BF394567 Marker Search Result - Rat Genome Database

Send us a Message
Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Search RGD Grant Resources Citing RGD About Us Contact Us
Genes Variants Community Projects QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data
OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer)
Aging & Age-Related Disease Cancer & Neoplastic Disease Cardiovascular Disease Coronavirus Disease Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease
Find Models   new Genetic Models Autism Models Rat PhenoMiner (Quantitative Phenotypes) Chinchilla PhenoMiner Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive
Pathways
Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Presentations Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources

Marker: BF394567

Symbol: BF394567
Previously known as:
RGD ID: 5059826
Expected Size: 237 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.2X86,150,804 - 86,151,041 (+)MAPPERmRatBN7.2
Rnor_6.0X92,688,157 - 92,688,393NCBIRnor6.0
Rnor_5.0X92,590,268 - 92,590,504UniSTSRnor5.0
RGSC_v3.4X109,929,599 - 109,929,835UniSTSRGSC3.4
CeleraX87,288,754 - 87,288,990UniSTS
RH 3.4 Map21065.49UniSTS
Cytogenetic MapXq32UniSTS
Is Marker For: Genes:   Pcdh11x  


Annotation


References - curated
# Reference Title Reference Citation
1. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer TCTGGGTTTGGAGTAACCCACT
Reverse Primer GATTTATGAAATGGTGCGCAAA
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
1562864Pcdh11xprotocadherin 11 X-linkedX8605834886751078Rat

Nucleotide Sequences
RefSeq Transcripts NM_001271228.1 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
738035Stresp1Stress response QTL 14.960.000011stress-related behavior trait (VT:0010451)defensive burying - copingX41304447112935181Rat
1598837Memor13Memory QTL 133.2exploratory behavior trait (VT:0010471)difference between time of physical contact/close proximity of test subject and social stimulus during sample phase and test phase (CMO:0002678)X41052407146860749Rat
61430Cia18Collagen induced arthritis QTL 183.1joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)X14843113120568734Rat
61431Cia19Collagen induced arthritis QTL 194.4joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)X65612192120568734Rat
724551Glom1Glomerulus QTL 12.80.0004kidney glomerulus morphology trait (VT:0005325)count of superficial glomeruli not directly contacting the kidney surface (CMO:0001002)X75294106120294106Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 317204 UniSTS
UniSTS 244793 UniSTS