BE106508 Marker Search Result - Rat Genome Database
Submit Data |  Help |  Video Tutorials |  News |  Publications |  FTP Download |  REST API |  Citing RGD |  Contact   

Marker: BE106508

Symbol: BE106508
Also known as:
RGD ID: 5062318
Expected Size: 190 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
Rnor_6.01421,154,018 - 21,154,207NCBIRnor6.0
Rnor_5.01421,063,845 - 21,064,034UniSTSRnor5.0
RGSC_v3.41421,095,979 - 21,096,168UniSTSRGSC3.4
Celera1418,854,383 - 18,854,572UniSTS
Cytogenetic Map14p22UniSTS
RH 3.4 Map14285.3UniSTS
Is Marker For: Genes:   Utp3  


Annotation


References - curated
1. RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer TTGACCTACGGTAAGTGGCAAA
Reverse Primer TCCCAGAGTCAAACATAGGGAAA
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
1308540Utp3UTP3, small subunit processome component142115399821155652Rat

Nucleotide Sequences
RefSeq Transcripts NM_001012036 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
GenBank Nucleotide BC079277 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (Rnor_6.0)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
2300159Bmd61Bone mineral density QTL 615.30.0001femur mineral mass (VT:0010011)volumetric bone mineral density (CMO:0001553)14127597761Rat
2300183Bmd60Bone mineral density QTL 605.70.0001femur mineral mass (VT:0010011)volumetric bone mineral density (CMO:0001553)14127597761Rat
619619Rf4Renal disease susceptibility QTL 44.10.002total urine protein amount (VT:0000032)urine protein excretion rate to body weight ratio (CMO:0001099)14134403399Rat
9589814Gluco67Glucose level QTL 674.540.001blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)14141333960Rat
7411573Bw139Body weight QTL 1394.70.001body mass (VT:0001259)body weight gain (CMO:0000420)14141333960Rat
634352Apr6Acute phase response QTL 63.7blood interleukin-6 amount (VT:0008595)plasma interleukin-6 level (CMO:0001927)14142766285Rat
1300114Srn2Serum renin concentration QTL 23.27blood renin amount (VT:0003349)plasma renin activity level (CMO:0000116)14483323323004027Rat
70195Mcs8Mammary carcinoma susceptibility QTL 84.28mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)14483323326466248Rat
1331740Bw26Body weight QTL 263.028body mass (VT:0001259)body weight (CMO:0000012)14483323333040042Rat
1581500Renag1Renal agenesis QTL 1kidney development trait (VT:0000527)percentage of study population developing unilateral renal agenesis during a period of time (CMO:0000940)14975643572854397Rat
1358296Ael3Aortic elastin QTL 33.70.00051aorta elastin amount (VT:0003905)aortic elastin141053997755539977Rat
2302045Pia39Pristane induced arthritis QTL 394.90.001blood immunoglobulin amount (VT:0002460)serum immunoglobulin G2a level (CMO:0002116)141053997755539977Rat
731183Pia20Pristane induced arthritis QTL 203.55joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)141072926861873323Rat
2302277Gluco38Glucose level QTL 385.8blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)141268042430155192Rat
631839Niddm37Non-insulin dependent diabetes mellitus QTL 373.37blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)1412680424106641756Rat
631212Bw5Body weight QTL55.43retroperitoneal fat pad mass (VT:0010430)retroperitoneal fat pad weight to body weight ratio (CMO:0000635)141268061332593926Rat
1300140Srn3Serum renin concentration QTL 33.19blood renin amount (VT:0003349)plasma renin activity level (CMO:0000116)141633698833163485Rat
631528Scl11Serum cholesterol level QTL 114.9blood cholesterol amount (VT:0000180)blood total cholesterol level (CMO:0000051)141915991938289187Rat
71117Niddm17Non-insulin dependent diabetes mellitus QTL 172.35blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)141916189343957503Rat
631262Tcas4Tongue tumor susceptibility QTL 47.29tongue integrity trait (VT:0010553)number of squamous cell tumors of the tongue with diameter greater than 3 mm (CMO:0001950)141919154143957628Rat
2313397Coatc1Coat color QTL1coat/hair pigmentation trait (VT:0010463)coat/hair color measurement (CMO:0001808)142018938665189386Rat
61420Pia6Pristane induced arthritis QTL 64.9joint integrity trait (VT:0010548)arthritic paw count (CMO:0001460)142026622343957628Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 305258 UniSTS
UniSTS 246300 UniSTS