RH137965 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: RH137965

Symbol: RH137965
Previously known as:
RGD ID: 5074348
Expected Size: 175 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.237,769,497 - 7,769,672 (-)MAPPERmRatBN7.2
mRatBN7.21662,847,639 - 62,847,814 (+)MAPPERmRatBN7.2
Rnor_6.01667,035,227 - 67,035,401NCBIRnor6.0
Rnor_6.01667,025,600 - 67,025,774NCBIRnor6.0
Rnor_5.01666,668,077 - 66,668,252NCBIRnor5.0
Rnor_5.01666,831,709 - 66,831,884NCBIRnor5.0
RGSC_v3.435,108,454 - 5,108,628UniSTSRGSC3.4
RGSC_v3.41667,090,219 - 67,090,393UniSTSRGSC3.4
Celera1660,842,646 - 60,842,820UniSTS
Celera32,598,730 - 2,598,904UniSTS
Cytogenetic Map3p13UniSTS
Is Marker For: Genes:   Dph7  


Annotation


References - curated
# Reference Title Reference Citation
1. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer AGCAGTTCCAGGAAGCAAATTC
Reverse Primer ACTTGGCCTTGGGACAATCTAA
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
735079Zmynd19zinc finger, MYND-type containing 19377581337769722Rat



QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
1600378Arunc4Aerobic running capacity QTL 40.03exercise endurance trait (VT:0002332)maximum distance run on treadmill (CMO:0001406)1638024580345693Rat
70205Gcr3Gastric cancer resistance QTL 32.3stomach morphology trait (VT:0000470)stomach tumor depth of invasion (CMO:0001888)161769679182635055Rat
70205Gcr3Gastric cancer resistance QTL 32.3stomach morphology trait (VT:0000470)stomach tumor depth of invasion (CMO:0001888)161769679182635055Rat
70205Gcr3Gastric cancer resistance QTL 32.3stomach morphology trait (VT:0000470)stomach tumor diameter (CMO:0001889)161769679182635055Rat
70205Gcr3Gastric cancer resistance QTL 32.3stomach morphology trait (VT:0000470)stomach tumor diameter (CMO:0001889)161769679182635055Rat
70215Niddm29Non-insulin dependent diabetes mellitus QTL 293.54blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)161900443575226532Rat
2302057Pia29Pristane induced arthritis QTL 293.60.001blood autoantibody amount (VT:0003725)serum immunoglobulin M-type rheumatoid factor level relative to an arbitrary reference serum (CMO:0002111)162173597566735975Rat
8694453Bw172Body weight QTL 1728.330.001retroperitoneal fat pad mass (VT:0010430)retroperitoneal fat pad weight to body weight ratio (CMO:0000635)162432551369325513Rat
6903294Stl30Serum triglyceride level QTL 302.60.0013blood triglyceride amount (VT:0002644)plasma triglyceride level (CMO:0000548)162515279370152793Rat
1578768Stresp22Stress response QTL 222.8thymus mass (VT:0004954)thymus wet weight (CMO:0000855)163528887080288870Rat
2293690Bss45Bone structure and strength QTL 455.130.0001lumbar vertebra morphology trait (VT:0010494)lumbar vertebra cortical cross-sectional area (CMO:0001690)163775215682752156Rat
2300163Bmd64Bone mineral density QTL 645.30.0001lumbar vertebra mineral mass (VT:0010511)volumetric bone mineral density (CMO:0001553)163775215682752156Rat
7205510Activ5Activity QTL 53.780.00028locomotor behavior trait (VT:0001392)number of entries into a discrete space in an experimental apparatus (CMO:0000960)164239634584729064Rat
8694429Bw164Body weight QTL 16450.001body lean mass (VT:0010483)lean tissue morphological measurement (CMO:0002184)165272646484729064Rat
8694364Abfw7Abdominal fat weight QTL 712.220.001visceral adipose mass (VT:0010063)abdominal fat pad weight to body weight ratio (CMO:0000095)165272646484729064Rat
7411648Foco22Food consumption QTL 22150.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)165272646484729064Rat
631525Pia14Pristane induced arthritis QTL 144.4joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)165571108783402471Rat
70202Alc19Alcohol consumption QTL 192.5drinking behavior trait (VT:0001422)ethanol intake volume to total fluid intake volume ratio (CMO:0001591)3127494778Rat
631679Cm10Cardiac mass QTL 107.340.0001heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)3131158234Rat
631831Alc8Alcohol consumption QTL 82.7consumption behavior trait (VT:0002069)calculated ethanol drink intake rate (CMO:0001615)3133230976Rat
61468Bp15Blood pressure QTL 154.4blood pressure trait (VT:0000183)diastolic blood pressure (CMO:0000005)3133278763Rat
61468Bp15Blood pressure QTL 154.4blood pressure trait (VT:0000183)systolic blood pressure (CMO:0000004)3133278763Rat
61468Bp15Blood pressure QTL 154.4blood pressure trait (VT:0000183)pulse pressure (CMO:0000292)3133278763Rat
631545Bp85Blood pressure QTL 853.1arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)3133278763Rat
4889966Bss95Bone structure and strength QTL 954.4tibia area (VT:1000281)tibia-fibula cross-sectional area (CMO:0001718)3136847613Rat
2312664Scl62Serum cholesterol level QTL 620.05blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)3138710544Rat
631568Bp92Blood pressure QTL 922.20.005arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)3139874793Rat
2290452Scl56Serum cholesterol level QTL 562.26blood cholesterol amount (VT:0000180)plasma total cholesterol level (CMO:0000585)3191609953Rat
1358185Ept6Estrogen-induced pituitary tumorigenesis QTL 66.7pituitary gland mass (VT:0010496)pituitary gland wet weight (CMO:0000853)3653764510778823Rat
2292615Ept17Estrogen-induced pituitary tumorigenesis QTL 176.7pituitary gland mass (VT:0010496)pituitary gland wet weight (CMO:0000853)3653764510778823Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 296550 UniSTS
UniSTS 220052 UniSTS