 - 56,628,404 (+)MAPPERmRatBN7.2
Rnor_6.01458,939,967 - 58,940,184NCBIRnor6.0
Rnor_5.01459,072,380 - 59,072,597UniSTSRnor5.0
RGSC_v3.41461,363,762 - 61,363,979UniSTSRGSC3.4
Celera1455,757,472 - 55,757,689UniSTS


Annotation


References - curated
# Reference Title Reference Citation
1. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer ACAAGTTTGTCCAGTGTCACGC
Reverse Primer CTGCAGTTGGAACTTAAGCCCT
 

Region

Nucleotide Sequences


QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
1581500Renag1Renal agenesis QTL 1kidney development trait (VT:0000527)percentage of study population developing unilateral renal agenesis during a period of time (CMO:0000940)14817066868298175Rat
631839Niddm37Non-insulin dependent diabetes mellitus QTL 373.37blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)141103062295876975Rat
2313397Coatc1Coat color QTL1coat/hair pigmentation trait (VT:0010463)coat/hair color measurement (CMO:0001808)141854133263541332Rat
10755459Coatc15Coat color QTL 150.01681coat/hair pigmentation trait (VT:0010463)pigmented ventral coat/hair area to total ventral coat/hair area ratio (CMO:0001812)141983694464836944Rat
70187Pancm5Pancreatic morphology QTL 516.7pancreas mass (VT:0010144)pancreas weight to body weight ratio (CMO:0000630)143032009280829842Rat
1300154Bp189Blood pressure QTL 1893.04arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)143088377768757901Rat
2313048Bss84Bone structure and strength QTL 843.10.0001tibia strength trait (VT:1000284)tibia total energy absorbed before break (CMO:0001736)143766971982669719Rat
2313084Bss83Bone structure and strength QTL 832.90.0001tibia size trait (VT:0100001)tibia midshaft endosteal cross-sectional area (CMO:0001716)143766971982669719Rat
2313089Bss81Bone structure and strength QTL 813.40.0001body length (VT:0001256)body length, nose to rump (CMO:0000079)143766971982669719Rat
2313100Bss82Bone structure and strength QTL 8230.0001tibia size trait (VT:0100001)tibia midshaft cross-sectional area (CMO:0001717)143766971982669719Rat
738037Hcas6Hepatocarcinoma susceptibility QTL 62.93liver integrity trait (VT:0010547)liver nonremodeling tumorous lesion volume to total liver volume ratio (CMO:0001464)143905723783368335Rat
70214Niddm28Non-insulin dependent diabetes mellitus QTL 284.06blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)143999825175582726Rat
631523Pia13Pristane induced arthritis QTL 133.3joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)144079346098037301Rat
1300136Rf22Renal function QTL 223.9renal blood flow trait (VT:2000006)absolute change in renal vascular resistance (CMO:0001900)144226252995023211Rat
1549834Scl45Serum cholesterol level QTL 455.8blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)145002321195023211Rat
2300197Scl59Serum cholesterol level QTL 59blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)1455147478100147478Rat
9590294Uminl4Urine mineral level QTL 45.660.001urine mineral amount (VT:0015086)urine electrolyte level (CMO:0000593)1455624247100624247Rat
9589034Epfw11Epididymal fat weight QTL 1160.001epididymal fat pad mass (VT:0010421)epididymal fat pad weight to body weight ratio (CMO:0000658)1455624247100624247Rat


Additional Information

Database Acc Id Source(s)
UniSTS 222152 UniSTS