RH140005 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: RH140005

Symbol: RH140005
Previously known as: AI178075; AI178592; BE107747; 
RGD ID: 5077866
Expected Size: 196 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.213104,698,091 - 104,698,287 (+)MAPPERmRatBN7.2
Rnor_6.013111,896,006 - 111,896,201NCBIRnor6.0
Rnor_5.013116,451,579 - 116,451,774UniSTSRnor5.0
RGSC_v3.413109,012,903 - 109,013,098UniSTSRGSC3.4
Celera13104,128,348 - 104,128,543UniSTS
RH 3.4 Map13758.0UniSTS
Cytogenetic Map13q27UniSTS
Is Marker For: Genes:   Traf3ip3  


Annotation


References - curated
# Reference Title Reference Citation
1. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer TCAATTTATTGAAGGGTTCAACG
Reverse Primer GCTCTTTCTTTGCCTAAGGCTG
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
1304848Traf3ip3TRAF3 interacting protein 313104694802104719655Rat

Nucleotide Sequences
GenBank Nucleotide CH473985 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM000243 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
12879475Bp400Blood pressure QTL 400arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)1361825626106807694Rat
2293702Bss34Bone structure and strength QTL 344.610.0001femur strength trait (VT:0010010)femur midshaft polar moment of inertia (CMO:0001669)1365103704106807694Rat
2293687Bss26Bone structure and strength QTL 264.60.0001femur morphology trait (VT:0000559)femur cross-sectional area (CMO:0001661)1365103704106807694Rat
4889606Gluco63Glucose level QTL 632.860.003blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)1380753256106807694Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 360900 UniSTS
UniSTS 222087 UniSTS