BF402049 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: BF402049

Symbol: BF402049
Previously known as:
RGD ID: 5061566
Expected Size: 98 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.21592,969,048 - 92,969,146 (+)MAPPERmRatBN7.2
Rnor_6.015101,020,468 - 101,020,564NCBIRnor6.0
Celera1591,831,069 - 91,831,166UniSTS
RH 3.4 Map15629.5UniSTS
Cytogenetic Map15q24UniSTS
Is Marker For: Genes:   Gpc5  


Annotation


References - curated
# Reference Title Reference Citation
1. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer TCGAGTCCTGGACACCAGTCTA
Reverse Primer CCTGCCCATGACAACTGATTTA
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
1308835Gpc5glypican 5159220727593644054Rat

Nucleotide Sequences
GenBank Nucleotide CH473951 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM000245 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
631655Bp126Blood pressure QTL 1264arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1558156477101769107Rat
2317055Aia10Adjuvant induced arthritis QTL 103.41joint integrity trait (VT:0010548)left rear ankle joint diameter (CMO:0002149)1575788062101769107Rat
731177Uae26Urinary albumin excretion QTL 262.40.025urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)1567588667101769107Rat
631516Gluco31Glucose level QTL 317blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)155559608995018120Rat
1300118Bp190Blood pressure QTL 1902.94arterial blood pressure trait (VT:2000000)blood pressure measurement (CMO:0000003)158226252098288169Rat
1300120Kidm7Kidney mass QTL 73.55kidney mass (VT:0002707)left kidney wet weight to body weight ratio (CMO:0001954)158226252098288169Rat
1300144Rf23Renal function QTL 233.61renal blood flow trait (VT:2000006)absolute change in renal vascular resistance (CMO:0001900)154063126898288169Rat
1331724Bp223Blood pressure QTL 2233.53715arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)157369051895018228Rat
1549844Bss7Bone structure and strength QTL 76.4femur strength trait (VT:0010010)femur midshaft polar moment of inertia (CMO:0001669)1575788062101769107Rat
1581519Cm59Cardiac mass QTL 592.80.05heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)158885347095840528Rat
1576315Schws6Schwannoma susceptibility QTL 60.0069nervous system integrity trait (VT:0010566)post-insult time of death (CMO:0002005)155380615298806152Rat
1578646Bmd18Bone mineral density QTL 185.2femur mineral mass (VT:0010011)trabecular volumetric bone mineral density (CMO:0001729)152280624098288169Rat
1578647Bmd17Bone mineral density QTL 174femur mineral mass (VT:0010011)total volumetric bone mineral density (CMO:0001728)152280624098288169Rat
1578660Bss19Bone structure and strength QTL 194.3femur morphology trait (VT:0000559)bone trabecular cross-sectional area (CMO:0002311)152280624098288169Rat
70182BpQTLcluster12Blood pressure QTL cluster 123.53arterial blood pressure trait (VT:2000000)absolute change in mean arterial blood pressure (CMO:0000533)157369065795018120Rat
1641889Colcr6Colorectal carcinoma resistance QTL 62.90.0126intestine integrity trait (VT:0010554)benign colorectal tumor surface area measurement (CMO:0001799)157369051899794247Rat
2300326Plaw1Placental weight QTL 1150.005placenta mass (VT:0004257)placenta wet weight (CMO:0002088)1568327165100062518Rat
70155Gcs1Gastric cancer susceptibility QTL13.8stomach morphology trait (VT:0000470)stomach tumor susceptibility score (CMO:0002043)1576306099101769107Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 306157 UniSTS
UniSTS 245848 UniSTS