BF404401 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: BF404401

Symbol: BF404401
Previously known as:
RGD ID: 5063610
Expected Size: 197 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.2126,281,873 - 26,282,070 (+)MAPPERmRatBN7.2
Rnor_6.0128,567,708 - 28,567,904NCBIRnor6.0
Rnor_5.0130,022,486 - 30,022,682UniSTSRnor5.0
RGSC_v3.4126,942,284 - 26,942,480UniSTSRGSC3.4
Celera124,975,930 - 24,976,126UniSTS
RH 3.4 Map1275.4UniSTS
Cytogenetic Map1p11UniSTS
Is Marker For: Genes:   Tpd52l1  


Annotation


References - curated
# Reference Title Reference Citation
1. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer ACAGTGCATAGGGTTGCTCAAA
Reverse Primer GGAAGCTGCAGACTTTCTCACA
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
1594796Tpd52l1TPD52 like 112617203826290704Rat

Nucleotide Sequences
GenBank Nucleotide CH474002 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM000231 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
2298546Neuinf4Neuroinflammation QTL 45.1nervous system integrity trait (VT:0010566)spinal cord RT1-B protein level (CMO:0002132)1128736750Rat
2313053Bss51Bone structure and strength QTL 513.80.0001tibia length (VT:0004357)tibia length (CMO:0000450)1132356093Rat
2313070Bss52Bone structure and strength QTL 524.40.0001body length (VT:0001256)body length (CMO:0000013)1132356093Rat
2313090Bmd69Bone mineral density QTL 694.40.0001tibia mineral mass (VT:1000283)compact volumetric bone mineral density (CMO:0001730)1132356093Rat
738020Pia8Pristane induced arthritis QTL 84.7joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1165833076Rat
1578650Bmd6Bone mineral density QTL 612.2femur mineral mass (VT:0010011)total volumetric bone mineral density (CMO:0001728)150910843284926Rat
1578651Bmd7Bone mineral density QTL 714.2femur mineral mass (VT:0010011)compact volumetric bone mineral density (CMO:0001730)150910843284926Rat
1578669Bss9Bone structure and strength QTL 96.3femur morphology trait (VT:0000559)bone trabecular cross-sectional area (CMO:0002311)150910843284926Rat
1554320Bmd1Bone mineral density QTL 112.20.0001femur mineral mass (VT:0010011)volumetric bone mineral density (CMO:0001553)150910886060548Rat
1600360Mcs16Mammary carcinoma susceptibility QTL 162.4mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)1224439043433040Rat
7421626Bp360Blood pressure QTL 3600.001arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)1439328949393289Rat
631688Hcas2Hepatocarcinoma susceptibility QTL 230.0001liver integrity trait (VT:0010547)liver tumorous lesion number (CMO:0001068)15925874115540829Rat
631508Sald1Serum aldosterone level QTL 13.7blood aldosterone amount (VT:0005346)serum aldosterone level (CMO:0000487)1985600154856001Rat
2302038Pia31Pristane induced arthritis QTL 315.50.001blood autoantibody amount (VT:0003725)serum immunoglobulin M-type rheumatoid factor level relative to an arbitrary reference serum (CMO:0002111)11099206555992065Rat
1300167Hrtrt2Heart rate QTL 24.35heart pumping trait (VT:2000009)heart rate (CMO:0000002)11148131275088344Rat
2313062Bmd73Bone mineral density QTL 733.90.0001tibia mineral mass (VT:1000283)compact volumetric bone mineral density (CMO:0001730)11148131282174945Rat
2313065Bss67Bone structure and strength QTL 673.10.0001tibia area (VT:1000281)tibia total energy absorbed before break (CMO:0001736)11148131282174945Rat
2313069Bss68Bone structure and strength QTL 682.90.0001tibia size trait (VT:0100001)tibia total energy absorbed before break (CMO:0001736)11148131282174945Rat
2313075Bss66Bone structure and strength QTL 663.40.0001tibia length (VT:0004357)tibia length (CMO:0000450)11148131282174945Rat
2313077Bss69Bone structure and strength QTL 693.50.0001tibia strength trait (VT:1000284)bone polar moment of inertia (CMO:0001558)11148131282174945Rat
2313092Bmd72Bone mineral density QTL 722.50.0001tibia mineral mass (VT:1000283)total volumetric bone mineral density (CMO:0001728)11148131282174945Rat
2313097Bss70Bone structure and strength QTL 703.50.0001tibia strength trait (VT:1000284)tibia total energy absorbed before break (CMO:0001736)11148131282174945Rat
2317755Glom22Glomerulus QTL 223.8urine protein amount (VT:0005160)urine protein level (CMO:0000591)11148148232355910Rat
1578756Iddm22Insulin dependent diabetes mellitus QTL 222.7blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)11183518156835181Rat
5684998Bss101Bone structure and strength QTL 1013.6tibia strength trait (VT:1000284)tibia ultimate force (CMO:0001734)11543162149361612Rat
5684999Bss102Bone structure and strength QTL 1025.50.00000072tibia strength trait (VT:1000284)tibia stiffness (CMO:0001735)11543162149361612Rat
631494Bp95Blood pressure QTL 95400.0001arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)11620621049268520Rat
634353Rends2Renal damage susceptibility QTL 20.05kidney blood vessel morphology trait (VT:0000530)organ lesion measurement (CMO:0000677)11933357156983283Rat
1558642Prcr2Prostate cancer resistance QTL 24.3prostate integrity trait (VT:0010571)area of ventral prostate occupied by tumorous lesions to total ventral prostate area ratio (CMO:0000899)12076315844095856Rat
724520Bp145Blood pressure QTL 1452.10.0024arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)12078482865784828Rat
1357397Bw41Body weight QTL 414.190.0001body mass (VT:0001259)body weight (CMO:0000012)12234064749361612Rat
1357401Bw43Body weight QTL 433.75body mass (VT:0001259)body weight (CMO:0000012)12234064749361612Rat
1357400Bw62Body weight QTL624.05inguinal fat pad mass (VT:0010424)inguinal fat pad weight to body weight ratio (CMO:0001253)12234064767340647Rat
631495Bp96Blood pressure QTL 964.52arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)122340647102268831Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 689256 UniSTS
UniSTS 247088 UniSTS