RH140013 Marker Search Result - Rat Genome Database

Send us a Message
Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Search RGD Grant Resources Citing RGD About Us Contact Us
Genes Variants Community Projects QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data
OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer)
Aging & Age-Related Disease Cancer & Neoplastic Disease Cardiovascular Disease Coronavirus Disease Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease
Find Models Genetic Models Autism Models Rat PhenoMiner (Quantitative Phenotypes) Chinchilla PhenoMiner Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive
Pathways
Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Presentations Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources
Advanced Search (OLGA)

Marker: RH140013

Symbol: RH140013
Previously known as:
RGD ID: 5077880
Expected Size: 218 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.21322,907,130 - 22,907,348 (+)MAPPERmRatBN7.2
mRatBN7.22010,280,315 - 10,280,533 (+)MAPPERmRatBN7.2
Rnor_6.02011,001,431 - 11,001,648NCBIRnor6.0
Rnor_6.01326,825,287 - 26,825,504NCBIRnor6.0
Rnor_5.02013,172,334 - 13,172,551UniSTSRnor5.0
Rnor_5.01331,975,763 - 31,975,980UniSTSRnor5.0
RGSC_v3.42010,615,304 - 10,615,521UniSTSRGSC3.4
RGSC_v3.41312,959,869 - 12,960,086UniSTSRGSC3.4
Celera1322,765,535 - 22,765,752UniSTS
Celera2011,789,654 - 11,789,871UniSTS
Cytogenetic Map13p13UniSTS
Is Marker For: Genes:   Vps4b  


Annotation


References - curated
# Reference Title Reference Citation
1. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer AGGAACAATATATTTCCCGCCT
Reverse Primer GTTGTGCCTTGAACATTTGCAT
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
1305969Vps4bvacuolar protein sorting 4 homolog B132290710522932200Rat

Nucleotide Sequences
RefSeq Transcripts NM_001025716 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
GenBank Nucleotide BC099128 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
2317027Aia22Adjuvant induced arthritis QTL 222.29joint integrity trait (VT:0010548)right rear ankle joint diameter (CMO:0002150)13134266636Rat
2302275Gluco37Glucose level QTL 373.8blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)131192944946193066Rat
7207885Glom27Glomerulus QTL 273.9kidney glomerulus integrity trait (VT:0010546)kidney crescentic glomeruli count to kidney normal glomeruli count ratio (CMO:0002139)1320605871101339738Rat
9589141Insul28Insulin level QTL 2810.820.001blood insulin amount (VT:0001560)plasma insulin level (CMO:0000342)13931346554313465Rat
2317034Aia9Adjuvant induced arthritis QTL 94.62joint integrity trait (VT:0010548)left rear ankle joint diameter (CMO:0002149)131176653532331607Rat
1581554Pur11Proteinuria QTL 11urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)13599483377046787Rat
61391Bp5Blood pressure QTL 55.6arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)132230187567301875Rat
1300163Cardf1Cardiac cell morphology QTL 14.18aorta morphology trait (VT:0000272)artery lesion measurement (CMO:0000975)131192944945417941Rat
631672Iddm12Insulin dependent diabetes mellitus QTL 122.20.0032blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)13599466834535351Rat
2317040Aia21Adjuvant induced arthritis QTL 212.75joint integrity trait (VT:0010548)left rear ankle joint diameter (CMO:0002149)13983154154831541Rat
2303031Bp326Blood pressure QTL 326arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)131176653523001904Rat
631645Bp121Blood pressure QTL 1213.3arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)131491565559915655Rat
2317046Aia8Adjuvant induced arthritis QTL 83.9700000286102295joint integrity trait (VT:0010548)left rear ankle joint diameter (CMO:0002149)13983154154831541Rat
2317044Aia23Adjuvant induced arthritis QTL 232.3joint integrity trait (VT:0010548)ankle joint diameter (CMO:0002148)131176653532331607Rat
1581570Eae17Experimental allergic encephalomyelitis QTL 174.1nervous system integrity trait (VT:0010566)experimental autoimmune encephalomyelitis incidence/prevalence measurement (CMO:0001046)138897350101631289Rat
61339Bp24Blood pressure QTL 240.05arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)13599466844807491Rat
1331784Bp222Blood pressure QTL 2222.944arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)131769443653050594Rat
1581573Uae36Urinary albumin excretion QTL 36urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)13599483377046787Rat
1354666Bp244Blood pressure QTL 2444.9arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)131101056920Rat
9589164Gluco66Glucose level QTL 666.670.001blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)131515872260158722Rat
738036Lnnr4Liver neoplastic nodule remodeling QTL 43.64liver integrity trait (VT:0010547)liver remodeling tumorous lesion number (CMO:0001461)13142356786Rat
7411662Foco29Food consumption QTL 2920.80.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)13931346554313465Rat
2317027Aia22Adjuvant induced arthritis QTL 222.29joint integrity trait (VT:0010548)right rear ankle joint diameter (CMO:0002150)13134266636Rat
4889870Pur30Proteinuria QTL 30190.005urine total protein amount (VT:0000032)urine total protein excretion rate (CMO:0000756)20804241029322208Rat
1354642Despr15Despair related QTL 150.0027locomotor behavior trait (VT:0001392)amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)20124159021Rat
9589141Insul28Insulin level QTL 2810.820.001blood insulin amount (VT:0001560)plasma insulin level (CMO:0000342)13931346554313465Rat
2317034Aia9Adjuvant induced arthritis QTL 94.62joint integrity trait (VT:0010548)left rear ankle joint diameter (CMO:0002149)131176653532331607Rat
4889857Pur27Proteinuria QTL 2712.20.001urine total protein amount (VT:0000032)urine total protein excretion rate (CMO:0000756)20460660717617956Rat
70154Insul2Insulin level QTL 23.75blood insulin amount (VT:0001560)plasma insulin level (CMO:0000342)20669170617489458Rat
61391Bp5Blood pressure QTL 55.6arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)132230187567301875Rat
9590109Sffal8Serum free fatty acids level QTL 85.320.01blood free fatty acid amount (VT:0001553)plasma free fatty acids level (CMO:0000546)20129191651Rat
1300163Cardf1Cardiac cell morphology QTL 14.18aorta morphology trait (VT:0000272)artery lesion measurement (CMO:0000975)131192944945417941Rat
9590275Scort15Serum corticosterone level QTL 153.480.001blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)20129191651Rat
1581577Pur15Proteinuria QTL 154.380.0002urine total protein amount (VT:0000032)urine protein excretion rate (CMO:0000759)20804241017617956Rat
2317040Aia21Adjuvant induced arthritis QTL 212.75joint integrity trait (VT:0010548)left rear ankle joint diameter (CMO:0002149)13983154154831541Rat
2303031Bp326Blood pressure QTL 326arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)131176653523001904Rat
631645Bp121Blood pressure QTL 1213.3arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)131491565559915655Rat
2317046Aia8Adjuvant induced arthritis QTL 83.9700000286102295joint integrity trait (VT:0010548)left rear ankle joint diameter (CMO:0002149)13983154154831541Rat
2317044Aia23Adjuvant induced arthritis QTL 232.3joint integrity trait (VT:0010548)ankle joint diameter (CMO:0002148)131176653532331607Rat
1581570Eae17Experimental allergic encephalomyelitis QTL 174.1nervous system integrity trait (VT:0010566)experimental autoimmune encephalomyelitis incidence/prevalence measurement (CMO:0001046)138897350101631289Rat
61339Bp24Blood pressure QTL 240.05arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)13599466844807491Rat
1331784Bp222Blood pressure QTL 2222.944arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)131769443653050594Rat
6893685Bw111Body weight QTL 1112.70.004body mass (VT:0001259)body weight (CMO:0000012)20132578807Rat
1581573Uae36Urinary albumin excretion QTL 36urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)13599483377046787Rat
2302275Gluco37Glucose level QTL 373.8blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)131192944946193066Rat
7207885Glom27Glomerulus QTL 273.9kidney glomerulus integrity trait (VT:0010546)kidney crescentic glomeruli count to kidney normal glomeruli count ratio (CMO:0002139)1320605871101339738Rat
1641915Colcr9Colorectal carcinoma resistance QTL 92.970.0024intestine integrity trait (VT:0010554)benign colorectal tumor number (CMO:0001795)20153065546530655Rat
2317057Aia27Adjuvant induced arthritis QTL 272.83joint integrity trait (VT:0010548)right rear ankle joint diameter (CMO:0002150)20289259726381954Rat
7387283Uae44Urinary albumin excretion QTL 440.1712urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)20126123605Rat
7411668Foco32Food consumption QTL 3280.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)20136600972Rat
2305926Iddm37Insulin dependent diabetes mellitus QTL 376blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)20152784246527842Rat
1600382Edcs3Endometrial carcinoma susceptibility QTL33.50.003uterus morphology trait (VT:0001120)percentage of study population developing endometrioid carcinoma during a period of time (CMO:0001759)20125159026Rat
1558640Prcs2Prostate cancer susceptibility QTL 23.3prostate integrity trait (VT:0010571)percentage of study population developing ventral prostate tumorous lesions during a period of time (CMO:0000943)20460660717617956Rat
631265Iresp1Immunoglobin response QTL18.3blood anti-double stranded DNA antibody amount (VT:0004762)serum anti-DNA antibody level (CMO:0001533)20903971913461775Rat
8694189Bw153Body weight QTL 1533.130.001body mass (VT:0001259)body weight gain (CMO:0000420)20129191651Rat
1581554Pur11Proteinuria QTL 11urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)13599483377046787Rat
631672Iddm12Insulin dependent diabetes mellitus QTL 122.20.0032blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)13599466834535351Rat
9589155Insul32Insulin level QTL 326.380.001blood insulin amount (VT:0001560)plasma insulin level (CMO:0000342)20129191651Rat
7411650Foco23Food consumption QTL 2320.70.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)20129191651Rat
2317851Alcrsp22Alcohol response QTL 223.20.05response to alcohol trait (VT:0010489)duration of loss of righting reflex (CMO:0002289)20127339237Rat
1598816Memor12Memory QTL 122.4exploratory behavior trait (VT:0010471)average horizontal distance between subject and target during voluntary locomotion in an experimental apparatus (CMO:0002674)20260683647606836Rat
61432Cia1Collagen induced arthritis QTL 1joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)20362165614101050Rat
1641893Alcrsp7Alcohol response QTL 7response to alcohol trait (VT:0010489)duration of loss of righting reflex (CMO:0002289)20127339237Rat
1354666Bp244Blood pressure QTL 2444.9arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)131101056920Rat
9589164Gluco66Glucose level QTL 666.670.001blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)131515872260158722Rat
9590252Scort12Serum corticosterone level QTL 1220.460.001blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)20136600972Rat
738036Lnnr4Liver neoplastic nodule remodeling QTL 43.64liver integrity trait (VT:0010547)liver remodeling tumorous lesion number (CMO:0001461)13142356786Rat
7411662Foco29Food consumption QTL 2920.80.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)13931346554313465Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 360834 UniSTS