BE106868 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Pathways

Marker: BE106868

Symbol: BE106868
Previously known as:
RGD ID: 5062572
Expected Size: 184 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.22013,594,092 - 13,594,276 (+)MAPPERmRatBN7.2
Rnor_6.02014,543,799 - 14,543,982NCBIRnor6.0
Rnor_5.02016,726,547 - 16,726,730UniSTSRnor5.0
RGSC_v3.42014,095,322 - 14,095,505UniSTSRGSC3.4
Celera2015,077,384 - 15,077,567UniSTS
Cytogenetic Map20p12UniSTS
Is Marker For: Genes:   Bcr  


Annotation


References - curated
# Reference Title Reference Citation
1. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer GGATTCTGACAAATGAAGCACG
Reverse Primer GTTATGGTTTCGAGATCCAGGC
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
1307993BcrBCR activator of RhoGEF and GTPase201346932513596942Rat

Nucleotide Sequences
GenBank Nucleotide CH473988 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM000250 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (GRCr8)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
4889870Pur30Proteinuria QTL 30190.005urine total protein amount (VT:0000032)urine total protein excretion rate (CMO:0000756)20804241029322208Rat
1354642Despr15Despair related QTL 150.0027locomotor behavior trait (VT:0001392)amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)20124159021Rat
4889857Pur27Proteinuria QTL 2712.20.001urine total protein amount (VT:0000032)urine total protein excretion rate (CMO:0000756)20460660717617956Rat
70154Insul2Insulin level QTL 23.75blood insulin amount (VT:0001560)plasma insulin level (CMO:0000342)20669170617489458Rat
9590109Sffal8Serum free fatty acids level QTL 85.320.01blood free fatty acid amount (VT:0001553)plasma free fatty acids level (CMO:0000546)20129191651Rat
9590275Scort15Serum corticosterone level QTL 153.480.001blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)20129191651Rat
1581577Pur15Proteinuria QTL 154.380.0002urine total protein amount (VT:0000032)urine protein excretion rate (CMO:0000759)20804241017617956Rat
6893685Bw111Body weight QTL 1112.70.004body mass (VT:0001259)body weight (CMO:0000012)20132578807Rat
9590092Insglur9Insulin/glucose ratio QTL 918.380.001blood insulin amount (VT:0001560)calculated plasma insulin level (CMO:0002170)201175751554435887Rat
1641915Colcr9Colorectal carcinoma resistance QTL 92.970.0024intestine integrity trait (VT:0010554)benign colorectal tumor number (CMO:0001795)20153065546530655Rat
2317057Aia27Adjuvant induced arthritis QTL 272.83joint integrity trait (VT:0010548)right rear ankle joint diameter (CMO:0002150)20289259726381954Rat
7387283Uae44Urinary albumin excretion QTL 440.1712urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)20126123605Rat
7411668Foco32Food consumption QTL 3280.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)20136600972Rat
2305926Iddm37Insulin dependent diabetes mellitus QTL 376blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)20152784246527842Rat
1600382Edcs3Endometrial carcinoma susceptibility QTL33.50.003uterus morphology trait (VT:0001120)percentage of study population developing endometrioid carcinoma during a period of time (CMO:0001759)20125159026Rat
1558640Prcs2Prostate cancer susceptibility QTL 23.3prostate integrity trait (VT:0010571)percentage of study population developing ventral prostate tumorous lesions during a period of time (CMO:0000943)20460660717617956Rat
8694189Bw153Body weight QTL 1533.130.001body mass (VT:0001259)body weight gain (CMO:0000420)20129191651Rat
9589155Insul32Insulin level QTL 326.380.001blood insulin amount (VT:0001560)plasma insulin level (CMO:0000342)20129191651Rat
7411650Foco23Food consumption QTL 2320.70.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)20129191651Rat
7411652Foco24Food consumption QTL 240.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)201175751554435887Rat
2317851Alcrsp22Alcohol response QTL 223.20.05response to alcohol trait (VT:0010489)duration of loss of righting reflex (CMO:0002289)20127339237Rat
1598816Memor12Memory QTL 122.4exploratory behavior trait (VT:0010471)average horizontal distance between subject and target during voluntary locomotion in an experimental apparatus (CMO:0002674)20260683647606836Rat
61432Cia1Collagen induced arthritis QTL 1joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)20362165614101050Rat
1641893Alcrsp7Alcohol response QTL 7response to alcohol trait (VT:0010489)duration of loss of righting reflex (CMO:0002289)20127339237Rat
9590252Scort12Serum corticosterone level QTL 1220.460.001blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)20136600972Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 309696 UniSTS