AW534512 Marker Search Result - Rat Genome Database

Send us a Message
Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Search RGD Grant Resources Citing RGD About Us Contact Us
Genes Variants Community Projects QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data
OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer)
Aging & Age-Related Disease Cancer & Neoplastic Disease Cardiovascular Disease Coronavirus Disease Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease
Find Models   new Genetic Models Autism Models Rat PhenoMiner (Quantitative Phenotypes) Chinchilla PhenoMiner Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive
Pathways
Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Presentations Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources

Marker: AW534512

Symbol: AW534512
Previously known as:
RGD ID: 5062802
Expected Size: 179 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.28121,349,040 - 121,349,219 (+)MAPPERmRatBN7.2
Rnor_6.08130,322,883 - 130,323,061NCBIRnor6.0
Rnor_5.08129,506,318 - 129,506,496UniSTSRnor5.0
Celera8120,483,931 - 120,484,109UniSTS
RH 3.4 Map81256.1UniSTS
Is Marker For: Genes:   Sec22c  


Annotation


References - curated
# Reference Title Reference Citation
1. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer GCCTTTCTCCTTTCCACTTCAA
Reverse Primer AGTCAAATCTGCAATGTCTGGG
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
1590146Sec22cSEC22 homolog C, vesicle trafficking protein8121345839121371509Rat

Nucleotide Sequences
RefSeq Transcripts XM_001078538 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
1554321Bmd3Bone mineral density QTL 37.90.0001femur mineral mass (VT:0010011)volumetric bone mineral density (CMO:0001553)840952565123900184Rat
2300181Bmd55Bone mineral density QTL 555.70.0001femur mineral mass (VT:0010011)volumetric bone mineral density (CMO:0001553)876468691121468691Rat
61437Cia6Collagen induced arthritis QTL 6joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)882460758122812818Rat
738011Anxrr9Anxiety related response QTL 96.1exploratory behavior trait (VT:0010471)number of entries into a discrete space in an experimental apparatus (CMO:0000960)893535351123900184Rat
1358893Bp263Blood pressure QTL 2635.01arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)893965141123900184Rat
1358903Bp252Blood pressure QTL 25270.0001arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)893965141123900184Rat
738014Anxrr15Anxiety related response QTL 153.60.005locomotor behavior trait (VT:0001392)amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)895718998123900184Rat
2300182Bmd56Bone mineral density QTL 565.4femur mineral mass (VT:0010011)volumetric bone mineral density (CMO:0001553)895718998123900184Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 687022 UniSTS
UniSTS 246590 UniSTS