RH137861 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: RH137861

Symbol: RH137861
Previously known as: AW526669; 
RGD ID: 5074168
Expected Size: 139 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.24172,522,615 - 172,522,754 (+)MAPPERmRatBN7.2
Rnor_6.04173,770,513 - 173,770,651NCBIRnor6.0
Rnor_5.04238,011,653 - 238,011,791UniSTSRnor5.0
RGSC_v3.44176,750,473 - 176,750,611UniSTSRGSC3.4
Celera4161,081,066 - 161,081,204UniSTS
RH 3.4 Map41033.6UniSTS
Cytogenetic Map4q44UniSTS
Is Marker For: Genes:   Pik3c2g  


Annotation


References - curated
# Reference Title Reference Citation
1. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer GCTTGTGGAATTTACCTATTCCTG
Reverse Primer TTAGGAGCCTCTATGTGCAAGG
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
620231Pik3c2gphosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 gamma4172483752172851623Rat
41306080LOC120102423uncharacterized LOC1201024234172518596172533761Rat

Nucleotide Sequences
GenBank Nucleotide JH614865.1 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
2316958Gluco58Glucose level QTL 5810blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)411320076180699135Rat
1576316Ept5Estrogen-induced pituitary tumorigenesis QTL 53.8pituitary gland mass (VT:0010496)pituitary gland wet weight (CMO:0000853)483428419177635233Rat
1549827Scl46Serum cholesterol level QTL 463.5blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)4132396220177396220Rat
724558Plsm2Polydactyly-luxate syndrome (PLS) morphotypes QTL 20.0003hindlimb integrity trait (VT:0010563)hind foot phalanges count (CMO:0001949)4132422778177422778Rat
2303623Vencon2Ventilatory control QTL 23.8respiration trait (VT:0001943)minute ventilation (CMO:0000132)4135204660180204660Rat
1578674Bmd12Bone mineral density QTL 123.8femur mineral mass (VT:0010011)compact volumetric bone mineral density (CMO:0001730)4135699135180699135Rat
2293659Bmd35Bone mineral density QTL 354.50.0001femur strength trait (VT:0010010)femoral neck ultimate force (CMO:0001703)4137755016181392681Rat
61362Oia2Oil induced arthritis QTL 20.001joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)4138503169173369699Rat
1298524Oia8Oil induced arthritis QTL 8joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)4138503169173369699Rat
1331738Bp209Blood pressure QTL 2092.979arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)4138503169179293946Rat
6478718Anxrr34Anxiety related response QTL 340.00896locomotor behavior trait (VT:0001392)amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)4144639524182687754Rat
6478748Anxrr42Anxiety related response QTL 420.28008locomotor behavior trait (VT:0001392)amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)4144639524182687754Rat
6478754Anxrr43Anxiety related response QTL 430.14035locomotor behavior trait (VT:0001392)distance moved per unit of time into, out of or within a discrete space in an experimental apparatus (CMO:0001493)4144639524182687754Rat
6478693Anxrr32Anxiety related response QTL 320.00092locomotor behavior trait (VT:0001392)measurement of voluntary locomotion into, out of or within a discrete space in an experimental apparatus (CMO:0000957)4144639524182687754Rat
6478700Anxrr33Anxiety related response QTL 330.00896locomotor behavior trait (VT:0001392)amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)4144639524182687754Rat
10401796Kidm48Kidney mass QTL 48kidney mass (VT:0002707)both kidneys wet weight (CMO:0000085)4145568712182687754Rat
634342Cia24Collagen induced arthritis QTL 244.5joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)4146565735175236377Rat
10053718Scort25Serum corticosterone level QTL 252.150.0097blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)4155561574182687754Rat
1300109Rf13Renal function QTL 133.91renal blood flow trait (VT:2000006)absolute change in renal blood flow rate (CMO:0001168)4157710145182687754Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 116720 UniSTS
UniSTS 219948 UniSTS