AU047795 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: AU047795

Symbol: AU047795
Also known as:
RGD ID: 5067370
Expected Size: 119 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.2461,161,066 - 61,161,185 (+)MAPPERmRatBN7.2
mRatBN7.24159,522,587 - 159,522,823 (+)MAPPERmRatBN7.2
Rnor_6.04161,026,152 - 161,026,387NCBIRnor6.0
Rnor_6.0459,882,499 - 59,882,617NCBIRnor6.0
Rnor_5.0459,624,303 - 59,624,421UniSTSRnor5.0
Rnor_5.04226,241,268 - 226,241,503UniSTSRnor5.0
RGSC_v3.44163,067,031 - 163,067,266UniSTSRGSC3.4
RGSC_v3.4459,691,473 - 59,691,591UniSTSRGSC3.4
Celera456,247,502 - 56,247,630UniSTS
Celera4148,239,419 - 148,239,654UniSTS
Cytogenetic Map4q22UniSTS
Is Marker For: Genes:   Plxna4  


Annotation


References - curated
1. RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer AGTCCTCATCTGCTCCGAGG
Reverse Primer GTGTGTGTATGTGTGTGTGCG
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
1308074Plxna4plexin A446072024661162206Rat
1563055RGD1563055similar to transcription elongation factor B (SIII), polypeptide 246133418761334902Rat
1310325Chchd3coiled-coil-helix-coiled-coil-helix domain containing 346136035261616850Rat
1565435RGD1565435similar to Hmgb1 protein46180596461806669Rat
621791Exoc4exocyst complex component 446180770662584316Rat
41082831LOC120102446FAD-linked sulfhydryl oxidase ALR-like46209998762100799Rat
1594818LOC689234similar to catechol-O-methyltransferase domain containing 146261638962632132Rat
1308226Lrgukleucine-rich repeats and guanylate kinase domain containing46264722262770268Rat
1308985Slc35b4solute carrier family 35 member B446277699362799013Rat
1594775LOC689277hypothetical protein LOC68927746287878162879361Rat
2092Akr1b1aldo-keto reductase family 1 member B46293203362946126Rat
708475Akr1b8aldo-keto reductase family 1, member B846299724163009815Rat
1308277Akr1b10aldo-keto reductase family 1 member B1046303845963060336Rat
620257Akr1b7aldo-keto reductase family 1, member B746305356063100934Rat
6497379LOC100910662myosin light polypeptide 6-like46306171263063832Rat
735018Bpgmbisphosphoglycerate mutase46313973063168581Rat
40970919LOC120102253uncharacterized LOC12010225346320022963204908Rat
2256Cald1caldesmon 146326578163446936Rat
41095347LOC120102254uncharacterized LOC12010225446336104963362181Rat
11450777LOC108350691uncharacterized LOC10835069146344516263448456Rat
1561995Agbl3AGBL carboxypeptidase 346344878963535538Rat
1549759Tmem140transmembrane protein 14046353647763547478Rat
1563238Cyrencell cycle regulator of NHEJ46354731163553394Rat
1306697Wdr91WD repeat domain 9146355436463591733Rat
1562852Stra8stimulated by retinoic acid 846360144363624777Rat
1565367RGD1565367similar to Solute carrier family 23, member 2 (Sodium-dependent vitamin C transporter 2)46363129263679687Rat
9074622LOC103692099uncharacterized LOC10369209946364549963654542Rat
1310318Cnot4CCR4-NOT transcription complex, subunit 446371277063814355Rat
7739309LOC102553126uncharacterized LOC10255312646381374863829271Rat
1309413Nup205nucleoporin 20546385493463920852Rat
41196132LOC12010225560S ribosomal protein L38-like46392236963936867Rat
1591053Stmp1short transmembrane mitochondrial protein 146392752363937355Rat
1359715Slc13a4solute carrier family 13 member 446394336963988852Rat
1308013Fam180afamily with sequence similarity 180, member A46399286764008047Rat
2319013LOC100365467hypothetical LOC10036546746409466264097040Rat
619806Mtpnmyotrophin46415927364186686Rat
41021819LOC120102764U2 spliceosomal RNA46456265364562792Rat
41309461LOC120102671small nucleolar RNA SNORA1746458071464580842Rat
1588434LOC500081hypothetical LOC50008146481823964819039Rat
7733981LOC102554507uncharacterized LOC10255450746500661265016735Rat
41195642LOC120102763U2 spliceosomal RNA46500716565007263Rat
620023Chrm2cholinergic receptor, muscarinic 246501540865149104Rat
2325414Mir490microRNA 49046504754865047631Rat
3444Ptnpleiotrophin46529373165375572Rat
735049Dgkidiacylglycerol kinase, iota46541087865872733Rat
1306040Creb3l2cAMP responsive element binding protein 3-like 246590757066112078Rat
620752Akr1d1aldo-keto reductase family 1, member D146615424666187505Rat
41237666LOC120102513high mobility group protein B1-like46649212666492794Rat
1560596Trim24tripartite motif-containing 2446666486466717244Rat
1566053SvoplSVOP like46669755066751699Rat
1305055Atp6v0a4ATPase H+ transporting V0 subunit a446676015966842110Rat
1588740Tmem213transmembrane protein 21346682495866831070Rat
1306271RGD1306271similar to KIAA1549 protein46684067466968407Rat
1309236Zc3hav1lzinc finger CCCH-type containing, antiviral 1 like46699419267003207Rat
628694Zc3hav1zinc finger CCCH-type containing, antiviral 146701215167062406Rat
1561363Ttc26tetratricopeptide repeat domain 2646709062267154707Rat
11448653LOC108350693high mobility group protein B1 pseudogene46709136867092710Rat
1310722Ubn2ubinuclein 246716527867251562Rat
41072194LOC12010248960S ribosomal protein L23-like46725589767260205Rat
11451624Trnar-ccu2transfer RNA arginine (anticodon CCU) 246727344867273520Rat
1559476Fmc1formation of mitochondrial complex V assembly factor 146727410467282140Rat
1308651Luc7l2LUC7-like 2 pre-mRNA splicing factor46728759367347986Rat
9320161LOC103692107small nuclear ribonucleoprotein E pseudogene46732695167328859Rat
41372108LOC120102490insulin-induced gene 1 protein-like46733039967331371Rat
1587495Klrg2killer cell lectin like receptor G246736021667374867Rat
1565373Clec2lC-type lectin domain family 2, member L46739211867414539Rat
1309349Hipk2homeodomain interacting protein kinase 246743932767619223Rat
3826Tbxas1thromboxane A synthase 146766496367837096Rat
41142180LOC120102680small nucleolar RNA SNORA1746776730567767435Rat
1308628Parp12poly (ADP-ribose) polymerase family, member 1246782654867885356Rat
1592650Kdm7alysine demethylase 7A46789940767974264Rat
41219357LOC120102491uncharacterized LOC12010249146798822168026091Rat
41161250LOC120102577U6 spliceosomal RNA46803216868032274Rat
1583604Chmp4bl1chromatin modifying protein 4B-like 146804974268050791Rat
1310346Slc37a3solute carrier family 37, member 346810931468153590Rat
1565263Rab19RAB19, member RAS oncogene family46815715968166889Rat
1303251Mkrn1makorin ring finger protein 146817590968197216Rat
40962184LOC120102609small nucleolar RNA SNORA7146819917868199301Rat
1306142Dennd2aDENN domain containing 2A46823301668332235Rat
7643066LOC102554568serine/arginine-rich splicing factor 3-like46834229268343400Rat
1311058Adck2aarF domain containing kinase 246834885368362725Rat
7626918LOC102554668uncharacterized LOC10255466846836299068367488Rat
1308130Ndufb2NADH:ubiquinone oxidoreductase subunit B246836752668374609Rat
619908BrafB-Raf proto-oncogene, serine/threonine kinase46837548468510652Rat
41225554LOC12010225660S ribosomal protein L26-like46839090368395785Rat
7666339LOC102555403ferritin heavy chain-like46843185768436899Rat
1309217Mrps33mitochondrial ribosomal protein S3346859672968605547Rat
40994299LOC120102257uncharacterized LOC12010225746861471568622669Rat
9116769LOC103692103uncharacterized LOC10369210346862670668655436Rat
1585938Tmem178btransmembrane protein 178B46865942569035690Rat
7574135LOC102555151uncharacterized LOC10255515146892487368939499Rat
1562046Agkacylglycerol kinase46911485069193989Rat
1563986Dennd11DENN domain containing 1146919716169266013Rat
1587197Wee2WEE2 oocyte meiosis inhibiting kinase46923904369261576Rat
3760Ssbp1single stranded DNA binding protein 146926602469276135Rat
1560602Tas2r137taste receptor, type 2, member 13746927927669286935Rat
1561194Tas2r108taste receptor, type 2, member 10846928766769288581Rat
1311823Prss37serine protease 3746932297769334555Rat
1333433Olr798-psolfactory receptor pseudogene 79846936072369361664Rat
1332737Olr799olfactory receptor 79946940160669402550Rat
1584755Clec5aC-type lectin domain containing 5A46940712569416872Rat
1560649Tas2r138taste receptor, type 2, member 13846942834469429339Rat
9369725LOC103690059maltase-glucoamylase, intestinal-like46944162669602068Rat
1308368Mgammaltase-glucoamylase46962402469715782Rat
1564286Moxd2monooxygenase, DBH-like 246972469369733188Rat
1303054Prss58serine protease 5846975265169757306Rat
1302947Prss59protease, serine 5946976420669785111Rat
1563848LOC312273Trypsin V-A46979766169803606Rat
708585LOC286960preprotrypsinogen IV46981510769826206Rat
6496223LOC100910843polymerase delta-interacting protein 2-like46985626469857478Rat
708437Prss3bprotease, serine, 3B46987181069875518Rat
6493911LOC100911271uncharacterized LOC10091127147003688070038079Rat
1311446Prss3serine protease 347020308870206562Rat
41142645LOC120102514cell division control protein 42 homolog47020715770207873Rat
1560283Try5trypsin 547021376070217034Rat
1359400Try10trypsin 1047024431470247819Rat
3418Prss2protease, serine, 247027830470283385Rat
1598148LOC679922similar to protease, serine, 347031769070320752Rat
7618053LOC102554637anionic trypsin-2-like47033167370335768Rat
1597830LOC683849similar to Anionic trypsin II precursor (Pretrypsinogen II)47034433870348069Rat
3417Prss1serine protease 147036458970367792Rat
41021783LOC120102259uncharacterized LOC12010225947042230970428425Rat
41226242LOC120102568U6 spliceosomal RNA47044930770449413Rat
1306163Ephb6Eph receptor B647049197370507230Rat
69335Trpv6transient receptor potential cation channel, subfamily V, member 647050734770523013Rat
620636Trpv5transient receptor potential cation channel, subfamily V, member 547053643270562743Rat
1595510Llcfc1LLLL and CFNLAS motif containing 147056620670567592Rat
1565470KelKell metallo-endopeptidase (Kell blood group)47056824170585666Rat
2323329LOC100359812hypothetical LOC10035981247060065270601022Rat
1562066RGD1562066similar to odorant receptor ORZ647067126670672635Rat
2323279LOC100359864hypothetical LOC10035986447075251370753615Rat
70946Pipprolactin induced protein47078762770791921Rat
620869Sval2seminal vesicle antigen-like 247080936670813330Rat
620867Sval1seminal vesicle antigen-like 147084522870856192Rat
1595436Tas2r139taste receptor, type 2, member 13947098528070986239Rat
1562314Tas2r144taste receptor, type 2, member 14447108618271087141Rat
735188Gstk1glutathione S-transferase kappa 147111897971123298Rat
2321500LOC100360758peroxiredoxin-1-like47114152971143722Rat
1594187Tmem139transmembrane protein 13947114707271149151Rat
69274Casp2caspase 247114963271167388Rat
41054799LOC120102741small nucleolar RNA SNORD8847116051571160603Rat
2360Clcn1chloride voltage-gated channel 147117194971201483Rat
1560653Fam131bfamily with sequence similarity 131, member B47120103771210292Rat
41384154LOC120102260uncharacterized LOC12010226047120915971219286Rat
620698Zyxzyxin47123676771246553Rat
1304680Epha1Eph receptor A147124640971260920Rat
41267017LOC120102261uncharacterized LOC12010226147126100871284951Rat
1566290Tas2r143taste receptor, type 2, member 14347128785771288741Rat
1561078Tas2r135taste receptor, type 2, member 13547129291271293877Rat
727853Tas2r126taste receptor, type 2, member 12647133382171334747Rat
1334194Olr801olfactory receptor 80147136649071367431Rat
1333188Olr802olfactory receptor 80247137786971378810Rat
1333811Olr803olfactory receptor 80347138952671390464Rat
1333381Olr804olfactory receptor 80447145036371451316Rat
1359405Fam115efamily with sequence similarity 115, member E47151027871524582Rat
1591778Tcaf2cTRPM8 channel associated factor 2C47155370071567820Rat
1565474Tcaf1TRPM8 channel-associated factor 147158967471639309Rat
1334371Olr805-psolfactory receptor pseudogene 80547166247171662682Rat
11498065LOC10835080840S ribosomal protein S23 pseudogene47167471371675154Rat
1332594Olr806olfactory receptor 80647168893671689889Rat
1333677Olr807olfactory receptor 80747170732671708276Rat
1333950Olr808olfactory receptor 80847174019371741149Rat
41357395LOC120102713small nucleolar RNA SNORA1747175492771755060Rat
1333504Olr809olfactory receptor 80947175974771760682Rat
1333975Olr810olfactory receptor 81047177536871776300Rat
41399876LOC120102605U6 spliceosomal RNA47179492871795029Rat
1333367Olr811olfactory receptor 81147179998271800917Rat
41055517LOC120102159uncharacterized LOC12010215947185448371905362Rat
1334415Olr812olfactory receptor 81247185608471857016Rat
1332716Olr813olfactory receptor 81347187857871879519Rat
1333772Olr814-psolfactory receptor pseudogene 81447189871971899655Rat
1333327Olr815-psolfactory receptor pseudogene 81547190616971906509Rat
1333098Olr816olfactory receptor 81647194234371943275Rat
1587195Olr437olfactory receptor 43747196511871966047Rat
1334209Olr818olfactory receptor 81847197902671979958Rat
40956713LOC120102160uncharacterized LOC12010216047198640571989140Rat
1332872Olr819olfactory receptor 81947201281972013760Rat
11419404LOC108350809glyceraldehyde-3-phosphate dehydrogenase pseudogene47201417272015171Rat
1333011Olr820olfactory receptor 82047203190972032871Rat
1334159Olr821olfactory receptor 82147204632872047290Rat
7517929LOC102548553uncharacterized LOC10254855347208172272088278Rat
620718Arhgef5Rho guanine nucleotide exchange factor 547208720572112316Rat
1563929NoboxNOBOX oogenesis homeobox47212893172134436Rat
1589408Tpk1thiamin pyrophosphokinase 147217013472557707Rat
11481974LOC108350700uncharacterized LOC10835070047224919372293064Rat
41181679LOC120102665small nucleolar RNA SNORA1747278134972781478Rat
1587194LOC502761similar to suppression of tumorigenicity 1347393531073937677Rat
41128409LOC120102161uncharacterized LOC12010216147406270374072374Rat
1307076Cntnap2contactin associated protein 247410945576366434Rat
41075400NEWGENE_40933816transfer RNA valine (anticodon AAC)47472882274728894Rat
7558071LOC102549191uncharacterized LOC10254919147501451575018378Rat
9287263LOC103692120uncharacterized LOC10369212047521592875218753Rat
40926761LOC120102681small nucleolar RNA SNORA1747557598075576108Rat
7580004LOC102549132uncharacterized LOC10254913247591043575915630Rat
7613801LOC102553884uncharacterized LOC10255388447633415976429716Rat
2322482LOC100360269hypothetical LOC10036026947649790576498598Rat
1308157Cul1cullin 147655195276625830Rat
1595860Ezh2enhancer of zeste 2 polycomb repressive complex 2 subunit47662439976687362Rat
41101884LOC120102262uncharacterized LOC12010226247676728476777220Rat
619835Pdia4protein disulfide isomerase family A, member 447680319876822245Rat
2293500Zfp786zinc finger protein 78647682238376840943Rat
1562129Zfp398zinc finger protein 39847684967276881075Rat
1306278Zfp282zinc finger protein 28247688492476911370Rat
1307836Zfp212Zinc finger protein 21247692363876936076Rat
1304879Zfp956zinc finger protein 95647694323976967238Rat
9367833LOC103692140ATP synthase subunit delta, mitochondrial pseudogene47694416876946742Rat
11410744Trnac-gca1transfer RNA cysteine (anticodon GCA) 147698021376980284Rat
1566056Zfp777zinc finger protein 77747701636377044008Rat
1306209Zfp746zinc finger protein 74647705500877078968Rat
11470191Trnac-gca2transfer RNA cysteine (anticodon GCA) 247712214477122215Rat
11469937Trnac-gca3transfer RNA cysteine (anticodon GCA) 347712755777127628Rat
11368266Trnac-gca4transfer RNA cysteine (anticodon GCA) 447712852177128592Rat
11383953Trnac-gca5transfer RNA cysteine (anticodon GCA) 547713610077136171Rat
11445921Trnac-gca6transfer RNA cysteine (anticodon GCA) 647713711577137186Rat
11466918Trnac-gca7transfer RNA cysteine (anticodon GCA) 747714011377140184Rat
11391872Trnac-gca9transfer RNA cysteine (anticodon GCA) 947716356377163634Rat
11491518Trnac-gca10transfer RNA cysteine (anticodon GCA) 1047717826077178331Rat
11515722Trnac-gca11transfer RNA cysteine (anticodon GCA) 1147718033477180405Rat
11490908Trnac-gca12transfer RNA cysteine (anticodon GCA) 1247718288577182956Rat
11462536Trnac-gca13transfer RNA cysteine (anticodon GCA) 1347719026477190335Rat
11424934LOC108350703uncharacterized LOC10835070347719590077341432Rat
11380450Trnac-gca39transfer RNA cysteine (anticodon GCA) 3947720206277202133Rat
11365902Trnac-gca14transfer RNA cysteine (anticodon GCA) 1447720364177203712Rat
11442637Trnac-gca15transfer RNA cysteine (anticodon GCA) 1547720984077209911Rat
11515107Trnac-gca16transfer RNA cysteine (anticodon GCA) 1647723254277232613Rat
11368396Trnac-gca17transfer RNA cysteine (anticodon GCA) 1747723542477235495Rat
11517337Trnac-gca18transfer RNA cysteine (anticodon GCA) 1847723641577236486Rat
1583518LOC681173similar to mitochondrial ribosomal protein L1747725297477253783Rat
11448279Trnac-gca19transfer RNA cysteine (anticodon GCA) 1947726528277265353Rat
11497862Trnac-gca20transfer RNA cysteine (anticodon GCA) 2047726629777266368Rat
11415393Trnac-gca21transfer RNA cysteine (anticodon GCA) 2147727232077272391Rat
11400791Trnac-gca22transfer RNA cysteine (anticodon GCA) 2247727333277273403Rat
11453373Trnac-gca23transfer RNA cysteine (anticodon GCA) 2347727609477276165Rat
1564070Fgfr1-ps1fibroblast growth factor receptor 1, pseudogene 147727960477282022Rat
11397796Trnac-gca24transfer RNA cysteine (anticodon GCA) 2447728288577282956Rat
11420199Trnac-gca25transfer RNA cysteine (anticodon GCA) 2547728386677283937Rat
11386332Trnac-gca26transfer RNA cysteine (anticodon GCA) 2647729489477294965Rat
11390635Trnac-gca27transfer RNA cysteine (anticodon GCA) 2747729587377295944Rat
11467847Trnac-gca28transfer RNA cysteine (anticodon GCA) 2847730766177307732Rat
1306967Krba1KRAB-A domain containing 147734165477363075Rat
1561603Zfp467zinc finger protein 46747738575277394709Rat
1549716SspoSCO-spondin47739491577450526Rat
41321371LOC120102263uncharacterized LOC12010226347744562977451151Rat
1598054Zfp862zinc finger protein 86247745293077481981Rat
1303238Atp6v0e2ATPase, H+ transporting V0 subunit e247748486877488016Rat
1561800Lrrc61leucine rich repeat containing 6147750385777523909Rat
1309874Rarres2retinoic acid receptor responder 247752254977525733Rat
2323359LOC100363281hypothetical LOC10036328147753819177545808Rat
1549707Repin1replication initiator 147754872277554242Rat
1304910Zfp775zinc finger protein 77547755703777575296Rat
1559747RGD1559747similar to Zinc finger and SCAN domain containing protein 2 (Zinc finger protein 29)47757987777585815Rat
1564570Gimap8GTPase, IMAP family member 847760010477611593Rat
1597980LOC681294similar to phasmid Socket Absent PSA-4, homolog of SWI2/SNF2-related matrix-associated actin-dependent regulator of chromatin, required for an asymmetric cell division (170.6 kD) (psa-4)47762142377622617Rat
1549762Gimap9GTPase, IMAP family member 947762655377629386Rat
628765Gimap4GTPase, IMAP family member 447763640177643315Rat
1305041Gimap6GTPase, IMAP family member 647765370377659112Rat
1565750Gimap7GTPase, IMAP family member 747767052277674692Rat
1306777Gimap1GTPase, IMAP family member 147768758177691468Rat
628871Gimap5GTPase, IMAP family member 547769341777701025Rat
41023422LOC120102264uncharacterized LOC12010226447769389877696051Rat
708403Tmem176btransmembrane protein 176B47776692877774740Rat
1310725Tmem176atransmembrane protein 176A47777494077778620Rat
41166541LOC120102515uncharacterized LOC12010251547778078477793017Rat
61296Aoc1amine oxidase, copper containing 147781226077831846Rat
1587193LOC502765similar to disabled homolog 2 (Drosophila) interacting protein47784161377844707Rat
11436055LOC108350705amiloride-sensitive amine oxidase [copper-containing]-like47787153177873395Rat
735023Doxl1diamine oxidase-like protein 147787942877883044Rat
40942986LOC120102699small nucleolar RNA SNORA1747788726377887385Rat
735130Doxl2diamine oxidase-like protein 247793455177938333Rat
2323010LOC100363435hypothetical LOC10036343547794799777948862Rat
708424Svs1seminal vesicle secretory protein 147795547877960376Rat
7661434LOC102546557uncharacterized LOC10254655747799003977994867Rat
71008Gpnmbglycoprotein nmb47801024778031491Rat
1306936Malsu1mitochondrial assembly of ribosomal large subunit 147805109078059913Rat
1306512Igf2bp3insulin-like growth factor 2 mRNA binding protein 347806049478195007Rat
1562563Tra2atransformer 2 alpha homolog47822083878239737Rat
1583234Gemin7l1gem (nuclear organelle) associated protein 7-like 147826989578270697Rat
41148600LOC120102265uncharacterized LOC12010226547827987078287108Rat
41214177LOC120102162prothymosin alpha-like47829254878293734Rat
1561171Ccdc126coiled-coil domain containing 12647829762578318655Rat
6497475LOC100910678coiled-coil domain-containing protein 72-like47833066378331163Rat
11412043LOC10835085860S ribosomal protein L17 pseudogene47833370478336111Rat
1563175Fam221afamily with sequence similarity 221, member A47833729678358918Rat
1563352RGD1563352similar to ribosomal protein S1147836759778368077Rat
1564384Stk31serine threonine kinase 3147837069178467599Rat
41158599LOC120102266uncharacterized LOC12010226647850726778513680Rat
41201656LOC120102267uncharacterized LOC12010226747851382078519021Rat
6485532LOC10091280114-3-3 protein theta-like47855544378556936Rat
1564712RGD1564712RGD156471247865228978679549Rat
3197Npyneuropeptide Y47888129478888495Rat
7571074LOC102555694uncharacterized LOC10255569447903911779041508Rat
41298329LOC120102516basic proline-rich protein-like47916687779179773Rat
1311833Pals2protein associated with LIN7 2, MAGUK p55 family member47917348879257542Rat
727871Gsdmegasdermin E47925879979321129Rat
1564287Osbpl3oxysterol binding protein-like 347934658379523523Rat
41162112LOC120102268uncharacterized LOC12010226847952343879529558Rat
2319409LOC100365265hypothetical LOC10036526547957764879578130Rat
41061164LOC120102676small nucleolar RNA SNORA1747962350279623632Rat
1565415RGD1565415similar to ribosomal protein L27a47963353979634311Rat
2451Cycscytochrome c, somatic47965189479653994Rat
7624339LOC102546410uncharacterized LOC10254641047965417279689329Rat
1563788LOC500124similar to RIKEN cDNA 4921507P0747966337579688282Rat
61815Npvfneuropeptide VF precursor47971252079716236Rat
11401676LOC108350707uncharacterized LOC10835070747979076779795915Rat
1593814LOC685443similar to Serine/threonine-protein kinase 6 (Aurora-A) (ratAurA)47981143179812875Rat
2319193LOC100365386hypothetical LOC10036538647985997579860338Rat
7508808LOC102546824uncharacterized LOC10254682447999538680054736Rat
41052635LOC120102269uncharacterized LOC12010226948011040280114314Rat
41083837LOC120102163uncharacterized LOC12010216348018866680191301Rat
1592878LOC681658similar to CCAAT displacement protein isoform b48026982180271956Rat
9685082Mir148amicroRNA 148a48033376280333858Rat
7657543LOC102549423uncharacterized LOC10254942348041680780427041Rat
41399556LOC120102270uncharacterized LOC12010227048047185780479206Rat
1307730Nfe2l3nuclear factor, erythroid 2-like 348050675680534629Rat
1310403Hnrnpa2b1heterogeneous nuclear ribonucleoprotein A2/B148053465980545297Rat
1549705Cbx3chromobox 348054545080559284Rat
1561341RGD1561341similar to Translocase of outer mitochondrial membrane 20 homolog48060334280603836Rat
1305782Snx10sorting nexin 1048061264880677005Rat
41025668LOC120102271MICOS complex subunit MIC13-like48062378580625489Rat
41106900LOC120102272uncharacterized LOC12010227248063104480644379Rat
41093189LOC120102273uncharacterized LOC12010227348082463680828739Rat
41305549LOC120102274uncharacterized LOC12010227448082881280830571Rat
41108658LOC120102517uncharacterized LOC12010251748089814280924068Rat
620159Skap2src kinase associated phosphoprotein 248094883281100900Rat
7570592LOC102550087uncharacterized LOC10255008748110093781144318Rat
41173484LOC12010216460S ribosomal protein L21-like48117475881175534Rat
11420575LOC10835086060S ribosomal protein L31 pseudogene48119187681192258Rat
41099928LOC120102275uncharacterized LOC12010227548119303681208800Rat
11414885Hoxa1homeobox A148125581481258504Rat
7716070Hotairm1Hoxa transcript antisense RNA, myeloid-specific 148125879381262291Rat
1561431Hoxa3homeobox A348126924381313218Rat
7620814LOC102546856uncharacterized LOC10254685648127531381293064Rat
40941309LOC120102276uncharacterized LOC12010227648128008781281256Rat
2814Hoxa4homeo box A448128967781291685Rat
10398773Hoxaas3Hoxa cluster antisense RNA 348130125481313958Rat
620609Hoxa5homeo box A548130234181306234Rat
1590236Hoxa6homeobox A648130491881313184Rat
1587253Hoxa7homeobox A748131573081317629Rat
1310001Hoxa9homeobox A948132323581329344Rat
2314882Mir196bmicroRNA 196b48133048781330571Rat
6491746LOC100911668homeobox protein Hox-A10-like48133159181341241Rat
1564605Hoxa11homeobox A1148134252781346189Rat
1564419Hoxa11-asHOXA11 antisense RNA48134641681350190Rat
1562483Hoxa13homeo box A1348135895681361091Rat
41113909LOC120102165NADH dehydrogenase [ubiquinone] 1 beta subcomplex subunit 4-like48147423881474752Rat
40974159LOC120102277uncharacterized LOC12010227748157824081580768Rat
41226461LOC120102278uncharacterized LOC12010227848161340681619082Rat
708399Hibadh3-hydroxyisobutyrate dehydrogenase48164918081747244Rat
1593850LOC685406LRRGT0006248168222481688735Rat
1595057LOC685391LRRGT0006348169291681699598Rat
41150076LOC120102279uncharacterized LOC12010227948170440281727173Rat
708579Tax1bp1Tax1 binding protein 148182199181877906Rat
1589007Jazf1JAZF zinc finger 148187950182183241Rat
7551122LOC102548643serine/arginine-rich splicing factor 7-like48214009382142214Rat
11492396LOC108350711uncharacterized LOC10835071148215375582165281Rat
40973112LOC120102280uncharacterized LOC12010228048225601382264460Rat
41294070LOC120102518creatine kinase U-type, mitochondrial-like48228467082319694Rat
41301986LOC120102651small nucleolar RNA SNORA4848229639982296539Rat
41028316LOC120102281uncharacterized LOC12010228148232552182347057Rat
1566107Creb5cAMP responsive element binding protein 548239309182794320Rat
1310827TrilTLR4 interactor with leucine-rich repeats48292232782927172Rat
41074832LOC120102667small nucleolar RNA SNORA1748298003982980170Rat
1563609Cpvlcarboxypeptidase, vitellogenic-like48298142183091730Rat
620140Chn2chimerin 248314861683407711Rat
41059633LOC120102282uncharacterized LOC12010228248317836983186721Rat
41039183LOC120102283uncharacterized LOC12010228348318245483189341Rat
7593775LOC102553678uncharacterized LOC10255367848336464383376599Rat
1311589Prr15proline rich 1548343200283435582Rat
41347976LOC120102519elongation factor 1-beta-like48344887783449544Rat
708559Wipf3WAS/WASL interacting protein family, member 348355007583629929Rat
1560999Scrn1secernin 148363212583694225Rat
7685582LOC102553885uncharacterized LOC10255388548369316083711573Rat
1311705Fkbp14FKBP prolyl isomerase 1448370553183721515Rat
1563940Plekha8pleckstrin homology domain containing A848372347083774081Rat
7537419LOC102554291mitochondrial import receptor subunit TOM7 homolog48373880383743666Rat
1549700Mturnmaturin, neural progenitor differentiation regulator homolog48380752883828494Rat
6500991LOC100909941uncharacterized LOC10090994148387056083875187Rat
1306645Znrf2zinc and ring finger 248395040684032676Rat
1562269Nod1nucleotide-binding oligomerization domain containing 148406087184111668Rat
41396160LOC120102675small nucleolar RNA SNORA1748411420284114328Rat
1304876Ggctgamma-glutamyl cyclotransferase48412292184129327Rat
2325113LOC10035961360S ribosomal protein L12-like48414816584152462Rat
7703180LOC102550675uncharacterized LOC10255067548415456384170509Rat
1307856Gars1glycyl-tRNA synthetase 148417159684212609Rat
70547Crhr2corticotropin releasing hormone receptor 248422289784265924Rat
7724284LOC102550746uncharacterized LOC10255074648428875284310594Rat
1597087Inmtindolethylamine N-methyltransferase48431819784322493Rat
1562590Mindy4MINDY lysine 48 deubiquitinase 448435866084469189Rat
2141Aqp1aquaporin 148448251284494690Rat
2688Ghrhrgrowth hormone releasing hormone receptor48449815984532847Rat
7509699LOC102551107uncharacterized LOC10255110748454311884560009Rat
2038Adcyap1r1ADCYAP receptor type I48459355884642700Rat
41043092LOC120102284uncharacterized LOC12010228448480010684817508Rat
1562793Neurod6neuronal differentiation 648484665984849905Rat
1561131Itprid1ITPR interacting domain containing 148501526485172457Rat
628647Ppp1r17protein phosphatase 1, regulatory subunit 1748521359585230607Rat
68332Pde1cphosphodiesterase 1C48530085885777948Rat
40966591LOC120102285MICOS complex subunit Mic26-like48531798985318559Rat
41079727NEWGENE_40938314transfer RNA serine (anticodon AGA)48548230785482381Rat
41168976NEWGENE_6576114transfer RNA threonine (anticodon AGU)48552640985526483Rat
41243681LOC120102661small nucleolar RNA SNORA1748579175085791883Rat
41177763LOC120102688small nucleolar RNA SNORA1748581335885813483Rat
1565107RGD1565107similar to 40S ribosomal protein SA (p40) (34/67 kDa laminin receptor)48586753285868460Rat
1308655Lsm5LSM5 homolog, U6 small nuclear RNA and mRNA degradation associated48595107385954289Rat
1564615Avl9AVL9 cell migration associated48596149386008347Rat
1310317Kbtbd2kelch repeat and BTB domain containing 248602794786050266Rat
1549757Fkbp9FKBP prolyl isomerase 948610625686156723Rat
1312013Nt5c3a5'-nucleotidase, cytosolic IIIA48616164286204671Rat
41297101LOC120102286uncharacterized LOC12010228648618482886206190Rat
1585226LOC688782similar to Heterogeneous nuclear ribonucleoprotein A1 (Helix-destabilizing protein) (Single-strand binding protein) (hnRNP core protein A1) (HDP-1) (Topoisomerase-inhibitor suppressed)48621647386218622Rat
1585214Vom1r65vomeronasal 1 receptor 6548623591286245705Rat
11356528LOC108350861glyceraldehyde-3-phosphate dehydrogenase pseudogene48625213086253132Rat
1549708Vom1r67vomeronasal 1 receptor 6748626771986268663Rat
1549744Vom1r66vomeronasal 1 receptor 6648628841586289326Rat
2316407Vom1r-ps69vomeronasal 1 receptor pseudogene 6948632957886330574Rat
1584130Vom1r-ps70vomeronasal 1 receptor pseudogene 7048634301886343928Rat
1549721Vom1r68vomeronasal 1 receptor 6848638056786381478Rat
1549722Vom1r69vomeronasal 1 receptor 6948639457186395479Rat
2323070Selenot-ps1selenoprotein T, pseudogene 148639863886399185Rat
1549710Vom1r70vomeronasal 1 receptor 7048644777886449039Rat
1549777Vom1r71vomeronasal 1 receptor 7148653684786538197Rat
1549709Vom1r72vomeronasal 1 receptor 7248662671886627617Rat
41345109LOC120102166heat shock protein HSP 90-alpha-like48663089386631975Rat
1549715Vom1r73vomeronasal 1 receptor 7348668476586685682Rat
1582950Vom1r-ps71vomeronasal 1 receptor pseudogene 7148671349186714388Rat
6487873LOC100912229tubulin gamma-1 chain-like48671611286717437Rat
1549695Vom1r74vomeronasal 1 receptor 7448674378186744692Rat
11405111Vom1r75vomeronasal 1 receptor 7548675662486757556Rat
1549714Vom1r76vomeronasal 1 receptor 7648678181586782714Rat
1597453LOC689033hypothetical protein LOC68903348679106886796467Rat
1359218Vom1r77vomeronasal 1 receptor 7748680140086802317Rat
9351699LOC10369489440S ribosomal protein S6 pseudogene48681994286820686Rat
9290612LOC10369214440S ribosomal protein S6 pseudogene48684360986845120Rat
1549704Vom1r78vomeronasal 1 receptor 7848687204986872966Rat
1359257Vom1r79vomeronasal 1 receptor 7948691076686912251Rat
1549747Vom1r80vomeronasal 1 receptor 8048695493286955833Rat
1587250LOC500147similar to tubulin, gamma 148695738286958820Rat
1549765Vom1r81vomeronasal 1 receptor 8148697716786978099Rat
1596167Vom1r-ps72vomeronasal 1 receptor pseudogene 7248701153087012437Rat
1549746Vom1r82vomeronasal 1 receptor 8248704874187049637Rat
1560845Vom1r-ps73vomeronasal 1 receptor pseudogene 7348706579587066329Rat
1549731Vom1r83vomeronasal 1 receptor 8348711393687114844Rat
1549753Vom1r84vomeronasal 1 receptor 8448713607487136982Rat
1549732Vom1r85vomeronasal 1 receptor 8548716095987161867Rat
1549696Vom1r86vomeronasal 1 receptor 8648719852587199433Rat
1587190Vom1r-ps74vomeronasal 1 receptor pseudogene 7448723150487232398Rat
1549756Vom1r87vomeronasal 1 receptor 8748725550387256755Rat
1596849Vom1r-ps111vomeronasal 1 receptor pseudogene 11148730700087307908Rat
1549699Vom1r88vomeronasal 1 receptor 8848734693387347826Rat
1306494Vopp1VOPP1 WW domain binding protein48736367887432747Rat
1310809Lancl2LanC like 248744182187483707Rat
1565524PyurfPIGY upstream open reading frame48750185987505494Rat
1561739Herc6HECT and RLD domain containing E3 ubiquitin protein ligase family member 648752447087566895Rat
1563162LOC500148similar to 40S ribosomal protein S7 (S8)48759277387602036Rat
1308501Ppm1kprotein phosphatase, Mg2+/Mn2+ dependent, 1K48761219887638993Rat
631345Abcg2ATP binding cassette subfamily G member 248767624187802757Rat
41258840LOC120102567U6 spliceosomal RNA48784604487846150Rat
1587249LOC500149similar to peptidylprolyl isomerase D48785508187856880Rat
41250383LOC120102287uncharacterized LOC12010228748794191487952110Rat
1307803Herc3HECT and RLD domain containing E3 ubiquitin protein ligase 348795220288042492Rat
1584123Nap1l5nucleosome assembly protein 1-like 548802267088024988Rat
1309807Fam13afamily with sequence similarity 13, member A48805652188155782Rat
41392412LOC120102697small nucleolar RNA SNORA1748824063988240769Rat
1593482LOC689382hypothetical protein LOC68938248826755188268264Rat
1559612Tigd2tigger transposable element derived 248841436688417458Rat
2322105LOC100360451hypothetical LOC10036045148855134588555553Rat
1565690Gprin3GPRIN family member 348856370888657603Rat
11451272LOC108350862uncharacterized LOC10835086248876271388780061Rat
41312835LOC120102520uncharacterized LOC12010252048894704088947688Rat
41381715LOC120102288uncharacterized LOC12010228848944218589475598Rat
3729Sncasynuclein alpha48969642089797240Rat
1591097LOC689530similar to Alpha-enolase (2-phospho-D-glycerate hydro-lyase) (Non-neural enolase) (NNE) (Enolase 1)48987254889873844Rat
1587248Mmrn1multimerin 148987540889950814Rat
2321912LOC100360545protein phosphatase 6, catalytic subunit48997047089997261Rat
41044388LOC120102751U2 spliceosomal RNA49015113790151328Rat
1565731Ccser1coiled-coil serine-rich protein 149015387391391441Rat
41195085LOC120102492uncharacterized LOC12010249249081616490869483Rat
11450417LOC108350840uncharacterized LOC10835084049087966590931441Rat
11440908LOC108350839high mobility group protein B1-like49130690291309095Rat
40994091LOC120102521multifunctional protein ADE2-like49164710291648078Rat
41059287LOC120102620U7 small nuclear RNA49171696791717031Rat
620960Hint1-ps1histidine triad nucleotide binding protein 1, pseudogene 149210099492101568Rat
9264819Tshr-ps1thyroid stimulating hormone receptor, pseudogene 149214265692143138Rat
68368Grid2glutamate ionotropic receptor delta type subunit 249241501993892472Rat
41193354LOC120102493uncharacterized LOC12010249349329282193299590Rat
40926323LOC120102600U6 spliceosomal RNA49362423893624344Rat
41104383LOC120102494uncharacterized LOC12010249449389284393911169Rat
1565171Atoh1atonal bHLH transcription factor 149391206893914163Rat
41221465LOC120102615U7 small nuclear RNA49406097694061038Rat
40929032LOC120102616U7 small nuclear RNA49406112494061185Rat
1588783LOC689705hypothetical protein LOC68970549406540194065784Rat
41255876LOC120102647small nucleolar RNA SNORA4849414489094145033Rat
1587189LOC502786similar to non-POU domain containing, octamer-binding49415739794158751Rat
1309640Smarcad1SWI/SNF-related, matrix-associated actin-dependent regulator of chromatin, subfamily a, containing DEAD/H box 1`49431144194379184Rat
69251Hpgdshematopoietic prostaglandin D synthase49436842694397931Rat
41269840LOC1201022897,8-dihydro-8-oxoguanine triphosphatase-like49438167994382041Rat
9386529LOC10369215114-3-3 protein theta pseudogene49449111694491862Rat
1560028RGD1560028similar to RIKEN cDNA C130060K24 gene49467837094757034Rat
1588732Tnip3TNFAIP3 interacting protein 349486725894908780Rat
1311080Ndnfneuron-derived neurotrophic factor49494474994987414Rat
40991721LOC120102726small nucleolar RNA SNORA1749499311894993219Rat
41386173NEWGENE_40940579transfer RNA leucine (anticodon AAG)49503448895034569Rat
1588700Prdm5PR/SET domain 549507573695237921Rat
735071RSA-14-44RSA-14-44 protein49525165795253029Rat
41323200LOC120102581U6 spliceosomal RNA49528482095284926Rat
1307592Lin28clin-28 homolog C (C. elegans)49541756695420497Rat
1587188LOC502787similar to eukaryotic translation initiation factor 4, gamma 1 isoform a49559026595592593Rat
1587548LOC689832similar to 60S ribosomal protein L7a49563296895633283Rat
1564699RGD1564699similar to High mobility group protein 1 (HMG-1)49574279595743265Rat
41361057LOC12010229060S ribosomal protein L21-like49578372795784432Rat
41328136LOC120102650small nucleolar RNA SNORA4849582653795826676Rat
1310889Mad2l1mitotic arrest deficient 2 like 149590669295918885Rat
1359215Vom1r89vomeronasal 1 receptor 8949594262695943550Rat
621516Gng12G protein subunit gamma 1249601111896134767Rat
41081979LOC120102712U1 spliceosomal RNA49614656196146710Rat
2654Gadd45agrowth arrest and DNA-damage-inducible, alpha49615478996157091Rat
6488311LOC100912188uncharacterized LOC10091218849615649096204457Rat
619907Serbp1Serpine1 mRNA binding protein 149640158796421816Rat
41196388LOC120102291uncharacterized LOC12010229149641626996417217Rat
620026Il12rb2interleukin 12 receptor subunit beta 249642461596515327Rat
41121586LOC120102292uncharacterized LOC12010229249643512196439487Rat
1586368Il23rinterleukin 23 receptor49658056896672540Rat
1359498Tacstd2tumor-associated calcium signal transducer 249670795096709650Rat
41113583LOC120102728small nucleolar RNA SNORA1749681038496810504Rat
41316092LOC120102682small nucleolar RNA SNORA1749685191196852043Rat
41337280LOC120102727small nucleolar RNA SNORA1749688594096886060Rat
11362919LOC108353269Ig kappa chain V-II region 26-10-like49696857496969477Rat
41059548LOC120102691small nucleolar RNA SNORA1749698993796990067Rat
41107960LOC120102702small nucleolar RNA SNORA1749700031297000443Rat
41251011LOC120102700small nucleolar RNA SNORA1749709688597097017Rat
9438141LOC103690610Ig kappa chain V-V region L6-like49711573297119085Rat
41170451LOC120102696small nucleolar RNA SNORA1749713082197130958Rat
41215295LOC120102732small nucleolar RNA SNORA1749715488097155000Rat
41112623LOC120102736small nucleolar RNA SNORA1749717502897175121Rat
40942068LOC120102704small nucleolar RNA SNORA1749722965597229787Rat
9102747LOC103692159Ig kappa chain V-V region L6-like49734899497349801Rat
40977765LOC120102731small nucleolar RNA SNORA1749748051797480618Rat
11364654LOC108350814Ig kappa chain V-V region L6-like49749492997495415Rat
9439280LOC103692161uncharacterized LOC10369216149757291097573408Rat
40936449LOC120102716small nucleolar RNA SNORA1749757666097576791Rat
2322825LOC100363522hypothetical protein LOC10036352249780939697810460Rat
9330732LOC103690609NADH dehydrogenase [ubiquinone] 1 beta subcomplex subunit 3 pseudogene49782873997829070Rat
11052016LOC102551948Ig kappa chain V-II region RPMI 6410-like49791651997917533Rat
41045910LOC120102715small nucleolar RNA SNORA1749796989597970021Rat
6495277LOC100911032uncharacterized LOC10091103249800125798002145Rat
41327009LOC120102729small nucleolar RNA SNORA1749800423498004360Rat
1561722RGD1561722similar to immunoglobulin light chain49813078798131675Rat
41094682LOC120102721small nucleolar RNA SNORA1749813375998133886Rat
41353377LOC120102733small nucleolar RNA SNORA1749823881598238917Rat
41169229LOC120102722small nucleolar RNA SNORA1749826317398263300Rat
41125163LOC120102717small nucleolar RNA SNORA1749849391198494037Rat
41253364LOC120102725small nucleolar RNA SNORA1749858397298584104Rat
11051993LOC102557466Ig kappa chain V-II region 26-10-like49858862498589555Rat
41263518LOC120102530immunoglobulin kappa variable 1-9-like49887513898875778Rat
41365694LOC120102297immunoglobulin kappa variable 1D-33-like49896141998965084Rat
41075263LOC120102531immunoglobulin kappa variable 1-9-like49901452399015161Rat
41277236LOC120102585U6 spliceosomal RNA49914578099145884Rat
41180823LOC120102592U6 spliceosomal RNA49916978599169889Rat
41205249LOC120102578U6 spliceosomal RNA49920039799200501Rat
41120707LOC120102598U6 spliceosomal RNA49921932699219429Rat
40974521LOC120102579U6 spliceosomal RNA49925367099253774Rat
41114178LOC120102583U6 spliceosomal RNA49926872299268826Rat
41108878LOC120102533Ig kappa chain V-V region K2-like49928277299285103Rat
41107864LOC120102589U6 spliceosomal RNA49929007299290176Rat
41033320LOC120102595U6 spliceosomal RNA49930944099309544Rat
41049106LOC120102534Ig kappa chain V-V region K2-like49932280799323306Rat
40946187LOC120102535immunoglobulin kappa variable 1-39-like49934046699340968Rat
40961802LOC120102590U6 spliceosomal RNA49934623299346336Rat
41270403LOC120093116immunoglobulin kappa variable 1-5-like49936335399363814Rat
2320855LOC100364505hypothetical LOC10036450549936447499369594Rat
2323358LOC100363282Igk protein-like49938974799390292Rat
40952956LOC120102536actin-related protein 2/3 complex subunit 5-like49942323999424376Rat
41362761LOC120102298immunoglobulin kappa variable 1D-33-like49953181099532249Rat
11051991LOC102551297Ig kappa chain V-II region 26-10-like49976417199765272Rat
2321092LOC100360968mCG142527-like49994200399942688Rat
2320327LOC100361338hypothetical LOC1003613384100209006100209643Rat
7521956LOC102553480zinc finger protein 120-like4100210123100220831Rat
2319569LOC100361705rCG64259-like4100487837100488968Rat
1561547LOC500180similar to IG KAPPA CHAIN V-V REGION K2 PRECURSOR4100511688100512362Rat
11383082LOC102556911Ig kappa chain V-V region L7-like4100736032100736741Rat
41136119LOC120102301uncharacterized LOC1201023014100744447100787990Rat
11458713LOC103691773Ig kappa chain V-V region K2-like4100774851100775585Rat
11051990LOC102556862Ig kappa chain V-III region MOPC 63-like4100900754100901355Rat
11051998LOC102554848Ig kappa chain V-V region L7-like4101003409101004411Rat
41349965LOC120102541immunoglobulin kappa variable 1D-33-like4101040345101043988Rat
2324539LOC100362515hypothetical LOC1003625154101065901101066416Rat
1587247LOC500184similar to fibrillarin4101138821101139593Rat
11051987LOC102555123Ig kappa chain V-V region K2-like4101195589101196676Rat
1588449LOC498750similar to cDNA sequence BC0055374101258112101260037Rat
41305950LOC120102564U6 spliceosomal RNA4101286236101286342Rat
620468Igkv28immunoglobulin kappa chain variable 28 (V28)4101302903101303452Rat
1592227LOC690737similar to Eukaryotic translation initiation factor 5 (eIF-5)4101363702101365081Rat
41091703LOC120102168rRNA 2'-O-methyltransferase fibrillarin-like4101416548101417555Rat
2318882LOC100365500mCG142154-like4101432815101433399Rat
41381944LOC120102305uncharacterized LOC1201023054101437202101439905Rat
2319042LOC100365438mCG141619-like4101478715101479376Rat
1586004LOC502823similar to fibrillarin4101510664101511950Rat
11497379LOC103691800Ig kappa chain V-IV region-like4101645320101645700Rat
9252629LOC103691799Ig kappa chain V-III region MOPC 63-like4101726300101727506Rat
1586003LOC502825hypothetical LOC5028254101805860101806662Rat
11052049LOC690813Ig kappa chain V-IV region-like4101838285101839132Rat
1563231RGD1563231similar to immunoglobulin kappa-chain VK-14102208069102208647Rat
1564696RGD1564696similar to immunoglobulin light chain variable region4102304440102305139Rat
2321310LOC100360848rCG64259-like4102343796102344458Rat
1597311LOC690381similar to glycosyltransferase-like domain containing 1 isoform b4102443892102445203Rat
2320908LOC100361052rCG64257-like4102446979102447648Rat
41008980LOC120102656small nucleolar RNA SNORA484102572182102572325Rat
7706369LOC102549228histone deacetylase 2-like4102624284102625962Rat
41213638LOC120102652small nucleolar RNA SNORA484102675250102675393Rat
1311377Rpiaribose 5-phosphate isomerase A4102723712102749374Rat
41120297LOC120102574U6 spliceosomal RNA4102735624102735728Rat
41378383LOC120102307uncharacterized LOC1201023074102761831102791308Rat
41398122LOC12010254260S ribosomal protein L21-like4102797216102797569Rat
7583063LOC102549525uncharacterized LOC1025495254102802796102805439Rat
70884Eif2ak3eukaryotic translation initiation factor 2 alpha kinase 34102805495102866914Rat
41401399LOC120102543signal peptidase complex subunit 2-like4102869047102869887Rat
1562720Tex37testis expressed 374102885695102892934Rat
1561816Foxi3forkhead box I34102933487102937655Rat
41364677LOC120102648small nucleolar RNA SNORA484102978143102978286Rat
41236250LOC120102679U1 spliceosomal RNA4103011258103011413Rat
1309144Thnsl2threonine synthase-like 24103112974103132122Rat
2590Fabp1fatty acid binding protein 14103191015103194791Rat
1305105Smyd1SET and MYND domain containing 14103195330103252989Rat
7727476LOC102549052low molecular weight phosphotyrosine protein phosphatase-like4103247606103251384Rat
40934091Trnaa-agctransfer RNA alanine (anticodon AGC)4103258388103258469Rat
1306495Krcc1lysine-rich coiled-coil 14103261566103274672Rat
7647571LOC102552663uncharacterized LOC1025526634103292937103297980Rat
2317Cd8bCD8b molecule4103312596103328523Rat
1587245LOC500198similar to Tubulin alpha-3 chain (Alpha-tubulin 3)4103340394103341605Rat
2316Cd8aCD8a molecule4103365804103370041Rat
1309766Rmnd5arequired for meiotic nuclear division 5 homolog A4103375846103432890Rat
40952747NEWGENE_40938314transfer RNA serine (anticodon AGA)4103396425103396498Rat
620586Rnf103ring finger protein 1034103526456103542529Rat
708556Chmp3charged multivesicular body protein 34103576453103622566Rat
708351Kdm3alysine demethylase 3A4103630907103675073Rat
1305230Reep1receptor accessory protein 14103746004103862347Rat
1307065Mrpl35mitochondrial ribosomal protein L354103865812103876687Rat
1310684Immtinner membrane mitochondrial protein4103880482103919116Rat
1565582Ptcd3Pentatricopeptide repeat domain 34103922440103957445Rat
41156854LOC120102744small nucleolar RNA SNORD944103924328103924464Rat
620824Polr1aRNA polymerase I subunit A4103950051104014022Rat
2319759LOC100361613hypothetical LOC1003616134104043649104046004Rat
41152181LOC120102169uncharacterized LOC1201021694104098343104105838Rat
7553872LOC102556495uncharacterized LOC1025564954104131807104134481Rat
620875St3gal5ST3 beta-galactoside alpha-2,3-sialyltransferase 54104134553104192560Rat
41176189LOC120102561U6 spliceosomal RNA4104156903104157009Rat
7524413LOC102546367uncharacterized LOC1025463674104166361104168839Rat
1561512Atoh8atonal bHLH transcription factor 84104259992104292168Rat
41177686LOC120102309uncharacterized LOC1201023094104285634104289300Rat
41062867LOC120102308uncharacterized LOC1201023084104292221104321842Rat
621700Sftpbsurfactant protein B4104359303104368439Rat
1308103Usp39ubiquitin specific peptidase 394104373908104406413Rat
1587471LOC691113hypothetical protein LOC6911134104402553104408317Rat
619998Tmem150atransmembrane protein 150A4104410271104414630Rat
1359698Rnf181ring finger protein 1814104414586104421433Rat
620419Vamp5vesicle-associated membrane protein 54104423813104435059Rat
620421Vamp8vesicle-associated membrane protein 84104442383104452884Rat
68383Ggcxgamma-glutamyl carboxylase4104469737104485631Rat
619985Mat2amethionine adenosyltransferase 2A4104489877104495447Rat
11355186LOC108350864ATP synthase subunit g, mitochondrial pseudogene4104555149104555540Rat
1587427Sh2d6SH2 domain containing 64104566210104574176Rat
1311724Capgcapping actin protein, gelsolin like4104594743104611856Rat
41109258NEWGENE_40926764transfer RNA proline (anticodon AGG)4104598962104599042Rat
1306408Elmod3ELMO domain containing 34104614665104653122Rat
628802Retsatretinol saturase4104653306104662069Rat
620445Tgoln2trans-golgi network protein 24104663356104671208Rat
7699711LOC102549526uncharacterized LOC1025495264104672363104687654Rat
1311671Tcf7l1transcription factor 7 like 14104680734104846086Rat
7562795LOC102549458uncharacterized LOC1025494584104767270104769717Rat
1591490Kcmf1potassium channel modulatory factor 14104888452104950234Rat
41358316LOC120102632small nucleolar RNA SNORA36 family4104895641104895763Rat
41116383LOC120102170thymosin beta-10-like4104962532104963461Rat
41083750LOC120102310uncharacterized LOC1201023104104988896104994531Rat
62022Tmsb10thymosin, beta 104105009959105011095Rat
41323307LOC120102777U4 spliceosomal RNA4105038037105038123Rat
621797Dnah6dynein, axonemal, heavy chain 64105064123105284361Rat
7639290LOC102550335prohibitin-like4105082392105084201Rat
41389009LOC120102554U4 spliceosomal RNA4105248170105248327Rat
41141586LOC120102311uncharacterized LOC1201023114105288960105294181Rat
619821Suclg1succinate-CoA ligase GDP/ADP-forming subunit alpha4105308236105337595Rat
1334150Olr822-psolfactory receptor pseudogene 8224105479255105480121Rat
1562515RGD1562515similar to RIKEN cDNA 4931417E114105520442105521542Rat
1586033LOC500205similar to polypyrimidine tract binding protein 1 isoform b4105696627105698961Rat
11472949LOC108350866uncharacterized LOC1083508664105957318105981816Rat
1586032LOC500206similar to src homology 2 domain-containing transforming protein C14105988811105991749Rat
41373605LOC120102663small nucleolar RNA SNORA174106494538106494669Rat
41121066LOC120102312protein FAM50A-like4106608389106609566Rat
11468430Trnas-gcu6transfer RNA serine (anticodon GCU) 64106831010106831091Rat
1586002LOC502848similar to cactin CG1676-PA4106867095106868859Rat
2320685LOC100361176solute carrier family 25, member 394107360735107361799Rat
1585901LOC679688hypothetical protein LOC6796884107575688107585650Rat
41247803LOC120102720small nucleolar RNA SNORA174108118729108118852Rat
2316392Vom1r-ps76vomeronasal 1 receptor pseudogene 764108297905108298689Rat
2320349LOC100361316hypothetical LOC1003613164108405683108421146Rat
41229891LOC120102544uncharacterized LOC1201025444108434706108534978Rat
41048538LOC120102701U1 spliceosomal RNA4108539249108539412Rat
40933947LOC120102313uncharacterized LOC1201023134108573617108627858Rat
11402703LOC10835081760S ribosomal protein L27a-like4108745019108755613Rat
41291582LOC120102545nucleophosmin-like4108791940108792947Rat
41103026LOC120102546ATP synthase subunit g, mitochondrial-like4108818020108821027Rat
1584754LOC679788similar to ribosomal protein L64108858856108967329Rat
41321497LOC120102565U6 spliceosomal RNA4109168372109168478Rat
1305060Ctnna2catenin alpha 24109293978110443413Rat
1585921LRRTM1leucine rich repeat transmembrane neuronal 14109701815109718924Rat
11385872LOC108350868glyceraldehyde-3-phosphate dehydrogenase pseudogene4110616441110617544Rat
41172269LOC120102644U11 spliceosomal RNA4110662076110662209Rat
3254Reg3bregenerating family member 3 beta4110861775110865015Rat
2319874LOC100361595hypothetical LOC1003615954110867647110870075Rat
621401Reg3aregenerating islet-derived 3 alpha4110872398110875157Rat
3552Reg1aregenerating family member 1 alpha4110892451110895115Rat
7688358LOC102556035uncharacterized LOC1025560354110915998110999186Rat
3256Reg3gregenerating family member 3 gamma4110922805110927803Rat
7552576LOC102546411syntaxin-binding protein 3-like4111049442111054421Rat
7708743LOC102556090uncharacterized LOC1025560904111069839111075961Rat
41016841LOC120102668U1 spliceosomal RNA4111394809111394970Rat
41323577LOC120102314uncharacterized LOC1201023144111407391111454991Rat
41096961LOC120102643small nucleolar RNA SNORA514111475412111475543Rat
41159196LOC120102709small nucleolar RNA SNORA174111773083111773205Rat
1560707Lrrtm4leucine rich repeat transmembrane neuronal 44112545874113338713Rat
1586028LOC500220similar to L-lactate dehydrogenase A chain (LDH-A) (LDH muscle subunit) (LDH-M)4113345717113349041Rat
1595483LOC680141hypothetical protein LOC6801414113401645113402234Rat
41195793LOC120102315uncharacterized LOC1201023154113504541113533897Rat
1586001LOC502850similar to mannose-6-phosphate receptor binding protein 14113755510113756823Rat
1594207LOC680224similar to Aspartate aminotransferase, mitochondrial precursor (Transaminase A) (Glutamate oxaloacetate transaminase 2)4114189936114190548Rat
40972357LOC120102677small nucleolar RNA SNORA174114390354114390483Rat
6493044LOC100911370uncharacterized LOC1009113704114459942114463108Rat
1304792Gcfc2GC-rich sequence DNA-binding factor 24114481613114519268Rat
1587381Mrpl19mitochondrial ribosomal protein L194114521824114526053Rat
1559797Eva1aeva-1 homolog A, regulator of programmed cell death4114593773114643011Rat
7520921LOC102547617peroxiredoxin-6-like4114684131114684952Rat
3811Tacr1tachykinin receptor 14114920844115089733Rat
41166952LOC120102316uncharacterized LOC1201023164115098139115106023Rat
1307793Pole4DNA polymerase epsilon 4, accessory subunit4115165285115171097Rat
7711844LOC102547728uncharacterized LOC1025477284115172801115177968Rat
41162732LOC120102317uncharacterized LOC1201023174115217376115228513Rat
2797Hk2hexokinase 24115234509115283530Rat
1592965Rps27a-ps18ribosomal protein S27a, pseudogene 184115353266115353807Rat
3658Sema4fssemaphorin 4F4115411411115437721Rat
1563842M1apmeiosis 1 associated protein4115445910115536745Rat
1596846LOC680041similar to 40S ribosomal protein S254115473792115474236Rat
41270105LOC120102319uncharacterized LOC1201023194115515273115521277Rat
1309499Dok1docking protein 14115537453115540464Rat
1311011Loxl3lysyl oxidase-like 34115540640115556958Rat
1308906Htra2HtrA serine peptidase 24115556914115560202Rat
1591777Aup1AUP1, lipid droplet regulating VLDL assembly factor4115560274115563346Rat
1591766Dqx1DEAQ box RNA-dependent ATPase 14115563497115572598Rat
1595506Tlx2T-cell leukemia homeobox 24115573736115576097Rat
1549782Pcgf1polycomb group ring finger 14115576165115587019Rat
1561172Lbx2ladybird homeobox 24115591974115593859Rat
1561779Ccdc142coiled-coil domain containing 1424115606151115616223Rat
1306709Mrpl53mitochondrial ribosomal protein L534115615329115616219Rat
41349825LOC12010231860S ribosomal protein L23-like4115616374115621512Rat
69240Mogsmannosyl-oligosaccharide glucosidase4115621623115625026Rat
1304961Wbp1WW domain binding protein 14115625168115627567Rat
1562258Ino80bINO80 complex subunit B4115627907115631069Rat
11518313LOC108350719uncharacterized LOC1083507194115639631115642945Rat
727874Rtknrhotekin4115640801115657952Rat
1561494Wdr54WD repeat domain 544115654968115677979Rat
1566019LOC500227hypothetical gene supported by BC0794244115661617115667929Rat
62038Dctn1dynactin subunit 14115671024115703824Rat
7718040LOC102548304uncharacterized LOC1025483044115678692115692726Rat
1303009Slc4a5solute carrier family 4 member 54115710101115810330Rat
1311313Mthfd2methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2, methenyltetrahydrofolate cyclohydrolase4115811135115822663Rat
1307014Mob1aMOB kinase activator 1A4115831581115848561Rat
1305975Bola3bolA family member 34115853350115862797Rat
1590584Tet3tet methylcytosine dioxygenase 34115867412115964433Rat
7650908LOC102548361uncharacterized LOC1025483614115950040115953954Rat
1304799Dguokdeoxyguanosine kinase4115987101116014733Rat
41161074LOC120102320uncharacterized LOC1201023204116014672116016904Rat
2027Actg2actin gamma 2, smooth muscle4116021832116046475Rat
619963StambpStam binding protein4116055563116083563Rat
41018082LOC120102321uncharacterized LOC1201023214116080648116105711Rat
621062Clec4fC-type lectin domain family 4, member F4116129023116138744Rat
1565913Cd207CD207 molecule4116155229116161587Rat
41080233LOC120093095glyceraldehyde-3-phosphate dehydrogenase-like4116161930116162927Rat
9389444LOC103692184glyceraldehyde-3-phosphate dehydrogenase pseudogene4116178416116195253Rat
621133Vax2ventral anterior homeobox 24116195576116219597Rat
11488278LOC108350721uncharacterized LOC1083507214116211039116218830Rat
1310619Atp6v1b1ATPase H+ transporting V1 subunit B14116223799116242475Rat
1561200Ankrd53ankyrin repeat domain 534116245561116253018Rat
1305851Tex261testis expressed 2614116253547116260730Rat
11437638LOC10835072260S ribosomal protein L27 pseudogene4116278373116281125Rat
1305057NagkN-acetylglucosamine kinase4116281179116293870Rat
1307930Paip2bpoly(A) binding protein interacting protein 2B4116291376116323422Rat
1309746Zfp638zinc finger protein 6384116355934116479845Rat
1586000LOC502853similar to 40S ribosomal protein S15 (RIG protein)4116373761116374229Rat
41152310LOC120102555U4 spliceosomal RNA4116423166116423314Rat
41233693LOC120102633small nucleolar RNA SNORA54116471399116471527Rat
1311023Dysfdysferlin4116490877116690709Rat
11421296LOC10835086960S ribosomal protein L31 pseudogene4116921291116921723Rat
631379Cyp26b1cytochrome P450, family 26, subfamily b, polypeptide 14117041808117058628Rat
1560638Exoc6bexocyst complex component 6B4117094741117550221Rat
41340927LOC120102746small nucleolar RNA U134117499018117499122Rat
1585860LOC680929similar to serine/threonine kinase4117569008117569987Rat
41129602LOC120102669small nucleolar RNA SNORA174117587214117587345Rat
41035699LOC120102323uncharacterized LOC1201023234117614716117648792Rat
41350806LOC120102322CXXC motif containing zinc binding protein-like4117631660117632934Rat
41282493LOC120102708small nucleolar RNA SNORA174117652870117652993Rat
3753Sprsepiapterin reductase4117671948117676292Rat
41009709LOC120102711small nucleolar RNA SNORA174117685079117685209Rat
1560795RGD1560795similar to Sepiapterin reductase (SPR)4117689458117693286Rat
41359859LOC120102324uncharacterized LOC1201023244117723370117725707Rat
1564002Emx1empty spiracles homeobox 14117725148117741616Rat
628706Sfxn5sideroflexin 54117750213117869826Rat
1592069Rab11fip5RAB11 family interacting protein 54117871301117908819Rat
1584703LOC681041similar to Argininosuccinate synthase (Citrulline--aspartate ligase)4117912849117927565Rat
1562910Notonotochord homeobox4117961163117965402Rat
1309153Smyd5SMYD family member 54117969615117984082Rat
1583112Pradc1protease-associated domain containing 14117984732117989710Rat
1306422Cct7chaperonin containing TCP1 subunit 74117989232118006478Rat
1566130Fbxo41F-box protein 414118007517118039547Rat
2546Egr4early growth response 44118047869118050328Rat
1311590Alms1ALMS1, centrosome and basal body associated protein4118125581118226005Rat
9142253LOC103692181nuclease-sensitive element-binding protein 1 pseudogene4118133630118134656Rat
41200685LOC120102325uncharacterized LOC1201023254118176974118190926Rat
621607Nat8f3N-acetyltransferase 8 (GCN5-related) family member 34118241792118246010Rat
621610Nat8f5N-acetyltransferase 8 (GCN5-related) family member 54118260323118285038Rat
1586026LOC500236similar to elastin microfibril interfacer 14118262387118266491Rat
621609Nat8N-acetyltransferase 84118279521118284671Rat
2324329LOC100362629camello-like 44118303631118305781Rat
1561619Nat8f2N-acetyltransferase 8 (GCN5-related) family member 24118319984118323159Rat
7636572Nat8f4N-acetyltransferase 8 (GCN5-related) family member 44118326092118332591Rat
621606Nat8f1N-acetyltransferase 8 (GCN5-related) family member 14118336208118342923Rat
1309786TprkbTp53rk binding protein4118342910118357908Rat
621605Nat8bN-acetyltransferase 8B4118359445118364351Rat
1307038Dusp11dual specificity phosphatase 114118367673118385183Rat
7547913LOC102549328uncharacterized LOC1025493284118400294118416651Rat
41388537LOC120102326uncharacterized LOC1201023264118416642118424029Rat
1564754Figlafolliculogenesis specific bHLH transcription factor4118432517118436846Rat
2042Add2adducin 24118444594118538505Rat
3849Tgfatransforming growth factor alpha4118618043118700897Rat
11502286LOC108350725uncharacterized LOC1083507254118778620118792730Rat
1304825Fam136afamily with sequence similarity 136, member A4118805129118811046Rat
1584713Snrpgsmall nuclear ribonucleoprotein polypeptide G4118812278118819827Rat
41150073LOC120102639small nucleolar RNA SNORA2/SNORA34 family4118815877118816012Rat
628652Pcyox1prenylcysteine oxidase 14118832114118842951Rat
11508600Trnag-ccc4transfer RNA glycine (anticodon CCC) 44118852419118852489Rat
1305742Tia1TIA1 cytotoxic granule-associated RNA binding protein4118852765118883252Rat
1306746RGD1306746similar to Hypothetical protein MGC255294118887688118916808Rat
41326110LOC120102327uncharacterized LOC1201023274118919046118930645Rat
7589793LOC102554318uncharacterized LOC1025543184118942068118966369Rat
1561319Pcbp1poly(rC) binding protein 14118972698118974722Rat
1584384LOC684976hypothetical protein LOC6849764118986414118988248Rat
7667063LOC102554372uncharacterized LOC1025543724119012925119030617Rat
1560859Asprv1aspartic peptidase, retroviral-like 14119076169119078887Rat
1564525Mxd1max dimerization protein 14119097353119118080Rat
1310925Snrnp27small nuclear ribonucleoprotein U4/U6.U5 subunit 274119123676119133234Rat
1359265Gmcl1germ cell-less 1, spermatogenesis associated4119140598119179891Rat
621171Anxa4annexin A44119184378119241183Rat
41374913LOC120102638small nucleolar RNA SNORA2/SNORA34 family4119234751119234887Rat
1305520Aak1AP2 associated kinase 14119300128119451834Rat
2322888LOC100360057ribosomal protein L22-like4119350406119350886Rat
41257949LOC120102328uncharacterized LOC1201023284119415816119417839Rat
1307823Nfu1NFU1 iron-sulfur cluster scaffold4119458981119480162Rat
1549703Gfpt1glutamine fructose-6-phosphate transaminase 14119496691119546472Rat
1307144Antxr1ANTXR cell adhesion molecule 14119590770119778232Rat
40955934LOC120102329uncharacterized LOC1201023294119717819119729211Rat
1311934Gkn2gastrokine 24119778326119824366Rat
735014Gkn1gastrokine 14119790101119795389Rat
1597754Gkn3gastrokine 34119828859119833924Rat
1562986Bmp10bone morphogenetic protein 104119872066119877694Rat
1562105Arhgap25Rho GTPase activating protein 254119896844119974982Rat
708443Prokr1prokineticin receptor 14120022301120033379Rat
1565557Aplfaprataxin and PNKP like factor4120070471120122656Rat
41291607LOC120102330uncharacterized LOC1201023304120086931120112957Rat
2323785Cfap92cilia and flagella associated protein 924120126565120181575Rat
6497663LOC100910604uncharacterized LOC1009106044120187658120188705Rat
1596494Efcc1EF-hand and coiled-coil domain containing 14120188202120223464Rat
1561601Gp9glycoprotein IX (platelet)4120235539120236874Rat
1565300Rab43RAB43, member RAS oncogene family4120249878120269174Rat
1307688Isy1ISY1 splicing factor homolog4120276535120297227Rat
621807CnbpCCHC-type zinc finger, nucleic acid binding protein4120302768120311694Rat
2323735LOC100362958hypothetical LOC1003629584120318859120320679Rat
41150042LOC120102331uncharacterized LOC1201023314120353804120366389Rat
9124640LOC10369217960S ribosomal protein L34 pseudogene4120362254120362604Rat
1565292Copg1COPI coat complex subunit gamma 14120366540120392502Rat
1559800Hmces5-hydroxymethylcytosine binding, ES cell specific4120392812120415616Rat
11508794LOC108350727uncharacterized LOC1083507274120415759120430399Rat
1565596H1f10H1.10 linker histone4120440515120444705Rat
7650153LOC102552138uncharacterized LOC1025521384120450176120462899Rat
61908Rab7aRAB7A, member RAS oncogene family4120461966120510756Rat
3594Rpn1ribophorin I4120543667120565069Rat
41402798LOC120102332uncharacterized LOC1201023324120567736120572576Rat
9252280LOC103692180uncharacterized LOC1036921804120584341120590943Rat
7562079LOC102554068uncharacterized LOC1025540684120590582120622585Rat
41376499LOC120102333uncharacterized LOC1201023334120648227120658210Rat
2664Gata2GATA binding protein 24120654205120667763Rat
1561981Dnajb8DnaJ heat shock protein family (Hsp40) member B84120681918120685108Rat
1562716Tcp1-ps1t-complex protein 1, pseudogene 14120705645120707491Rat
41153665LOC120102642small nucleolar RNA SNORA294120707367120707503Rat
1560552Eefseceukaryotic elongation factor, selenocysteine-tRNA-specific4120719616120915801Rat
41383162LOC120102335uncharacterized LOC1201023354120733062120737659Rat
41309288LOC12010233460S ribosomal protein L21-like4120819893120820436Rat
68373Ruvbl1RuvB-like AAA ATPase 14120932486120967400Rat
1583218LOC685085similar to 40S ribosomal protein S254120933765120934259Rat
68321Sec61a1SEC61 translocon subunit alpha 14120973519120987871Rat
1585999Kbtbd12kelch repeat and BTB domain containing 124121014636121088701Rat
71039Mgllmonoglyceride lipase4121192187121294187Rat
41199103NEWGENE_40933816transfer RNA valine (anticodon AAC)4121218174121218246Rat
7609272LOC102554878uncharacterized LOC1025548784121271560121272968Rat
41161138LOC120102336uncharacterized LOC1201023364121277566121278416Rat
1359363Abtb1ankyrin repeat and BTB domain containing 14121299302121305667Rat
1305815Podxl2podocalyxin-like 24121306224121338070Rat
1305577Mcm2minichromosome maintenance complex component 24121346434121360962Rat
620858Tpra1transmembrane protein adipocyte associated 14121364093121375275Rat
7696532LOC102554942uncharacterized LOC1025549424121401011121454903Rat
7591615LOC102555035uncharacterized LOC1025550354121464929121479571Rat
7550029LOC102555094uncharacterized LOC1025550944121511450121516890Rat
1591392Prr20eproline rich 20E4121566632121574734Rat
41120855LOC120102337uncharacterized LOC1201023374121604758121615075Rat
41025378LOC120102338uncharacterized LOC1201023384121690045121700753Rat
41127828LOC120102339uncharacterized LOC1201023394121701048121712111Rat
41234562LOC120102340uncharacterized LOC1201023404121723881121732860Rat
1560871Plxna1plexin A14121737934121782901Rat
1304561Chchd6coiled-coil-helix-coiled-coil-helix domain containing 64121803501122024209Rat
41227538LOC120102655small nucleolar RNA SNORA484121944388121944517Rat
1308363Txnrd3thioredoxin reductase 34122072548122112493Rat
1585998LOC502860hypothetical LOC5028604122120684122121727Rat
708509Vom1r90vomeronasal 1 receptor 904122139053122148056Rat
2323419LOC100363221hypothetical LOC1003632214122141718122144244Rat
7512196LOC102547820uncharacterized LOC1025478204122166102122172598Rat
1564573Vom1r92vomeronasal 1 receptor 924122222550122225303Rat
1549740Vom1r93vomeronasal 1 receptor 934122234616122242958Rat
1359098Vom1r94vomeronasal 1 receptor 944122274165122275145Rat
1359401Vom1r95vomeronasal 1 receptor 954122285444122286388Rat
2316391Vom1r-ps77vomeronasal 1 receptor pseudogene 774122311684122312578Rat
1549781Vom1r96vomeronasal 1 receptor 964122334287122335270Rat
708391Vom1r97vomeronasal 1 receptor 974122361863122364034Rat
2316390Vom1r-ps78vomeronasal 1 receptor pseudogene 784122370207122371034Rat
1549694Vom1r98vomeronasal 1 receptor 984122375961122376993Rat
2316389Vom1r-ps79vomeronasal 1 receptor pseudogene 794122394932122395749Rat
2316388Vom1r-ps80vomeronasal 1 receptor pseudogene 804122396580122396744Rat
1589006Vom1r99vomeronasal 1 receptor 994122430887122431711Rat
1549727Vom1r100vomeronasal 1 receptor 1004122468150122471495Rat
708395Vom1r101vomeronasal 1 receptor 1014122499102122500235Rat
708384Vom1r102vomeronasal 1 receptor 1024122536742122545602Rat
2316387Vom1r-ps81vomeronasal 1 receptor pseudogene 814122586021122586924Rat
2316386Vom1r-ps82vomeronasal 1 receptor pseudogene 824122595522122596518Rat
2316385Vom1r-ps83vomeronasal 1 receptor pseudogene 834122608252122609154Rat
2316384Vom1r-ps84vomeronasal 1 receptor pseudogene 844122613355122614266Rat
2316383Vom1r-ps85vomeronasal 1 receptor pseudogene 854122625876122626474Rat
41167200LOC120102341vomeronasal type-1 receptor A144122679045122680064Rat
2316382Vom1r-ps86vomeronasal 1 receptor pseudogene 864122686949122687878Rat
2316408Vom1r103vomeronasal 1 receptor 1034122729553122730533Rat
1587829Vom1r104vomeronasal 1 receptor 1044122768885122769850Rat
1587811LOC685964hypothetical protein LOC6859644122817681122822175Rat
1562825Chst13carbohydrate sulfotransferase 134122824712122837935Rat
1587777Uroc1urocanate hydratase 14122844933122876584Rat
1561296ZxdcZXD family zinc finger C4122882389122914486Rat
1305768Cfap100cilia and flagella associated protein 1004122914693122938994Rat
70918Klf15Kruppel-like factor 154122965718122978403Rat
621294Aldh1l1aldehyde dehydrogenase 1 family, member L14123059989123106471Rat
1589573Slc41a3solute carrier family 41, member 34123109555123154766Rat
1596313Iqsec1IQ motif and Sec7 domain ArfGEF 14123168719123488300Rat
41355210LOC120102710small nucleolar RNA SNORA174123361345123361441Rat
69339Nup210nucleoporin 2104123511559123609874Rat
1311706Hdac11histone deacetylase 114123645873123667407Rat
628685Fbln2fibulin 24123704289123763857Rat
69079Wnt7aWnt family member 7A4123863108123908981Rat
2316381Vom1r-ps87vomeronasal 1 receptor pseudogene 874123930673123931299Rat
1310746Chchd4coiled-coil-helix-coiled-coil-helix domain containing 44123968264123977398Rat
1549711Tmem43transmembrane protein 434123977680123992823Rat
1305760XpcXPC complex subunit, DNA damage recognition and repair factor4123993670124020922Rat
1305971Lsm3LSM3 homolog, U6 small nuclear RNA and mRNA degradation associated4124021023124027269Rat
7539827LOC102548902uncharacterized LOC1025489024124160535124201206Rat
61912Slc6a6solute carrier family 6 member 64124195186124268880Rat
621668Grip2glutamate receptor interacting protein 24124271456124356538Rat
1305225Ccdc174coiled-coil domain containing 1744124392183124419035Rat
11410861LOC10835080140S ribosomal protein S11-like4124395855124398410Rat
1560289RGD1560289similar to chromosome 3 open reading frame 204124422033124470657Rat
7553480LOC102554857uncharacterized LOC1025548574124441221124498179Rat
1305589Fgd5FYVE, RhoGEF and PH domain containing 54124497061124594564Rat
3201Nr2c2nuclear receptor subfamily 2, group C, member 24124610216124666813Rat
41318857LOC120102342uncharacterized LOC1201023424124637670124656902Rat
1308770Mrps25mitochondrial ribosomal protein S254124668320124680086Rat
1305397Rbsnrabenosyn, RAB effector4124682228124712578Rat
9301889LOC103692187uncharacterized LOC1036921874124712546124722083Rat
3903Trhthyrotropin releasing hormone4124742111124777094Rat
1306723Prickle2prickle planar cell polarity protein 24124869552125214862Rat
1306889Adamts9ADAM metallopeptidase with thrombospondin type 1 motif, 94125290633125462988Rat
7661237LOC102554570uncharacterized LOC1025545704125334112125359366Rat
40953411LOC120102343uncharacterized LOC1201023434125386934125418673Rat
7590189LOC102555978uncharacterized LOC1025559784125459772125773012Rat
41288887LOC120102344uncharacterized LOC1201023444125657909125684813Rat
41091722LOC120102670small nucleolar RNA SNORA174125861717125861845Rat
40993191LOC120102703small nucleolar RNA SNORA174126026597126026707Rat
41156543LOC120102345uncharacterized LOC1201023454126097347126157088Rat
9070006LOC103692189uncharacterized LOC1036921894126124290126129626Rat
1586441LOC688659similar to acidic ribosomal phosphoprotein P04126179018126180835Rat
41377972LOC120102346uncharacterized LOC1201023464126183463126186067Rat
1586025Magi1membrane associated guanylate kinase, WW and PDZ domain containing 14126205667126811354Rat
41162866NEWGENE_6576114transfer RNA threonine (anticodon AGU)4126353506126353587Rat
41070385LOC120102636small nucleolar RNA SNORA444126415989126416119Rat
41132129LOC120102495gamma-aminobutyric acid receptor-associated protein-like4126518341126548868Rat
2319160LOC100361920dynein light chain 1-like4126581955126582940Rat
40930702LOC120102497uncharacterized LOC1201024974126723866126732961Rat
41081553LOC120102498uncharacterized LOC1201024984126742553126760176Rat
41306468LOC120102496uncharacterized LOC1201024964126790194126802525Rat
1585997LOC502863similar to transcription elongation factor B (SIII), polypeptide 24126816689126817049Rat
2320195LOC100364870hypothetical LOC1003648704126884577126890225Rat
41394821LOC120102171uncharacterized LOC1201021714126995970126999766Rat
2323903LOC100362876hypothetical LOC1003628764127029644127030164Rat
1308811Slc25a26solute carrier family 25 member 264127036704127131022Rat
1306788Lrig1leucine-rich repeats and immunoglobulin-like domains 14127130899127230956Rat
1590113LOC687056hypothetical protein LOC6870564127274472127275699Rat
41121964LOC120102172cytochrome c oxidase subunit 6C-2-like4127416018127417910Rat
11398915Trnal-aag2transfer RNA leucine (anticodon AAG) 24127454175127454256Rat
41018384LOC120102173proteasome subunit beta type-3-like4127536885127537501Rat
1563166Kbtbd8kelch repeat and BTB domain containing 84127675967127688785Rat
1586024LOC500263similar to heterogeneous nuclear ribonucleoprotein A34127704697127705507Rat
1583000LOC688907similar to Elongation factor 1-gamma (EF-1-gamma) (eEF-1B gamma)4127841801127847162Rat
1305008Suclg2succinate-CoA ligase GDP-forming subunit beta4128067031128337146Rat
41031424LOC120102347uncharacterized LOC1201023474128336735128342363Rat
1564292RGD1564292similar to Nucleolar protein 14128479630128481920Rat
7643253LOC102550115ribosome biogenesis regulatory protein homolog4128616299128619872Rat
7508836LOC102549269uncharacterized LOC1025492694128652499128742024Rat
1563030Tafa1TAFA chemokine like family member 14128738028129244223Rat
11081189LOC500265nucleoporin 50-like4128787567128789296Rat
40949626LOC120102500uncharacterized LOC1201025004129086996129146558Rat
41335347LOC120102596U6 spliceosomal RNA4129166306129166407Rat
41004547LOC120102499uncharacterized LOC1201024994129197518129420528Rat
1597443Tafa4TAFA chemokine like family member 44129437466129671320Rat
1359357EogtEGF domain specific O-linked N-acetylglucosamine transferase4129718897129756558Rat
620551Tmf1TATA element modulatory factor 14129759952129785705Rat
41011708LOC120102630small nucleolar RNA SNORA36 family4129770615129770745Rat
621084Uba3ubiquitin-like modifier activating enzyme 34129789526129810707Rat
708572Arl6ip5ADP-ribosylation factor like GTPase 6 interacting protein 54129810650129838628Rat
41263255LOC120102348uncharacterized LOC1201023484129815657129821673Rat
1564924Lmod3leiomodin 34129843964129858684Rat
620172Frmd4bFERM domain containing 4B4129895401130222070Rat
41178684LOC120102547protein prune homolog 2-like4130327921130328679Rat
41317950LOC120102724small nucleolar RNA SNORA174130392379130392510Rat
3092Mitfmelanocyte inducing transcription factor4130409020130621145Rat
2323009Mdfic2MyoD family inhibitor domain containing 24130845260130948054Rat
41327928LOC120102566U6 spliceosomal RNA4131099002131099108Rat
1308669Foxp1forkhead box P14131559599132155092Rat
41126171LOC120102771small nucleolar RNA U34132053395132053495Rat
7669867LOC102555037uncharacterized LOC1025550374132153125132201203Rat
1586185Eif4e3eukaryotic translation initiation factor 4E family member 34132258502132301808Rat
71067Gpr27G protein-coupled receptor 274132328364132329497Rat
1561565Ier3ip1immediate early response 3 interacting protein 14132331372132342316Rat
620280Prok2prokineticin 24132346681132361754Rat
41337025LOC120102349uncharacterized LOC1201023494132466966132473095Rat
41233243LOC120102174macrophage migration inhibitory factor-like4132485334132485702Rat
9229745LOC103692198uncharacterized LOC1036921984132521989132539049Rat
41262491LOC120102350uncharacterized LOC1201023504132559007132560324Rat
11380835LOC108350738uncharacterized LOC1083507384132797064132799375Rat
40980164LOC120102351RING1 and YY1 binding protein4132876260132929075Rat
1307077RybpRING1 and YY1 binding protein4132876361132927580Rat
41024974LOC120102352uncharacterized LOC1201023524133042414133050061Rat
41314095LOC120102353uncharacterized LOC1201023534133100432133108825Rat
41140809LOC120102666small nucleolar RNA SNORA174133135428133135559Rat
41093674LOC120102354uncharacterized LOC1201023544133142571133164384Rat
1310610Shq1SHQ1, H/ACA ribonucleoprotein assembly factor4133213357133305586Rat
41162659LOC120102355actin, cytoplasmic 2-like4133306869133313492Rat
1586482Gxylt2glucoside xylosyltransferase 24133347230133449708Rat
1307312Ppp4r2protein phosphatase 4, regulatory subunit 24133454555133495486Rat
7731047LOC102555697uncharacterized LOC1025556974133577659133647925Rat
11480110LOC108350739uncharacterized LOC1083507394133581761133598613Rat
41053760LOC120102356uncharacterized LOC1201023564133648139133660193Rat
41049156LOC120102357uncharacterized LOC1201023574133676076133686958Rat
41070524LOC120102175UPF0729 protein C18orf32 homolog4133734357133734611Rat
1592353LOC689407similar to smoothelin isoform a4133742253133744275Rat
1305250Pdzrn3PDZ domain containing RING finger 34133770736133996959Rat
41163084LOC120102358uncharacterized LOC1201023584133818078133839199Rat
41240645LOC120102176uncharacterized LOC1201021764134072462134077268Rat
11469179LOC108350740uncharacterized LOC1083507404134210738134238146Rat
41246601LOC120102177uncharacterized LOC1201021774134335166134338245Rat
1586021LOC500273similar to tubulin, alpha 8 like 34134342304134343235Rat
1592322LOC689440similar to 60S ribosomal protein L134134558719134564121Rat
3253Cntn3contactin 34134841268135214460Rat
41352693LOC120102755U2 spliceosomal RNA4134969601134969762Rat
41127226LOC120102641small Cajal body-specific RNA 164135361243135361421Rat
41361992LOC120102607U6 spliceosomal RNA4135562032135562145Rat
40943387LOC120102178uncharacterized LOC1201021784135763696135765816Rat
11484912LOC10835080760S ribosomal protein L30-like4135972768135975698Rat
41072523LOC120102179uncharacterized LOC1201021794136171929136192655Rat
620122Chl1cell adhesion molecule L1-like4136291504136505830Rat
6492017LOC10091159460S ribosomal protein L4-like4136330114136331466Rat
41313119LOC120102359uncharacterized LOC1201023594136616052136628878Rat
41102695LOC120102611U7 small nuclear RNA4136623724136623786Rat
41351198LOC120102180uncharacterized LOC1201021804136636923136641514Rat
7565639LOC102549329uncharacterized LOC1025493294136745668136762242Rat
1585995LOC502869similar to karyopherin (importin) alpha 24136818724136820326Rat
1560353RGD1560353similar to 60S ribosomal protein L134136905705136907969Rat
1586020LOC500277similar to Ras-GTPase-activating protein binding protein 1 (ATP-dependent DNA helicase VIII) (GAP SH3-domain binding protein 1) (G3BP-1) (HDH-VIII)4136952803136954495Rat
41344928LOC120102718small nucleolar RNA SNORA174137032326137032442Rat
1563492RGD1563492similar to ATP-binding cassette, sub-family F (GCN20), member 24137093916137096351Rat
62008Cntn6contactin 64137354886137751712Rat
40983794LOC120102360uncharacterized LOC1201023604138620225138624508Rat
621361Cntn4contactin 44138624584139622499Rat
41223619LOC120102503uncharacterized LOC1201025034138789618138794102Rat
1586019LOC500279similar to Phosphoglycerate kinase 14139263587139265702Rat
41158046LOC120102501uncharacterized LOC1201025014139283893139296350Rat
41247159LOC120102502uncharacterized LOC1201025024139299748139305639Rat
70938Il5rainterleukin 5 receptor subunit alpha4139630652139664593Rat
1308857Trnt1tRNA nucleotidyl transferase 14139681115139703611Rat
41372663LOC120102573U6 spliceosomal RNA4139689094139689204Rat
1310533Crbncereblon4139701154139719949Rat
11479425LOC108348222GDP-Man:Man(3)GlcNAc(2)-PP-Dol alpha-1,2-mannosyltransferase pseudogene4139862203139863619Rat
1589884LOC689694similar to 40S ribosomal protein S7 (S8)4140380731140381276Rat
1564145Lrrn1leucine rich repeat neuronal 14140476752140520210Rat
40934392LOC120102689small nucleolar RNA SNORA174140680625140680738Rat
41284758NEWGENE_40938314transfer RNA serine (anticodon AGA)4140797732140797813Rat
6487745LOC100912325actin, cytoplasmic 2-like4140834718140835768Rat
1565882SetmarSET domain and mariner transposase fusion gene4141046058141058183Rat
1309939Sumf1sulfatase modifying factor 14141078735141160711Rat
2933Itpr1inositol 1,4,5-trisphosphate receptor, type 14141187377141554240Rat
7723051LOC102547466uncharacterized LOC1025474664141491266141542083Rat
11461811LOC108350742uncharacterized LOC1083507424141571301141599424Rat
68439Bhlhe40basic helix-loop-helix family, member e404141618453141624154Rat
41246146LOC120102361uncharacterized LOC1201023614141728281141747563Rat
1562830Arl8bADP-ribosylation factor like GTPase 8B4141748634141792605Rat
1563633Edem1ER degradation enhancing alpha-mannosidase like protein 14141797631141829717Rat
11400916LOC108350874uncharacterized LOC1083508744141940905141942281Rat
41239321LOC120102362uncharacterized LOC1201023624141998399142016719Rat
1586018LOC500283similar to Proteasome 26S subunit subunit 4 ATPase CG5289-PA4142081325142082608Rat
41017193LOC120102762U2 spliceosomal RNA4142280446142280654Rat
40996046LOC120102553U4 spliceosomal RNA4142973965142974049Rat
11358358LOC108350743uncharacterized LOC1083507434143321781143331269Rat
619857Grm7glutamate metabotropic receptor 74143730862144613230Rat
41188500LOC120102506uncharacterized LOC1201025064144039749144041146Rat
41180729LOC120102601U6 spliceosomal RNA4144143261144143356Rat
41219320LOC120102505cyclin-dependent kinases regulatory subunit 2-like4144220612144220990Rat
41166573LOC120102504NHP2-like protein 14144510658144511761Rat
41317445LOC120102593U6 spliceosomal RNA4144668340144668444Rat
41066235LOC120102548elongation factor 1-alpha 1-like4145130360145132187Rat
1308963Lmcd1LIM and cysteine-rich domains 14145393153145452049Rat
1562010Ssuh2ssu-2 homolog4145502942145521881Rat
2281Cav3caveolin 34145582168145598142Rat
3239Oxtroxytocin receptor4145598549145614674Rat
1306993Rad18RAD18 E3 ubiquitin protein ligase4145735654145821102Rat
7609120LOC102548080uncharacterized LOC1025480804145820794145887127Rat
1563152Srgap3SLIT-ROBO Rho GTPase activating protein 34145839369146070556Rat
41196182LOC120102769small nucleolar RNA U34146088309146088519Rat
7623898LOC102548337uncharacterized LOC1025483374146168757146185408Rat
1560852Thumpd3THUMP domain containing 34146185422146209802Rat
41216201LOC120102586U6 spliceosomal RNA4146200474146200580Rat
6491660Thumpd3-as1THUMPD3 antisense RNA 14146210520146217026Rat
1310433Setd5SET domain containing 54146217172146294896Rat
41393297NEWGENE_40926764transfer RNA proline (anticodon AGG)4146300941146301014Rat
727967Lhfpl4LHFPL tetraspan subfamily member 44146313539146340113Rat
1304842Mtmr14myotubularin related protein 144146386949146429990Rat
1309212Cpne9copine family member 94146429961146454335Rat
40962142LOC120102363translation initiation factor IF-2-like4146447443146458594Rat
1584828Brpf1bromodomain and PHD finger containing, 14146456344146472781Rat
621168Ogg18-oxoguanine DNA glycosylase4146474701146481959Rat
629473Camk1calcium/calmodulin-dependent protein kinase I4146481196146492039Rat
2319531LOC100361743chaperonin containing Tcp1, subunit 3 (gamma)4146490625146500878Rat
2319475LOC100361799cDNA sequence BC006662-like4146504023146505562Rat
1564009Tada3transcriptional adaptor 34146510213146521975Rat
41403052LOC120102750U2 spliceosomal RNA4146511607146511797Rat
1310096Arpc4actin related protein 2/3 complex, subunit 44146522255146532784Rat
1311255Ttll3tubulin tyrosine ligase like 34146532958146558425Rat
1307582Rpusd3RNA pseudouridine synthase D34146553230146562794Rat
7499834LOC102548450uncharacterized LOC1025484504146564239146568426Rat
1562113Cideccell death-inducing DFFA-like effector c4146569288146582173Rat
2319333LOC100361844mCG51413-like4146587525146589978Rat
1565488Jagn1jagunal homolog 14146591577146596287Rat
41402055LOC120102752U2 spliceosomal RNA4146594912146595102Rat
735148Il17reinterleukin 17 receptor E4146604547146618206Rat
1306392Il17rcinterleukin 17 receptor C4146618321146631444Rat
1309412Creld1cysteine-rich with EGF-like domains 14146631883146641493Rat
1562419Prrt3proline-rich transmembrane protein 34146641173146650487Rat
1311566Emc3ER membrane protein complex subunit 34146663065146678976Rat
1303172Fancd2FA complementation group D24146679014146743422Rat
1565997Fancd2osFANCD2 opposite strand4146740863146747547Rat
1598136Brk1BRICK1 subunit of SCAR/WAVE actin nucleating complex4146750821146766050Rat
3960Vhlvon Hippel-Lindau tumor suppressor4146772483146779376Rat
1309584Irak2interleukin-1 receptor-associated kinase 24146786004146842615Rat
41146337LOC120102364uncharacterized LOC1201023644146787484146795910Rat
1586017Tatdn2TatD DNase domain containing 24146845156146865708Rat
632283Ghrlghrelin and obestatin prepropeptide4146865712146869621Rat
1359555Sec13SEC13 homolog, nuclear pore and COPII coat complex component4146877739146891130Rat
2176Atp2b2ATPase plasma membrane Ca2+ transporting 24146896332147140665Rat
41203173LOC120102365uncharacterized LOC1201023654147065997147066964Rat
11380647LOC108350745uncharacterized LOC1083507454147262869147277704Rat
628737Slc6a11solute carrier family 6 member 114147297972147413319Rat
620533Slc6a1solute carrier family 6 member 14147448961147482295Rat
7575330LOC102548867uncharacterized LOC1025488674147482960147497153Rat
2830Hrh1histamine receptor H 14147564781147649353Rat
41382729LOC120102366uncharacterized LOC1201023664147575390147578136Rat
40972096LOC120102367endogenous retrovirus group K member 21 Env polyprotein-like4147699712147708407Rat
1304817Atg7autophagy related 74147718663147925656Rat
41039995LOC120102368uncharacterized LOC1201023684147735944147739532Rat
1311653Vgll4vestigial-like family member 44147925630148038514Rat
41261845LOC120102369uncharacterized LOC1201023694147944627147947997Rat
1586150Tamm41TAM41 mitochondrial translocator assembly and maintenance homolog4148070388148103728Rat
7601218LOC102556150mth938 domain-containing protein-like4148111641148112601Rat
3798Syn2synapsin II4148178846148347010Rat
2319464LOC100365210hypothetical LOC1003652104148247091148258212Rat
6491335LOC100911724tubulin alpha-1C chain-like4148253286148254718Rat
69077Timp4TIMP metallopeptidase inhibitor 44148306021148312558Rat
41143089LOC120102740small nucleolar RNA SNORA764148319434148319561Rat
3371Ppargperoxisome proliferator-activated receptor gamma4148423102148548471Rat
1309946Tsen2tRNA splicing endonuclease subunit 24148602805148638219Rat
2320714Mkrn2osMKRN2 opposite strand4148644489148653396Rat
1310618Mkrn2makorin, ring finger protein, 24148661529148679580Rat
3531Raf1Raf-1 proto-oncogene, serine/threonine kinase4148679534148740265Rat
41002253LOC120102730small nucleolar RNA SNORA174148787387148787491Rat
1587025Tmem40transmembrane protein 404148791509148819382Rat
620480Cand2cullin-associated and neddylation-dissociated 2 (putative)4148835050148864039Rat
41332887NEWGENE_40934091transfer RNA alanine (anticodon AGC)4148841925148842005Rat
621203Rpl32ribosomal protein L324148864048148867612Rat
41348576LOC120102637small nucleolar RNA SNORA74148866843148866982Rat
1586985Efcab12EF-hand calcium binding domain 124148869381148892922Rat
1585874Mbd4methyl-CpG binding domain 4 DNA glycosylase4148893049148904833Rat
1311302Ift122intraflagellar transport 1224148905031148975458Rat
3573Rhorhodopsin4148975597148988693Rat
1566236H1f8H1.8 linker histone4148993133148998254Rat
1310796Plxnd1plexin D14149002784149043097Rat
1311909Tmcc1transmembrane and coiled-coil domain family 14149069252149239585Rat
1592944LOC680385similar to Sjogren syndrome antigen B4149078162149079669Rat
735230Washc2cWASH complex subunit 2C4149267851149325850Rat
11384346LOC10835075060S ribosomal protein L9-like4149309307149310333Rat
628707Zfand4zinc finger AN1-type containing 44149327339149399490Rat
1309339Marchf8membrane associated ring-CH-type finger 84149415642149530771Rat
1591759LOC680441similar to 60S ribosomal protein L23a4149492385149492849Rat
2096Alox5arachidonate 5-lipoxygenase4149531329149578696Rat
41140853LOC12010250760S ribosomal protein L7-like4149550038149565446Rat
41121481NEWGENE_40933693transfer RNA proline (anticodon GGG)4149560503149560583Rat
1333902Olr823olfactory receptor 8234149602129149610213Rat
1333048Olr824olfactory receptor 8244149648444149649427Rat
1333814Olr825olfactory receptor 8254149673586149674569Rat
1332818Olr826olfactory receptor 8264149696014149696997Rat
1332631Olr827olfactory receptor 8274149717772149718755Rat
1586016LOC500299similar to heat shock protein 1, alpha4149745787149748099Rat
1333047Olr828olfactory receptor 8284149752294149753277Rat
1585993LOC502876similar to protein phosphatase 1, regulatory subunit 15B4149756752149759826Rat
1332875Olr829olfactory receptor 8294149777747149778730Rat
1334034Olr830olfactory receptor 8304149793474149794436Rat
1333628Olr831olfactory receptor 8314149818596149819528Rat
1333171Olr832olfactory receptor 8324149839430149840362Rat
11489696Trnac-gca29transfer RNA cysteine (anticodon GCA) 294149848557149848628Rat
620229Zfp422zinc finger protein 4224149885805149893287Rat
1307785Rassf4Ras association domain family member 44149897525149932658Rat
1565700Depp1DEPP1, autophagy regulator4149910794149913013Rat
1308850Tmem72transmembrane protein 724149946296149973550Rat
41351797LOC120102672small nucleolar RNA SNORA174150004608150004742Rat
41188358LOC120102768U2 spliceosomal RNA4150054525150054694Rat
1560120Akr1b1-ps2aldo-keto reductase family 1, member B1 (aldose reductase), pseudogene 24150078484150079434Rat
41392789LOC120102370uncharacterized protein C9orf85 homolog4150205867150206875Rat
11463298LOC108350876uncharacterized LOC1083508764150306396150319990Rat
3651Cxcl12C-X-C motif chemokine ligand 124150388326150401173Rat
41354715LOC120102371uncharacterized LOC1201023714150423574150431401Rat
7749382LOC102548743uncharacterized LOC1025487434150498770150548561Rat
40976786LOC120102649small nucleolar RNA SNORA484150527373150527515Rat
1596703LOC681387similar to ubiquitin-conjugating enzyme E2M4150686815150745259Rat
41109424LOC120102372uncharacterized LOC1201023724150812902150819415Rat
2321730LOC100360627DAZ associated protein 2-like4150905260150905887Rat
1563294RGD1563294similar to Alpha enolase (2-phospho-D-glycerate hydro-lyase)4150927402150929143Rat
41340890LOC120102373uncharacterized LOC1201023734150943127150952907Rat
1559850Zfp637zinc finger protein 6374150984940151010079Rat
41401598LOC120102374uncharacterized LOC1201023744150988154150999023Rat
6502210Zfp239zinc finger protein 2394151029425151039283Rat
41036133LOC120102375uncharacterized LOC1201023754151066816151075877Rat
620366Hnrnpfheterogeneous nuclear ribonucleoprotein F4151083262151104464Rat
70998Fxyd4FXYD domain-containing ion transport regulator 44151109779151113659Rat
1583233LOC685069similar to H2A histone family, member V isoform 14151152904151153567Rat
41016825LOC120102376uncharacterized LOC1201023764151176337151179656Rat
1305836Rasgef1aRasGEF domain family, member 1A4151187533151267982Rat
1563660Csgalnact2chondroitin sulfate N-acetylgalactosaminyltransferase 24151271774151308856Rat
41347889LOC120102660small nucleolar RNA SNORA174151283431151283559Rat
1597753LOC685129similar to developmental pluripotency-associated 34151323404151325118Rat
3556Retret proto-oncogene4151325969151368176Rat
1597729LOC685154similar to DNA-directed RNA polymerase II 7.6 kDa polypeptide (RPB10) (RPB7.6) (RPABC5)4151425481151425881Rat
1308043Bms1BMS1 ribosome biogenesis factor4151558163151595187Rat
11379695LOC10835075260S ribosomal protein L17 pseudogene4151573137151573717Rat
1561270Zfp248zinc finger protein 2484151605433151630249Rat
2293498Zfp9zinc finger protein 94151638724151656740Rat
41096242LOC120102774U4 spliceosomal RNA4151638871151639012Rat
1310736Ankrd26ankyrin repeat domain 264151670604151740032Rat
41039270LOC120102508uncharacterized LOC1201025084151761162151765077Rat
2245Cacna1ccalcium voltage-gated channel subunit alpha1 C4151764138152379454Rat
1562214Dcp1bdecapping mRNA 1B4152358267152395747Rat
1562038Cacna2d4calcium voltage-gated channel auxiliary subunit alpha2delta 44152408657152524614Rat
1587001Lrtm2leucine-rich repeats and transmembrane domains 24152485863152508248Rat
1307891Adipor2adiponectin receptor 24152524604152588848Rat
41299916LOC120102588U6 spliceosomal RNA4152565797152565884Rat
40959422LOC120102757U2 spliceosomal RNA4152575725152575876Rat
628850Wnt5bWnt family member 5B4152609566152733790Rat
1305523Fbxl14F-box and leucine-rich repeat protein 144152662542152666360Rat
628733Erc1ELKS/RAB6-interacting/CAST family member 14152763664153055706Rat
40986091LOC120102447mitochondrial import inner membrane translocase subunit Tim23-like4152877093152878119Rat
7728321LOC102552689caspase-6-like4153024536153025248Rat
41078896LOC120102377uncharacterized LOC1201023774153055775153064184Rat
9455361LOC103694898COMM domain-containing protein 6 pseudogene4153087395153094324Rat
1304975Rad52RAD52 homolog, DNA repair protein4153106062153128598Rat
621141Wnk1WNK lysine deficient protein kinase 14153128334153253905Rat
9472652LOC10369221040S ribosomal protein S12 pseudogene4153219586153220023Rat
620552Ninj2ninjurin 24153306439153408618Rat
1584727LOC681016similar to ribosomal protein L44153376053153378932Rat
1561056B4galnt3beta-1,4-N-acetyl-galactosaminyl transferase 34153410907153509019Rat
41205097NEWGENE_40934091transfer RNA alanine (anticodon AGC)4153468859153468931Rat
41105292NEWGENE_40940579transfer RNA leucine (anticodon AAG)4153529208153529282Rat
1310710Ccdc77coiled-coil domain containing 774153534184153566059Rat
1305429Kdm5alysine demethylase 5A4153565909153643912Rat
1306559Il17rainterleukin 17 receptor A4153667534153690174Rat
41271751LOC120102378uncharacterized LOC1201023784153689331153692583Rat
1565302Tmem121btransmembrane protein 121B4153695193153700497Rat
1306557Hdhd5haloacid dehalogenase like hydrolase domain containing 54153701026153753303Rat
11370866LOC108350753uncharacterized LOC1083507534153846873153873689Rat
1564182Cecr2CECR2, histone acetyl-lysine reader4153890310153998078Rat
1590470Slc25a18solute carrier family 25 member 184154000808154021373Rat
735157Atp6v1e1ATPase H+ transporting V1 subunit E14154022360154044486Rat
1306985Bcl2l13BCL2 like 134154056116154112890Rat
620160BidBH3 interacting domain death agonist4154113198154136353Rat
1359504Mical3microtubule associated monooxygenase, calponin and LIM domain containing 34154152776154353274Rat
1584998Pex26peroxisomal biogenesis factor 264154414332154426954Rat
1566041Tuba8tubulin, alpha 84154440045154456918Rat
40978413LOC120102509uncharacterized LOC1201025094154458546154471554Rat
1359153Usp18ubiquitin specific peptidase 184154471634154499154Rat
7621965LOC102553072uncharacterized LOC1025530724154499466154500917Rat
620788Slc6a13solute carrier family 6 member 134154539246154577784Rat
620255Slc6a12solute carrier family 6 member 124154585386154603750Rat
1593191Iqsec3IQ motif and Sec7 domain ArfGEF 34154610933154707310Rat
1564159RGD1564159similar to eukaryotic translation elongation factor 1 epsilon 14154775536154776601Rat
6490793LOC100911742voltage-dependent anion-selective channel protein 2-like4154880345154881160Rat
2004A2malpha-2-macroglobulin4154897770154947787Rat
1584999LOC297568alpha-1-inhibitor III4154980279155036688Rat
11453896LOC108350755thymosin beta-10 pseudogene4155001910155003394Rat
1584878LOC500309similar to salvador homolog 14155048501155049735Rat
621366Mug1murinoglobulin 14155076270155130051Rat
11450202LOC108350756uncharacterized LOC1083507564155137257155149163Rat
1302962Mug2murinoglobulin 24155164061155236765Rat
1566313Cpamd8C3 and PZP-like, alpha-2-macroglobulin domain containing 84155332827155413098Rat
41292079LOC120102379thymosin beta-10-like4155392522155394525Rat
40988507LOC120102549killer cell lectin-like receptor subfamily G member 14155426357155433041Rat
61978Klrg1killer cell lectin like receptor G14155455465155467301Rat
1359355M6prmannose-6-phosphate receptor, cation dependent4155501080155510219Rat
1309203Phc1polyhomeotic homolog 14155510274155532636Rat
11488957Trnaa-agc5transfer RNA alanine (anticodon AGC) 54155610386155610452Rat
41146352LOC120102380small ubiquitin-related modifier 1-like4155619960155620555Rat
1560851Rimklbribosomal modification protein rimK-like family member B4155664392155706888Rat
1307919Mfap5microfibril associated protein 54155727925155750458Rat
41024371LOC120102557U4 spliceosomal RNA4155771670155771782Rat
1303222Aicdaactivation-induced cytidine deaminase4155774132155783972Rat
41120875LOC120102381cytochrome c oxidase subunit 7C, mitochondrial-like4155783930155785243Rat
2133Apobec1apolipoprotein B mRNA editing enzyme catalytic subunit 14155800030155828515Rat
1564178Gdf3growth differentiation factor 34155831572155835953Rat
1310932Dppa3developmental pluripotency-associated 34155851461155854845Rat
1588989LOC685897hypothetical protein LOC6858974155881523155882431Rat
1303178NanogNanog homeobox4155943737155951116Rat
3706Slc2a3solute carrier family 2 member 34155960944156026000Rat
41187910LOC120102382uncharacterized LOC1201023824156027337156039551Rat
1565101Foxj2forkhead box J24156047043156073540Rat
620537C3ar1complement C3a receptor 14156074747156084680Rat
1563551RGD1563551similar to ribosomal protein L314156096896156097888Rat
1306053Necap1NECAP endocytosis associated 14156103935156119068Rat
7546468LOC102550396LRRGT001884156121822156134151Rat
40989992LOC12010218160S ribosomal protein L7-like4156171212156172467Rat
1359109Clec4a1C-type lectin domain family 4, member A14156173894156186009Rat
1359528Clec4a3C-type lectin domain family 4, member A34156214030156224818Rat
1359163Clec4a2C-type lectin domain family 4, member A24156262438156321695Rat
1359662Clec4aC-type lectin domain family 4, member A4156340439156434212Rat
1359354Clec4b2C-type lectin domain family 4, member B24156462742156486240Rat
1359505Clec6a-ps1C-type lectin domain family 6, member A, pseudogene 14156539408156559032Rat
1559669RGD1559669similar to Slbp protein4156563058156563967Rat
1303339Clec4dC-type lectin domain family 4, member D4156589591156598969Rat
1359298Clec4eC-type lectin domain family 4, member E4156606927156612911Rat
11516150LOC108350823eukaryotic translation initiation factor 4E pseudogene4156653571156657665Rat
1585454Vom2r48vomeronasal 2 receptor, 484156661971156702951Rat
1589986Vom2r49vomeronasal 2 receptor, 494156733978156781086Rat
41401725LOC120102735small nucleolar RNA SNORA174156772988156773105Rat
1566165Vom2r50vomeronasal 2 receptor, 504156801318156823561Rat
1561712Vom2r51vomeronasal 2 receptor, 514156834644156884468Rat
41066520LOC120102683small nucleolar RNA SNORA174156849122156849249Rat
735022Vom2r52vomeronasal 2 receptor, 524156918262156956543Rat
1561715RGD1561715similar to complement component 1, s subcomponent4157059237157061211Rat
41227954LOC120102684small nucleolar RNA SNORA174157084756157084883Rat
1310382Cd163CD163 molecule4157085080157118470Rat
1307916RGD1307916LOC3624334157157264157241805Rat
1307612Pex5peroxisomal biogenesis factor 54157270671157296432Rat
9230431LOC10369222160S ribosomal protein L17 pseudogene4157313085157313947Rat
621153Clstn3calsyntenin 34157331494157364769Rat
2319177Zfp42lZinc finger protein 42-like4157344350157345416Rat
7702915LOC102553636uncharacterized LOC1025536364157375080157391503Rat
1302936C1rlcomplement C1r subcomponent like4157394183157410771Rat
41237120LOC120102383uncharacterized LOC1201023834157404793157408561Rat
7639415LOC102553847uncharacterized LOC1025538474157410200157417093Rat
1309091C1rcomplement C1r4157412718157423483Rat
619983C1scomplement C1s4157430249157442438Rat
1310223Lpcat3lysophosphatidylcholine acyltransferase 34157468397157509889Rat
1307665Emg1EMG1 N1-specific pseudouridine methyltransferase4157509258157517540Rat
620203Phb2prohibitin 24157517662157522268Rat
41081789LOC120102747small nucleolar RNA U894157520539157520799Rat
2325407Mir141microRNA 1414157523239157523332Rat
4888590Mir3575microRNA 35754157523652157523766Rat
2325553Mir200cmicroRNA 200c4157523679157523747Rat
620660Ptpn6protein tyrosine phosphatase, non-receptor type 64157526034157550783Rat
2318975Grcc10gene rich cluster, C10 gene4157551276157552924Rat
41213572LOC120102610U7 small nuclear RNA4157552861157552922Rat
61832Atn1atrophin 14157554287157568092Rat
7594196LOC102549865uncharacterized LOC1025498654157561359157563262Rat
2554Eno2enolase 24157572085157580971Rat
41299711LOC120102384uncharacterized LOC1201023844157572998157576719Rat
1304779Lrrc23leucine rich repeat containing 234157581285157592188Rat
1310854Spsb2splA/ryanodine receptor domain and SOCS box containing 24157612921157615293Rat
3896Tpi1triosephosphate isomerase 14157615283157618813Rat
1308438Usp5ubiquitin specific peptidase 54157619643157634711Rat
1359093Cdca3cell division cycle associated 34157634775157638799Rat
708344Gnb3G protein subunit beta 34157639468157645171Rat
1305699P3h3prolyl 3-hydroxylase 34157646238157662035Rat
41163406LOC120102386uncharacterized LOC1201023864157660415157662419Rat
1307437Gpr162G protein-coupled receptor 1624157662200157668341Rat
41287307LOC120102385uncharacterized LOC1201023854157663064157665454Rat
2306Cd4Cd4 molecule4157668878157695366Rat
1302990Lag3lymphocyte activating 34157712665157722229Rat
621529Ptmsparathymosin4157722384157726575Rat
7566034LOC102553981uncharacterized LOC1025539814157727912157734774Rat
1306294Mlf2myeloid leukemia factor 24157739651157744325Rat
1310070Cops7aCOP9 signalosome subunit 7A4157766626157792632Rat
41200147LOC120102584U6 spliceosomal RNA4157772787157772892Rat
41008723LOC120102388uncharacterized LOC1201023884157783186157787376Rat
40933824LOC120102387uncharacterized LOC1201023874157788553157793531Rat
1304952PianpPILR alpha associated neural protein4157796425157804842Rat
708346Zfp384zinc finger protein 3844157810263157840052Rat
7507389LOC102554095uncharacterized LOC1025540954157831204157851015Rat
1309407Ing4inhibitor of growth family, member 44157841882157850519Rat
1564880Acrbpacrosin binding protein4157851149157864211Rat
1562580Lpar5lysophosphatidic acid receptor 54157870493157883970Rat
40984833NEWGENE_40926764transfer RNA proline (anticodon AGG)4157888872157888946Rat
620064Chd4chromodomain helicase DNA binding protein 44157898503157931632Rat
41371508LOC120102389uncharacterized LOC1201023894157913815157921519Rat
40942840LOC120102738small Cajal body-specific RNA 114157923016157923151Rat
1304616Nop2NOP2 nucleolar protein4157932731157944462Rat
1308257Iffo1intermediate filament family orphan 14157945075157962302Rat
2661Gapdhglyceraldehyde-3-phosphate dehydrogenase4157962312157967158Rat
1562596Ncapd2non-SMC condensin I complex, subunit D24157968814157992314Rat
41366642LOC120102748small nucleolar RNA U854157986558157986885Rat
1306686Mrpl51mitochondrial ribosomal protein L514157991756157994715Rat
3948Vamp1vesicle-associated membrane protein 14158012634158019350Rat
1307893TapbplTAP binding protein-like4158021454158028905Rat
41257034LOC120102390uncharacterized LOC1201023904158028943158032695Rat
1560499Cd27CD27 molecule4158030700158035862Rat
41018919LOC120102626small nucleolar RNA SNORA704158053924158054052Rat
7708239LOC102555545uncharacterized LOC1025555454158058337158075209Rat
1565719Tuba3atubulin, alpha 3A4158075083158083972Rat
1309448Ltbrlymphotoxin beta receptor4158108884158115339Rat
41005265LOC120102550uncharacterized LOC1201025504158115475158123311Rat
3639Scnn1asodium channel epithelial 1 subunit alpha4158122962158146184Rat
621237Tnfrsf1aTNF receptor superfamily member 1A4158150815158163592Rat
2318544Plekhg6pleckstrin homology and RhoGEF domain containing G64158163443158182628Rat
41370877LOC120102391uncharacterized LOC1201023914158182694158185265Rat
41268541LOC120102582U6 spliceosomal RNA4158206300158206401Rat
2318Cd9CD9 molecule4158256328158289136Rat
621759Vwfvon Willebrand factor4158360152158491539Rat
1591606Ano2anoctamin 24158514200158855639Rat
41030033LOC120102587U6 spliceosomal RNA4158700406158700512Rat
619728Ntf3neurotrophin 34158914984158984453Rat
7508270LOC102546745uncharacterized LOC1025467454159103806159151760Rat
2322439LOC100363712proteasome (prosome, macropain) assembly chaperone 4-like4159216759159217124Rat
2953Kcna5potassium voltage-gated channel subfamily A member 54159354689159358173Rat
41211382LOC120102392uncharacterized LOC1201023924159369156159392659Rat
2949Kcna1potassium voltage-gated channel subfamily A member 14159464223159472905Rat
11411257LOC108350764uncharacterized LOC1083507644159499081159520684Rat
41157489LOC120102393uncharacterized LOC1201023934159505806159516119Rat

Nucleotide Sequences
GenBank Nucleotide AU047795 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  JH614811 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
2306545Iddm39Insulin dependent diabetes mellitus QTL 39blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)47735672177687411Rat
2306547Iddm38Insulin dependent diabetes mellitus QTL 38blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)46738666970362197Rat
2313401Anxrr27Anxiety related response QTL 27aggression-related behavior trait (VT:0015014)tameness/aggressiveness composite score (CMO:0002136)41793350862933508Rat
2316958Gluco58Glucose level QTL 5810blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)411320076180699135Rat
731165Uae21Urinary albumin excretion QTL 212.40.0001urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)4106649412151649412Rat
737821Hcar9Hepatocarcinoma resistance QTL 93.7liver integrity trait (VT:0010547)volume of individual liver tumorous lesion (CMO:0001078)4109866907167139601Rat
1298082Stresp4Stress response QTL 4blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)450119848146803430Rat
631556Bp135Blood pressure QTL 1350.017arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)478881294117676292Rat
631646Stl4Serum triglyceride level QTL 46.50.0001blood triglyceride amount (VT:0002644)plasma triglyceride level (CMO:0000548)473169846132642728Rat
631651Bp124Blood pressure QTL 1243arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)462879517107879517Rat
631662Hcar2Hepatocarcinoma resistance QTL 23.10.0003liver integrity trait (VT:0010547)volume of individual liver tumorous lesion (CMO:0001078)478878504123878504Rat
631674Iddm14Insulin dependent diabetes mellitus QTL 14blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)464528739157573521Rat
631683Bp116Blood pressure QTL 1160.0001arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)4124303370169303370Rat
631689Scl4Serum cholesterol level QTL 41.90.008blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)495174120140174120Rat
737978Pia23Pristane induced arthritis QTL 235.3joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)4131730738167139601Rat
2317577Eae24Experimental allergic encephalomyelitis QTL 24nervous system integrity trait (VT:0010566)post-insult time to onset of experimental autoimmune encephalomyelitis (CMO:0001422)46699318572752834Rat
2317577Eae24Experimental allergic encephalomyelitis QTL 24nervous system integrity trait (VT:0010566)percentage of study population developing experimental autoimmune encephalomyelitis during a period of time (CMO:0001047)46699318572752834Rat
2317577Eae24Experimental allergic encephalomyelitis QTL 24nervous system integrity trait (VT:0010566)experimental autoimmune encephalomyelitis severity score (CMO:0001419)46699318572752834Rat
2317586Eae25Experimental allergic encephalomyelitis QTL 259.300000190734863nervous system integrity trait (VT:0010566)experimental autoimmune encephalomyelitis severity score (CMO:0001419)47888281783007655Rat
2317586Eae25Experimental allergic encephalomyelitis QTL 259.300000190734863nervous system integrity trait (VT:0010566)percentage of study population developing experimental autoimmune encephalomyelitis during a period of time (CMO:0001047)47888281783007655Rat
2317586Eae25Experimental allergic encephalomyelitis QTL 259.300000190734863nervous system integrity trait (VT:0010566)post-insult time to onset of experimental autoimmune encephalomyelitis (CMO:0001422)47888281783007655Rat
2317586Eae25Experimental allergic encephalomyelitis QTL 259.300000190734863nervous system integrity trait (VT:0010566)experimental autoimmune encephalomyelitis duration (CMO:0001424)47888281783007655Rat
2317587Eae26Experimental allergic encephalomyelitis QTL 26nervous system integrity trait (VT:0010566)experimental autoimmune encephalomyelitis severity score (CMO:0001419)488656681103194984Rat
2317588Eae27Experimental allergic encephalomyelitis QTL 27nervous system integrity trait (VT:0010566)percentage of study population developing experimental autoimmune encephalomyelitis during a period of time (CMO:0001047)4103194805112478794Rat
6478718Anxrr34Anxiety related response QTL 340.00896locomotor behavior trait (VT:0001392)amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)4144639524182687754Rat
6478743Anxrr40Anxiety related response QTL 400.83076defecation behavior trait (VT:0010462)defecation rate (CMO:0000998)462753847107753847Rat
6478748Anxrr42Anxiety related response QTL 420.28008locomotor behavior trait (VT:0001392)amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)4144639524182687754Rat
6478754Anxrr43Anxiety related response QTL 430.14035locomotor behavior trait (VT:0001392)distance moved per unit of time into, out of or within a discrete space in an experimental apparatus (CMO:0001493)4144639524182687754Rat
6478760Anxrr45Anxiety related response QTL 450.06717locomotor behavior trait (VT:0001392)amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)4110870972155870972Rat
6478763Anxrr46Anxiety related response QTL 460.07428locomotor behavior trait (VT:0001392)amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)4110870972155870972Rat
6478772Anxrr49Anxiety related response QTL 490.15488defecation behavior trait (VT:0010462)defecation rate (CMO:0000998)462753847107753847Rat
6478778Anxrr51Anxiety related response QTL 510.25384locomotor behavior trait (VT:0001392)measurement of voluntary locomotion into, out of or within a discrete space in an experimental apparatus (CMO:0000957)4124778595169778595Rat
5685009Bmd86Bone mineral density QTL 863.7tibia mineral mass (VT:1000283)bone mineral density (CMO:0001226)45664777678882945Rat
5685012Bmd87Bone mineral density QTL 875.1tibia mineral mass (VT:1000283)bone mineral content (CMO:0001554)45664777678882945Rat
6893678Bw108Body weight QTL 1082.60.006body mass (VT:0001259)body weight (CMO:0000012)44345797688457976Rat
1298524Oia8Oil induced arthritis QTL 8joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)4138503169173369699Rat
731178Oia7Oil induced arthritis QTL 70.0001joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)4156050654157232313Rat
738009Sach4Saccharine consumption QTL 44.90.000016consumption behavior trait (VT:0002069)saccharin intake volume to total fluid intake volume ratio (CMO:0001601)459948935154902892Rat
738015Pia9Pristane induced arthritis QTL 94.50.048joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)480694870125694870Rat
738016Alc16Alcohol consumption QTL 163.60.00015consumption behavior trait (VT:0002069)ethanol drink intake rate to body weight ratio (CMO:0001616)459948935154902892Rat
6478693Anxrr32Anxiety related response QTL 320.00092locomotor behavior trait (VT:0001392)measurement of voluntary locomotion into, out of or within a discrete space in an experimental apparatus (CMO:0000957)4144639524182687754Rat
6478700Anxrr33Anxiety related response QTL 330.00896locomotor behavior trait (VT:0001392)amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)4144639524182687754Rat
8694439Bw168Body weight QTL 1689.570.001retroperitoneal fat pad mass (VT:0010430)retroperitoneal fat pad weight to body weight ratio (CMO:0000635)44043341485433414Rat
8552782Vie1Viral induced encephalitis QTL 126.4brain integrity trait (VT:0010579)encephalitis incidence/prevalence measurement (CMO:0002361)43443048482490359Rat
738031Alc14Alcohol consumption QTL 147.60.00003consumption behavior trait (VT:0002069)ethanol drink intake rate to body weight ratio (CMO:0001616)459948935154902892Rat
631511Pia7Pristane induced arthritis QTL 74.3joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)4131730738167139601Rat
631546Bp86Blood pressure QTL 863.2arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)45711443291360801Rat
634311Sach7Saccharin preference QTL 7taste sensitivity trait (VT:0001986)saccharin intake volume to total fluid intake volume ratio (CMO:0001601)457114432102114432Rat
634334Xhs3X-ray hypersensitivity QTL 310intestine integrity trait (VT:0010554)post-insult time to onset of moribundity (CMO:0001896)484728680129854654Rat
634342Cia24Collagen induced arthritis QTL 244.5joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)4146565735175236377Rat
634344Hcar7Hepatocarcinoma resistance QTL 77.8liver integrity trait (VT:0010547)liver tumorous lesion area to total liver area ratio (CMO:0001075)470808386115808386Rat
634344Hcar7Hepatocarcinoma resistance QTL 77.8liver integrity trait (VT:0010547)liver tumorous lesion number (CMO:0001068)470808386115808386Rat
634347Hcar8Hepatocarcinoma resistance QTL 85.8liver integrity trait (VT:0010547)liver tumorous lesion area to total liver area ratio (CMO:0001075)4123143783168143783Rat
6909122Insul22Insulin level QTL 224.63blood insulin amount (VT:0001560)plasma insulin level (CMO:0000342)42690728575585128Rat
7411558Bw133Body weight QTL 13313.840.001body mass (VT:0001259)body weight gain (CMO:0000420)4125590636170590636Rat
8662350Eae35Experimental allergic encephalomyelitis QTL 356.2blood tumor necrosis factor amount (VT:0008552)inflammatory exudate tumor necrosis factor level (CMO:0001435)4100834579103761084Rat
7207480Bss105Bone structure and strength QTL 1058.1femur strength trait (VT:0010010)femur midshaft polar moment of inertia (CMO:0001669)4109827074154827074Rat
8655906Rf60Renal function QTL 603.8blood creatinine amount (VT:0005328)creatinine clearance (CMO:0000765)42949419581006281Rat
8552801Bw143Body weight QTL 1437.3body mass (VT:0001259)change in body weight to body weight ratio (CMO:0002216)43443048482490359Rat
8552807Vie4Viral induced encephalitis QTL 47.3brain integrity trait (VT:0010579)encephalitis incidence/prevalence measurement (CMO:0002361)46293350882490359Rat
8552809Vie5Viral induced encephalitis QTL 525.3brain integrity trait (VT:0010579)encephalitis incidence/prevalence measurement (CMO:0002361)43443048482490359Rat
1300109Rf13Renal function QTL 133.91renal blood flow trait (VT:2000006)absolute change in renal blood flow rate (CMO:0001168)4157710145182687754Rat
1300116Hrtrt5Heart rate QTL 53.76heart pumping trait (VT:2000009)heart rate (CMO:0000002)4116179486151161268Rat
1300139Hrtrt6Heart rate QTL 62.85heart pumping trait (VT:2000009)heart rate (CMO:0000002)439524264116179656Rat
1358352Srcrt3Stress Responsive Cort QTL 32.29blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)438465774146803430Rat
1358363Sradr3Stress Responsive Adrenal Weight QTL 36.19adrenal gland mass (VT:0010420)both adrenal glands wet weight (CMO:0000164)457486946102486946Rat
1331738Bp209Blood pressure QTL 2092.979arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)4138503169179293946Rat
10053718Scort25Serum corticosterone level QTL 252.150.0097blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)4155561574182687754Rat
1331802Srn5Serum renin concentration QTL 53.045renin activity (VT:0005581)plasma renin activity level (CMO:0000116)4119428175157578333Rat
1331807Rf31Renal function QTL 312.988urine potassium amount (VT:0010539)urine potassium level (CMO:0000128)43952426474726312Rat
1354612Foco1Food consumption QTL 18.87eating behavior trait (VT:0001431)food intake rate (CMO:0000427)444463908148090542Rat
1354660Salc1Saline consumption QTL 111.26drinking behavior trait (VT:0001422)saline drink intake rate (CMO:0001627)444463908148090542Rat
1558651Swd3Spike wave discharge measurement QTL 34.620.000024brain electrophysiology trait (VT:0010557)brain spike-and-wave discharge frequency (CMO:0001742)45843213392991462Rat
1358202Gluco11Glucose level QTL 112.40.02adipocyte glucose uptake trait (VT:0004185)absolute change in adipocyte glucose uptake (CMO:0000873)485379421167139601Rat
1358203Stl19Serum triglyceride level QTL 192.80.002blood triglyceride amount (VT:0002644)serum triglyceride level (CMO:0000360)4521829465958103Rat
1549827Scl46Serum cholesterol level QTL 463.5blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)4132396220177396220Rat
1549832Bss3Bone structure and strength QTL 311femur morphology trait (VT:0000559)femur midshaft cortical cross-sectional area (CMO:0001663)4109827074154827074Rat
1578655Bmd11Bone mineral density QTL 1111femur mineral mass (VT:0010011)total volumetric bone mineral density (CMO:0001728)490850165135850165Rat
1578657Bss12Bone structure and strength QTL 128.9femur morphology trait (VT:0000559)femoral neck cross-sectional area (CMO:0001697)460220938105220938Rat
1578658Bss13Bone structure and strength QTL 138femur strength trait (VT:0010010)femoral neck polar moment of inertia (CMO:0001670)460220938105220938Rat
1582232Gluco25Glucose level QTL 253.60.0023blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)485253748148090731Rat
1641919Alc22Alcohol consumption QTL 220.0005drinking behavior trait (VT:0001422)ethanol drink intake rate (CMO:0001407)481192555126192555Rat
1581566Eae21Experimental allergic encephalomyelitis QTL 216.2body mass (VT:0001259)maximum body weight loss to initial body weight ratio (CMO:0001400)4157680158158841762Rat
1581574Eae20Experimental allergic encephalomyelitis QTL 207.8nervous system integrity trait (VT:0010566)percentage of study population developing experimental autoimmune encephalomyelitis during a period of time (CMO:0001047)4153031106158841762Rat
1576305Emca6Estrogen-induced mammary cancer QTL 65.8mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)444463720155883716Rat
1576316Ept5Estrogen-induced pituitary tumorigenesis QTL 53.8pituitary gland mass (VT:0010496)pituitary gland wet weight (CMO:0000853)483428419177635233Rat
1641833Alc21Alcohol consumption QTL 218.60.0001drinking behavior trait (VT:0001422)ethanol drink intake rate (CMO:0001407)456698790126192555Rat
1578662Bss15Bone structure and strength QTL 1519.6femur width (VT:1000666)femoral neck width (CMO:0001695)487327165132327165Rat
1578670Bss14Bone structure and strength QTL 1416.4femur morphology trait (VT:0000559)bone trabecular cross-sectional area (CMO:0002311)487327165132327165Rat
1578674Bmd12Bone mineral density QTL 123.8femur mineral mass (VT:0010011)cortical volumetric bone mineral density (CMO:0001730)4135699135180699135Rat
61330Eau1Experimental allergic uveoretinitis QTL 10.0003uvea integrity trait (VT:0010551)experimental autoimmune uveitis score (CMO:0001504)470362013132642728Rat
61336Bp21Blood pressure QTL 214.6arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)45711470578881294Rat
61362Oia2Oil induced arthritis QTL 20.001joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)4138503169173369699Rat
61364Iddm2Insulin dependent diabetes mellitus QTL 2blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)478885890102684881Rat
61406Scwia1Streptococcal cell wall induced arthritis QTL 12.3joint integrity trait (VT:0010548)experimental arthritis severity measurement (CMO:0001459)4106805662151805662Rat
61412Pia2Pristane induced arthritis QTL 23.9joint integrity trait (VT:0010548)post-insult time to onset of experimental arthritis (CMO:0001450)42133334362278020Rat
61418Pia5Pristane induced arthritis QTL 54.5joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)462277855128289560Rat
61422Cia13Collagen induced arthritis QTL 134.5joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)4132642577167139601Rat
61434Cia3Collagen induced arthritis QTL 34.8joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)4103194656148194656Rat
70177Xhs1X-ray hypersensitivity QTL 125.1intestine integrity trait (VT:0010554)post-insult time to onset of moribundity (CMO:0001896)482798864152731274Rat
70200Alc18Alcohol consumption QTL 189.2drinking behavior trait (VT:0001422)ethanol intake volume to total fluid intake volume ratio (CMO:0001591)456647873149491524Rat
619616Bp79Blood pressure QTL 790.0292arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)4521460278882945Rat
631261Tcas3Tongue tumor susceptibility QTL 36.88tongue integrity trait (VT:0010553)number of squamous cell tumors of the tongue with diameter greater than 3 mm (CMO:0001950)41081417091360527Rat
61445Strs3Sensitivity to stroke QTL 33cerebrum integrity trait (VT:0010549)post-insult time to onset of cerebrovascular lesion (CMO:0002343)44043338885433388Rat
61446Coreg2Compensatory renal growth QTL 23.5kidney mass (VT:0002707)compensatory renal growth score (CMO:0001894)4148423102157580971Rat
61475Aia2Adjuvant induced arthritis QTL 25.8joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)43950527573892441Rat
61476Aia3Adjuvant induced arthritis QTL 33.9joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)486730991131730991Rat
724522Bp146Blood pressure QTL 1462.20.0021arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)473630210118630210Rat
724558Plsm2Polydactyly-luxate syndrome (PLS) morphotypes QTL 20.0003hindlimb integrity trait (VT:0010563)hind foot phalanges count (CMO:0001949)4132422778177422778Rat
2293840Kiddil9Kidney dilation QTL 92.9kidney pelvis morphology trait (VT:0004194)hydronephrosis severity score (CMO:0001208)4120926564148090731Rat
2302049Pia32Pristane induced arthritis QTL 325.10.001blood autoantibody amount (VT:0003725)serum immunoglobulin G-type rheumatoid factor level relative to an arbitrary reference serum (CMO:0002112)4105789505150789505Rat
2302051Pia28Pristane induced arthritis QTL 285.30.001blood autoantibody amount (VT:0003725)serum immunoglobulin G-type rheumatoid factor level relative to an arbitrary reference serum (CMO:0002112)473630210118630210Rat
2306899Bp338Blood pressure QTL 3380.071arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)481006124120102625Rat
2312569Pur19Proteinuria QTL 193.40.001total urine protein amount (VT:0000032)urine total protein excretion rate (CMO:0000756)46588210796130297Rat
2303623Vencon2Ventilatory control QTL 23.8respiration trait (VT:0001943)minute ventilation (CMO:0000132)4135204660180204660Rat
2306794Ean2Experimental allergic neuritis QTL 26.4nervous system integrity trait (VT:0010566)IFNG-secreting splenocyte count (CMO:0002122)48342841995853334Rat
1357342Bw40Body weight QTL 400.001body mass (VT:0001259)body weight (CMO:0000012)476647384117676292Rat
70167Bw22Body weight QTL 223.1body mass (VT:0001259)body weight (CMO:0000012)476647384117676292Rat
12798523Anxrr56Anxiety related response QTL 562.830.05locomotor behavior trait (VT:0001392)amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)485253748150276390Rat
724535Cm18Cardiac mass QTL 182.6heart mass (VT:0007028)calculated heart weight (CMO:0000073)4118856416163856416Rat
1549843Bw53Body weight QTL 530.0001body mass (VT:0001259)body weight gain (CMO:0000420)461697658103194791Rat
2312567Glom19Glomerulus QTL 191.90.006kidney glomerulus morphology trait (VT:0005325)index of glomerular damage (CMO:0001135)445456990146803430Rat
7394826Bw126Body weight QTL 1260.002body mass (VT:0001259)body weight gain (CMO:0000420)46293326987483707Rat
61451Ciaa4CIA Autoantibody QTL 43.1blood autoantibody amount (VT:0003725)calculated serum anti-rat type 2 collagen autoantibody titer (CMO:0001281)4126395976167139601Rat
4889969Bss96Bone structure and strength QTL 964.9tibia size trait (VT:0100001)tibia cortical bone volume (CMO:0001725)45664777678882945Rat
1582237Kidm34Kidney mass QTL 3440.0001kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)4148090542168069246Rat
1331759Hrtrt13Heart rate QTL 133.54628heart pumping trait (VT:2000009)heart rate (CMO:0000002)4110275411168266883Rat
70192BpQTLcluster5Blood pressure QTL cluster 54.183arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)462933508114921294Rat
70192BpQTLcluster5Blood pressure QTL cluster 54.183arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)462933508114921294Rat
70192BpQTLcluster5Blood pressure QTL cluster 54.183arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)462933508114921294Rat
70192BpQTLcluster5Blood pressure QTL cluster 54.183arterial blood pressure trait (VT:2000000)percent change in mean arterial blood pressure (CMO:0002035)462933508114921294Rat
70192BpQTLcluster5Blood pressure QTL cluster 54.183arterial blood pressure trait (VT:2000000)percent change in systolic blood pressure (CMO:0000747)462933508114921294Rat
70192BpQTLcluster5Blood pressure QTL cluster 54.183arterial blood pressure trait (VT:2000000)absolute change in pulse pressure (CMO:0001882)462933508114921294Rat
70192BpQTLcluster5Blood pressure QTL cluster 54.183arterial blood pressure trait (VT:2000000)absolute change in mean arterial blood pressure (CMO:0000533)462933508114921294Rat
634335Anxrr16Anxiety related response QTL 167.22locomotor behavior trait (VT:0001392)number of entries into a discrete space in an experimental apparatus (CMO:0000960)493308457167139447Rat
70201Gcr1Gastric cancer resistance QTL 12.7stomach morphology trait (VT:0000470)stomach tumor susceptibility score (CMO:0002043)4120260281147278687Rat
2303168Bp330Blood pressure QTL 3304.250.017arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)45214602146446691Rat
6909128Pancm4Pancreatic morphology QTL 411.35pancreas mass (VT:0010144)pancreas wet weight (CMO:0000626)42690728575585128Rat
10401796Kidm48Kidney mass QTL 48kidney mass (VT:0002707)both kidneys wet weight (CMO:0000085)4145568712182687754Rat
8655961Kidm43Kidney mass QTL 4318kidney mass (VT:0002707)both kidneys wet weight (CMO:0000085)436303261103194984Rat
6478684Anxrr30Anxiety related response QTL 300.00087defecation behavior trait (VT:0010462)defecation rate (CMO:0000998)462753847107753847Rat
12798527Anxrr58Anxiety related response QTL 584.110.05locomotor behavior trait (VT:0001392)distance moved per unit of time into, out of or within a discrete space in an experimental apparatus (CMO:0001493)4119463257147278687Rat
1549839Bw52Body weight QTL 520.0001body mass (VT:0001259)body weight gain (CMO:0000420)461697658115089733Rat
12798525Anxrr57Anxiety related response QTL 573.210.05locomotor behavior trait (VT:0001392)amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)4147278504167139601Rat
2300179Bmd50Bone mineral density QTL 505.90.0001femur mineral mass (VT:0010011)volumetric bone mineral density (CMO:0001553)460928534105928534Rat
12798520Anxrr55Anxiety related response QTL 554.450.01locomotor behavior trait (VT:0001392)number of rearing movements with lid-pushing in an experimental apparatus (CMO:0002715)432583980114627242Rat
12798519Anxrr54Anxiety related response QTL 542.540.05locomotor behavior trait (VT:0001392)distance moved per unit of time into, out of or within a discrete space in an experimental apparatus (CMO:0001493)4114627026159627026Rat
631671Iddm11Insulin dependent diabetes mellitus QTL 113.60.0012blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)45863587778886137Rat
4889972Bss97Bone structure and strength QTL 975.6tibia size trait (VT:0100001)tibia total bone volume (CMO:0001724)45664777678882945Rat
2293659Bmd35Bone mineral density QTL 354.50.0001femur strength trait (VT:0010010)femoral neck ultimate force (CMO:0001703)4137755016181392681Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 312213 UniSTS
UniSTS 110167 UniSTS