RH135436 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: RH135436

Symbol: RH135436
Previously known as:
RGD ID: 5072050
Expected Size: 208 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.239,182,071 - 9,182,279 (+)MAPPERmRatBN7.2
mRatBN7.2239,697,008 - 39,697,216 (+)MAPPERmRatBN7.2
Rnor_6.0239,484,171 - 39,484,378NCBIRnor6.0
Rnor_6.033,808,603 - 3,808,810NCBIRnor6.0
Rnor_5.039,169,831 - 9,170,038UniSTSRnor5.0
Rnor_5.0258,568,505 - 58,568,712UniSTSRnor5.0
RGSC_v3.4239,432,954 - 39,433,161UniSTSRGSC3.4
RGSC_v3.434,535,302 - 4,535,509UniSTSRGSC3.4
Celera34,001,985 - 4,002,192UniSTS
Celera235,538,129 - 35,538,336UniSTS
Cytogenetic Map3p13UniSTS
Is Marker For: Genes:   Snapc4  


Annotation


References - curated
# Reference Title Reference Citation
1. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer GGAAGTGAGAAACGGGCATTAC
Reverse Primer CTTATACCAGGCAAGAGGCAGG
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
1309048Snapc4small nuclear RNA activating complex, polypeptide 4391820619200819Rat
11405618LOC108350340uncharacterized LOC108350340391732589189568Rat

Nucleotide Sequences
RefSeq Transcripts XM_003749426 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  XM_003753705 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
738010Lnnr3Liver neoplastic nodule remodeling QTL 32.94liver integrity trait (VT:0010547)liver remodeling tumorous lesion number (CMO:0001461)2141244106Rat
61355Bp36Blood pressure QTL 362.9blood pressure trait (VT:0000183)systolic blood pressure (CMO:0000004)25873687102844969Rat
1600379Mcs18Mammary carcinoma susceptibility QTL 182.6mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)2788777242804738Rat
738012Anxrr3Anxiety related response QTL 33.8exploratory behavior trait (VT:0010471)percentage of entries into a discrete space in an experimental apparatus (CMO:0000961)2902351954023519Rat
10755430Coatc6Coat color QTL 60.02576coat/hair pigmentation trait (VT:0010463)pigmented ventral coat/hair area to total ventral coat/hair area ratio (CMO:0001812)21159110056591100Rat
1578664Bmd9Bone mineral QTL density 95femur mineral mass (VT:0010011)total volumetric bone mineral density (CMO:0001728)21185206249003364Rat
731184Mamtr4Mammary tumor resistance QTL 40.0003mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)21649174061491740Rat
1357990Ael1Aortic elastin QTL 13.10.00091aorta elastin amount (VT:0003905)aortic elastin21907682564076825Rat
731167Glom4Glomerulus QTL 42.40.0082kidney glomerulus morphology trait (VT:0005325)count of superficial glomeruli not directly contacting the kidney surface (CMO:0001002)22030467265304672Rat
2300168Bmd47Bone mineral density QTL 476.60.0001femur mineral mass (VT:0010011)bone mineral density (CMO:0001226)22066244865662448Rat
10402051Gdil2Gastrointestinal dilation QTL 2enteric ganglion morphology trait (VT:0001045)length of intestine affected by colonic aganglionosis to total length of colon ratio (CMO:0001836)22490385374786777Rat
1302794Stl27Serum triglyceride level QTL 274.40.0001blood triglyceride amount (VT:0002644)plasma triglyceride level (CMO:0000548)225413423143657569Rat
1358894Kidm24Kidney mass QTL 244.03kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)225413423157142209Rat
1358899Kidm23Kidney mass QTL 233.88kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)225413423157142209Rat
1358901Cm38Cardiac mass QTL 382heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)225413423157142209Rat
1358904Cm39Cardiac mass QTL 392.26heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)225413423157142209Rat
1358910Kidm27Kidney mass QTL 275.77kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)225413423157142209Rat
1358911Kidm28Kidney mass QTL 285.42kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)225413423157142209Rat
1358913Cm41Cardiac mass QTL 412.73heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)225413423203928301Rat
1358917Cm42Cardiac mass QTL 422.82heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)225413423203928301Rat
1358887Bw50Body weight QTL 502.39body mass (VT:0001259)body weight (CMO:0000012)225413652157142078Rat
1358908Bw49Body weight QTL 493.36body mass (VT:0001259)body weight (CMO:0000012)225413652157142078Rat
1354617Bp240Blood pressure QTL 2404arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)22691781781754745Rat
1354617Bp240Blood pressure QTL 2404arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)22691781781754745Rat
1354617Bp240Blood pressure QTL 2404arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)22691781781754745Rat
1354603Bp243Blood pressure QTL 2433.9arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)226917817127469484Rat
2290453Scl55Serum cholesterol level QTL 552.83blood cholesterol amount (VT:0000180)plasma total cholesterol level (CMO:0000585)226917817136917119Rat
1331764Bp205Blood pressure QTL 2053.476arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)22699957143154682Rat
1643006Pain1Pain QTL 13.630.005mechanical nociception trait (VT:0002734)self mutilation severity score (CMO:0002145)22699957148268661Rat
9590095Sffal3Serum free fatty acids level QTL 36.780.001blood free fatty acid amount (VT:0001553)plasma free fatty acids level (CMO:0000546)22715716072157160Rat
1300160Hrtrt3Heart rate QTL 33.62heart pumping trait (VT:2000009)absolute change in heart rate (CMO:0000534)22997159351729300Rat
10755434Coatc7Coat color QTL 70.04794coat/hair pigmentation trait (VT:0010463)pigmented ventral coat/hair area to total ventral coat/hair area ratio (CMO:0001812)23064806575648065Rat
731179Mamtr3Mammary tumor resistance QTL 30.0001mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)23237377043665178Rat
10755436Coatc8Coat color QTL 80.02431coat/hair pigmentation trait (VT:0010463)pigmented ventral coat/hair area to total ventral coat/hair area ratio (CMO:0001812)23502311780023117Rat
61371Edpm1Estrogen-dependent pituitary mass QTL 140.05pituitary gland mass (VT:0010496)pituitary gland wet weight (CMO:0000853)23513484188029593Rat
70202Alc19Alcohol consumption QTL 192.5drinking behavior trait (VT:0001422)ethanol intake volume to total fluid intake volume ratio (CMO:0001591)3127494778Rat
631679Cm10Cardiac mass QTL 107.340.0001heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)3131158234Rat
631831Alc8Alcohol consumption QTL 82.7consumption behavior trait (VT:0002069)calculated ethanol drink intake rate (CMO:0001615)3133230976Rat
61468Bp15Blood pressure QTL 154.4blood pressure trait (VT:0000183)diastolic blood pressure (CMO:0000005)3133278763Rat
61468Bp15Blood pressure QTL 154.4blood pressure trait (VT:0000183)systolic blood pressure (CMO:0000004)3133278763Rat
61468Bp15Blood pressure QTL 154.4blood pressure trait (VT:0000183)pulse pressure (CMO:0000292)3133278763Rat
631545Bp85Blood pressure QTL 853.1arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)3133278763Rat
4889966Bss95Bone structure and strength QTL 954.4tibia area (VT:1000281)tibia-fibula cross-sectional area (CMO:0001718)3136847613Rat
2312664Scl62Serum cholesterol level QTL 620.05blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)3138710544Rat
631568Bp92Blood pressure QTL 922.20.005arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)3139874793Rat
2290452Scl56Serum cholesterol level QTL 562.26blood cholesterol amount (VT:0000180)plasma total cholesterol level (CMO:0000585)3191609953Rat
1358185Ept6Estrogen-induced pituitary tumorigenesis QTL 66.7pituitary gland mass (VT:0010496)pituitary gland wet weight (CMO:0000853)3653764510778823Rat
2292615Ept17Estrogen-induced pituitary tumorigenesis QTL 176.7pituitary gland mass (VT:0010496)pituitary gland wet weight (CMO:0000853)3653764510778823Rat
1298526Arunc3Aerobic running capacity QTL 32.2exercise endurance trait (VT:0002332)maximum distance run on treadmill (CMO:0001406)3822719433703538Rat
10401810Kidm53Kidney mass QTL 53kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)3822719447233430Rat
70203Gcr2Gastric cancer resistance QTL 22.6stomach morphology trait (VT:0000470)stomach tumor susceptibility score (CMO:0002043)3865816227494778Rat
1358357Srcrtb1Stress Responsive Cort Basal QTL 16.360.002blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)3865816227494778Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 362088 UniSTS
UniSTS 218713 UniSTS