RH135335 Marker Search Result - Rat Genome Database
Submit Data |  Help |  Video Tutorials |  News |  Publications |  FTP Download |  REST API |  Citing RGD |  Contact   

Marker: RH135335

Symbol: RH135335
Also known as: AA859203; 
RGD ID: 5071874
Expected Size: 191 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
Rnor_6.01396,229,884 - 96,230,074NCBIRnor6.0
Rnor_5.013100,671,009 - 100,671,199UniSTSRnor5.0
RGSC_v3.41393,979,064 - 93,979,254UniSTSRGSC3.4
Celera1389,636,743 - 89,636,933UniSTS
Cytogenetic Map13q26UniSTS
RH 3.4 Map13608.5UniSTS
Is Marker For: Genes:   Hnrnpu  


Annotation


References - curated
1. RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer AGCAATGTCAGCAACCAGATTC
Reverse Primer CAATCCCAATTATGCCAATTCC
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
620372Hnrnpuheterogeneous nuclear ribonucleoprotein U139622209396238845Rat

Nucleotide Sequences
RefSeq Transcripts NM_057139 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
GenBank Nucleotide BC072529 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (Rnor_6.0)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
1354666Bp244Blood pressure QTL 2444.9arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)131107975663Rat
1354666Bp244Blood pressure QTL 2444.9arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)131107975663Rat
1354666Bp244Blood pressure QTL 2444.9arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)131107975663Rat
1581570Eae17Experimental allergic encephalomyelitis QTL 174.1nervous system integrity trait (VT:0010566)experimental autoimmune encephalomyelitis incidence/prevalence measurement (CMO:0001046)1312193394108478121Rat
7207885Glom27Glomerulus QTL 273.9kidney glomerulus integrity trait (VT:0010546)kidney crescentic glomeruli count to kidney normal glomeruli count ratio (CMO:0002139)1324502279108770533Rat
1354621Rf47Renal function QTL 473.7kidney renin amount (VT:0010559)kidney renin level (CMO:0002166)1335301263107975663Rat
70181BpQTLcluster11Blood pressure QTL cluster 116.922arterial blood pressure trait (VT:2000000)absolute change in mean arterial blood pressure (CMO:0000533)133614753399968921Rat
70181BpQTLcluster11Blood pressure QTL cluster 116.922arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)133614753399968921Rat
70181BpQTLcluster11Blood pressure QTL cluster 116.922arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)133614753399968921Rat
70181BpQTLcluster11Blood pressure QTL cluster 116.922arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)133614753399968921Rat
1298066Bp159Blood pressure QTL 1590.004arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)135156924896569248Rat
1641901Alcrsp6Alcohol response QTL 6response to alcohol trait (VT:0010489)duration of loss of righting reflex (CMO:0002289)1357903612102903612Rat
1354655Bp241Blood pressure QTL 2413.9arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1362975663107975663Rat
12879475Bp400Blood pressure QTL 400arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)1366971778111971778Rat
2293687Bss26Bone structure and strength QTL 264.60.0001femur morphology trait (VT:0000559)femur cross-sectional area (CMO:0001661)1371230858114033958Rat
2293702Bss34Bone structure and strength QTL 344.610.0001femur strength trait (VT:0010010)femur midshaft polar moment of inertia (CMO:0001669)1371230858114033958Rat
7387280Uae43Urinary albumin excretion QTL 435.690.4174urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)1372583716114033958Rat
10755455Coatc13Coat color QTL 130coat/hair pigmentation trait (VT:0010463)pigmented ventral coat/hair area to total ventral coat/hair area ratio (CMO:0001812)777694986114033958Rat
8655959Pur32Proteinuria QTL 328.4total urine protein amount (VT:0000032)urine total protein excretion rate (CMO:0000756)1379567081103613733Rat
2293341Glom15Glomerulus QTL 159.1kidney glomerulus integrity trait (VT:0010546)kidney sclerotic glomeruli count to total glomeruli count ratio (CMO:0001269)1380403559108770687Rat
4889606Gluco63Glucose level QTL 632.860.003blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)1386833393114033958Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 117280 UniSTS
UniSTS 218612 UniSTS