RH136924 Marker Search Result - Rat Genome Database
Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Search RGD Grant Resources Citing RGD About Us Contact Us
Genes QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data
OntoMate (Literature Search) JBrowse (Genome Browser) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) RatMine GViewer (Genome Viewer) Overgo Probe Designer ACP Haplotyper Genome Scanner
Aging & Age-Related Disease Cancer Cardiovascular Disease COVID-19 Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease
Find Models   new Genetic Models Autism Models PhenoMiner (Quantitative Phenotypes) Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes GERRC (Gene Editing Rat Resource Center) Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive
Pathways
Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Poster Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources

Marker: RH136924

Symbol: RH136924
Also known as: AA924843; 
RGD ID: 5072568
Expected Size: 198 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
Rnor_6.08117,476,493 - 117,476,690NCBIRnor6.0
Rnor_5.08116,821,289 - 116,821,486UniSTSRnor5.0
RGSC_v3.48113,736,794 - 113,736,991UniSTSRGSC3.4
Celera8108,681,489 - 108,681,686UniSTS
Cytogenetic Map8q32UniSTS
Is Marker For: Genes:   Slc25a20  


Annotation


References - curated
1. RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer GCCTTCCTACATTGTGGCTTTC
Reverse Primer CCCAAAGGACTAGGCAGACAAT
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
621443Slc25a20solute carrier family 25 member 208117455308117476762Rat



QTLs in Region (Rnor_6.0)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
1581557Eae16Experimental allergic encephalomyelitis QTL 163.8nervous system integrity trait (VT:0010566)experimental autoimmune encephalomyelitis incidence/prevalence measurement (CMO:0001046)89531047119211942Rat
631650Stl6Serum triglyceride level QTL 640.0019blood triglyceride amount (VT:0002644)plasma triglyceride level (CMO:0000548)810938911120496129Rat
1554321Bmd3Bone mineral density QTL 37.90.0001femur mineral mass (VT:0010011)volumetric bone mineral density (CMO:0001553)844458129118087517Rat
70197BpQTLcluster8Blood pressure QTL cluster 83.482arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)850529480128036471Rat
70197BpQTLcluster8Blood pressure QTL cluster 83.482arterial blood pressure trait (VT:2000000)absolute change in systolic blood pressure (CMO:0000607)850529480128036471Rat
70197BpQTLcluster8Blood pressure QTL cluster 83.482arterial blood pressure trait (VT:2000000)pulse pressure (CMO:0000292)850529480128036471Rat
70197BpQTLcluster8Blood pressure QTL cluster 83.482arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)850529480128036471Rat
2303171Bp331Blood pressure QTL 3315.570.005arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)865717449128033050Rat
631653Bp125Blood pressure QTL 1253.3arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)872849686117849686Rat
631210Bw3Body weight QTL35.9mesenteric fat pad mass (VT:0010427)mesenteric fat pad weight as a percentage of body weight (CMO:0000654)874917593121080545Rat
1300171Bp184Blood pressure QTL 1843.66arterial blood pressure trait (VT:2000000)blood pressure time series experimental set point of the baroreceptor response (CMO:0002593)876103982127182642Rat
9590292Uminl3Urine mineral level QTL 33.620.001urine mineral amount (VT:0015086)urine electrolyte level (CMO:0000593)878805083123805083Rat
8694446Bw170Body weight QTL 17012.070.001retroperitoneal fat pad mass (VT:0010430)retroperitoneal fat pad weight to body weight ratio (CMO:0000635)878805083123805083Rat
8694200Abfw4Abdominal fat weight QTL 49.070.001visceral adipose mass (VT:0010063)abdominal fat pad weight to body weight ratio (CMO:0000095)878805083123805083Rat
8694392Bw161Body weight QTL 1618.060.001body lean mass (VT:0010483)lean tissue morphological measurement (CMO:0002184)878805083123805083Rat
1549909Stresp11Stress response QTL 116.830.0019stress-related behavior trait (VT:0010451)number of approaches toward negative stimulus before onset of defensive burying response (CMO:0001960)880697934125697934Rat
2300181Bmd55Bone mineral density QTL 555.70.0001femur mineral mass (VT:0010011)volumetric bone mineral density (CMO:0001553)883894304128894304Rat
61437Cia6Collagen induced arthritis QTL 6joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)889058229132243842Rat
2313400Anxrr25Anxiety related response QTL 25aggression-related behavior trait (VT:0015014)tameness/aggressiveness composite score (CMO:0002136)895963141122354314Rat
1358893Bp263Blood pressure QTL 2635.01arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)8100873811133307652Rat
1358903Bp252Blood pressure QTL 25270.0001arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)8100873811133307652Rat
738011Anxrr9Anxiety related response QTL 96.1exploratory behavior trait (VT:0010471)number of entries into a discrete space in an experimental apparatus (CMO:0000960)8102051964133307652Rat
738014Anxrr15Anxiety related response QTL 153.60.005locomotor behavior trait (VT:0001392)amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)8104682575133307652Rat
2300182Bmd56Bone mineral density QTL 565.4femur mineral mass (VT:0010011)volumetric bone mineral density (CMO:0001553)8104682575133307652Rat
724539Cm19Cardiac mass QTL 192.6heart mass (VT:0007028)calculated heart weight (CMO:0000073)8107769005129956433Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 117035 UniSTS
UniSTS 219013 UniSTS