AI549547 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: AI549547

Symbol: AI549547
Also known as:
RGD ID: 5058734
Expected Size: 111 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.2285,702,117 - 85,702,228 (+)MAPPER
mRatBN7.2286,280,362 - 86,280,473 (+)MAPPER
Rnor_6.0287,620,138 - 87,620,248NCBIRnor6.0
Rnor_6.0276,940,833 - 76,940,943NCBIRnor6.0
Rnor_5.0296,666,545 - 96,666,655UniSTSRnor5.0
Rnor_5.02107,405,692 - 107,405,802UniSTSRnor5.0
RGSC_v3.4287,042,115 - 87,042,225UniSTSRGSC3.4
RGSC_v3.4287,592,649 - 87,592,759UniSTSRGSC3.4
Celera281,894,600 - 81,894,710UniSTS
Celera281,347,824 - 81,347,934UniSTS
RH 3.4 Map2530.4UniSTS
Cytogenetic Map2q23UniSTS
Is Marker For: Genes:   RGD1559887   Sirpb2l1   Sirpd  


Annotation


References - curated
1. RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer GCACTTAAGCTCTGGGACAATG
Reverse Primer GCTGATGAGAAGCCACTGAAGA
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
2321536Sirpdsignal-regulatory protein delta27669410776941002Rat
2321484LOC100360774signal-regulatory protein alpha-like27695503876962306Rat
1559887RGD1559887similar to Transducin-like enhancer protein 4 (Groucho-related protein 4) (Grg-4)27705771977112614Rat
7621135LOC102546663tyrosine-protein phosphatase non-receptor type substrate 1-like27727777577286844Rat
9082324LOC103691499signal-regulatory protein beta-1-like27729973977302572Rat
621491Basp1brain abundant, membrane attached signal protein 127758642477632626Rat
1566273RGD1566273similar to exo-alpha-sialidase (EC 3.2.1.18) - Trypanosoma cruzi27775599077772012Rat
11386721LOC108350173charged multivesicular body protein 5 pseudogene27777163977772609Rat
1589753LOC310177similar to RIKEN cDNA 0610040D2027778378877784626Rat
1307193Myo10myosin X27786839878072443Rat
9304689LOC103691488uncharacterized LOC10369148827796872877976188Rat
11403233LOC108349968uncharacterized LOC10834996827809281578096188Rat
11359058LOC10834996760S ribosomal protein L7a pseudogene27813403578138432Rat
2318290LOC100362397ubiquitin-conjugating enzyme E2L 3-like27821294278213944Rat
7667351LOC102546311histone H3.3-like27827345178275631Rat
6494071LOC100911298heterogeneous nuclear ribonucleoprotein M-like27828131778283487Rat
1565003Retreg1reticulophagy regulator 127839192178401569Rat
1309146Zfp622zinc finger protein 62227840731278421152Rat
9421618LOC103691489histone H3.3-like27841767378419853Rat
1593219LOC365713similar to 60S ribosomal protein L927852928578529861Rat
1559945Marchf11membrane associated ring-CH-type finger 1127882505378926402Rat
1305813Fbxl7F-box and leucine-rich repeat protein 727906790779439987Rat
1595140LOC685308similar to Heat shock protein HSP 90-beta (HSP 84) (Tumor-specific transplantation 84 kDa antigen) (TSTA)27956880279571074Rat
619925AnkhANKH inorganic pyrophosphate transport regulator28013156380256948Rat
2324500OtulinOTU deubiquitinase with linear linkage specificity28026772480293204Rat
1563205OtulinlOTU deubiquitinase with linear linkage specificity like28038364280408672Rat
1308360Triotrio Rho guanine nucleotide exchange factor28047139880769313Rat
9431470LOC103691490uncharacterized LOC10369149028069699180712318Rat
9185104LOC103691500uncharacterized LOC10369150028078324480792403Rat
1595053LOC685395hypothetical protein LOC68539528083671480837319Rat
1589269LOC683212similar to keratin complex 1, acidic, gene 1828087826380879814Rat
11418901LOC10834997060S ribosomal protein L27 pseudogene28092006780921048Rat
1560828Dnah5dynein, axonemal, heavy chain 528094773081143997Rat
1560828Dnah5dynein, axonemal, heavy chain 528115906081337560Rat
11493112LOC108349969tubulin alpha-1C chain-like28131814081321598Rat
1593760LOC685499similar to MYST histone acetyltransferase 128156538081567407Rat
1593218LOC365720similar to BMP/retinoic acid-inducible neural-specific protein28162815981632045Rat
7603843LOC102551226uncharacterized LOC10255122628172254081739144Rat
7740519LOC102551357uncharacterized LOC10255135728200026582030519Rat
2322903LOC100360042ARP3 actin-related protein 3 homolog (yeast)-like28218230282183522Rat
1592059LOC361908similar to 40S ribosomal protein S1028227462582275183Rat
6488544LOC10091211140S ribosomal protein S19-like28234065082341155Rat
11519496LOC108350174endogenous retrovirus group K member 25 Pol protein-like28247397682475092Rat
7530586LOC102551810uncharacterized LOC10255181028286282782882446Rat
620734Ctnnd2catenin delta 228322724784094315Rat
7595026LOC102553378uncharacterized LOC10255337828361228883613687Rat
7671897LOC102553574uncharacterized LOC10255357428423991884242373Rat
620641Dapdeath-associated protein28427588484328998Rat
1564227Ankrd33bankyrin repeat domain 33B28436106184436912Rat
11505970LOC108349971uncharacterized LOC10834997128446621584483673Rat
1591367Ropn1lrhophilin associated tail protein 1-like28452042184531192Rat
7678070LOC102553736uncharacterized LOC10255373628453140384534742Rat
1565757Marchf6membrane associated ring-CH-type finger 628453354684608743Rat
1306952Cmblcarboxymethylenebutenolidase homolog28464508484666836Rat
735161Cct5chaperonin containing TCP1 subunit 528466757884678730Rat
1560629AtpsckmtATP synthase c subunit lysine N-methyltransferase28467889284694152Rat
2322522LOC100360228hypothetical LOC10036022828481804084819425Rat
620733Tas2r119taste receptor, type 2, member 11928530522585306232Rat
2323921LOC100362858hypothetical LOC10036285828531483985315170Rat
6502911LOC100909539uncharacterized LOC10090953928537414285377163Rat
1308650Sema5asemaphorin 5A28537731885808970Rat
9158335LOC103691501zinc finger protein 345-like28592692886463583Rat
1585655LOC683539similar to Nonhistone chromosomal protein HMG-17 (High-mobility group nucleosome binding domain 2)28614065586140925Rat
11447466LOC108350175zinc finger protein 737-like28642569186435068Rat
6502425LOC100909688zinc finger protein 43-like28646872686559141Rat
6485043LOC100912995zinc finger protein 733-like28658575586588902Rat
6485085LOC100913005zinc finger protein 99-like28661557686902946Rat
11355185LOC108350176zinc finger protein 728 pseudogene28686824286869229Rat
2322273LOC100360380zinc finger protein 457-like28688080686922446Rat
11427226LOC108349972uncharacterized LOC10834997228691000386913443Rat
11457724LOC108349973zinc finger protein 728-like28695178986968928Rat
1559684Zfp458zinc finger protein 45828697112986980519Rat
628788Zfp455zinc finger protein 45528699677587011696Rat
1587849Rsl1regulator of sex limited protein 128701590487040788Rat
7564391LOC102548546zinc finger protein 709-like28708546187092882Rat
6501293LOC100909879tyrosine-protein phosphatase non-receptor type substrate 1-like28741842587419918Rat
1587814Sirpb2l1signal-regulatory protein beta 2-like 128752884787620311Rat



QTLs in Region (Rnor_6.0)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
61355Bp36Blood pressure QTL 362.9blood pressure trait (VT:0000183)systolic blood pressure (CMO:0000004)23127638105149020Rat
10755499Bp389Blood pressure QTL 3892.61arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)216679272245624402Rat
1302794Stl27Serum triglyceride level QTL 274.40.0001blood triglyceride amount (VT:0002644)plasma triglyceride level (CMO:0000548)223837491149614623Rat
1358894Kidm24Kidney mass QTL 244.03kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)223837491169852800Rat
1358899Kidm23Kidney mass QTL 233.88kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)223837491169852800Rat
1358901Cm38Cardiac mass QTL 382heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)223837491169852800Rat
1358904Cm39Cardiac mass QTL 392.26heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)223837491169852800Rat
1358910Kidm27Kidney mass QTL 275.77kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)223837491169852800Rat
1358911Kidm28Kidney mass QTL 285.42kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)223837491169852800Rat
1358913Cm41Cardiac mass QTL 412.73heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)223837491218957222Rat
1358917Cm42Cardiac mass QTL 422.82heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)223837491218957222Rat
1358887Bw50Body weight QTL 502.39body mass (VT:0001259)body weight (CMO:0000012)223837719169852670Rat
1358908Bw49Body weight QTL 493.36body mass (VT:0001259)body weight (CMO:0000012)223837719169852670Rat
1354617Bp240Blood pressure QTL 2404arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)22618609783819822Rat
1354617Bp240Blood pressure QTL 2404arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)22618609783819822Rat
1354617Bp240Blood pressure QTL 2404arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)22618609783819822Rat
1354603Bp243Blood pressure QTL 2433.9arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)226186097135654963Rat
2290453Scl55Serum cholesterol level QTL 552.83blood cholesterol amount (VT:0000180)plasma total cholesterol level (CMO:0000585)226186097142053534Rat
12879841Cm87Cardiac mass QTL 870.026heart mass (VT:0007028)heart wet weight to body weight ratio (CMO:0002408)227161361148295267Rat
12879842Cm88Cardiac mass QTL 880.042heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)227161361148295267Rat
12879843Am3Aortic mass QTL 30.016aorta mass (VT:0002845)aorta weight to aorta length to body weight ratio (CMO:0002722)227161361148295267Rat
12879844Kidm62Kidney mass QTL 620.001kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)227161361148295267Rat
61371Edpm1Estrogen-dependent pituitary mass QTL 140.05pituitary gland mass (VT:0010496)pituitary gland wet weight (CMO:0000853)23408817591101903Rat
10755436Coatc8Coat color QTL 80.02431coat/hair pigmentation trait (VT:0010463)pigmented ventral coat/hair area to total ventral coat/hair area ratio (CMO:0001812)23513320280133202Rat
2306903Bp336Blood pressure QTL 3360.01arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)236245223112175725Rat
70174BpQTLCluster2Blood pressure QTL cluster 24.24arterial blood pressure trait (VT:2000000)absolute change in mean arterial blood pressure (CMO:0000533)240171834105089682Rat
70174BpQTLCluster2Blood pressure QTL cluster 24.24arterial blood pressure trait (VT:2000000)pulse pressure (CMO:0000292)240171834105089682Rat
70174BpQTLCluster2Blood pressure QTL cluster 24.24arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)240171834105089682Rat
70174BpQTLCluster2Blood pressure QTL cluster 24.24arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)240171834105089682Rat
70174BpQTLCluster2Blood pressure QTL cluster 24.24arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)240171834105089682Rat
2293835Kiddil5Kidney dilation QTL 53.8kidney pelvis morphology trait (VT:0004194)hydronephrosis severity score (CMO:0001208)242776916169852800Rat
2293843Kiddil6Kidney dilation QTL 63.1kidney pelvis morphology trait (VT:0004194)hydronephrosis severity score (CMO:0001208)242776916195645082Rat
1298085Bp165Blood pressure QTL 1650.0006arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)242776916217498710Rat
1298074Bp164Blood pressure QTL 1640.003arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)242776916217498710Rat
61467Bp14Blood pressure QTL 142.2arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)243133606217498545Rat
61467Bp14Blood pressure QTL 142.2arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)243133606217498545Rat
2293676Bmd19Bone mineral density QTL 1910.70.0001femur mineral mass (VT:0010011)total volumetric bone mineral density (CMO:0001728)243141290114164944Rat
2293682Bmd24Bone mineral density QTL 248.90.0001femur mineral mass (VT:0010011)cortical volumetric bone mineral density (CMO:0001730)243141290114164944Rat
2293671Bss44Bone structure and strength QTL 4410.970.0001lumbar vertebra morphology trait (VT:0010494)lumbar vertebra cortical cross-sectional area (CMO:0001690)243141290154583160Rat
631208Bw1Body weight QTL15.09mesenteric fat pad mass (VT:0010427)mesenteric fat pad weight as a percentage of body weight (CMO:0000654)24314978885642672Rat
1354601Slep1Serum leptin concentration QTL 15.39blood leptin amount (VT:0005667)serum leptin level (CMO:0000780)243149788198704485Rat
631266Bp132Blood pressure QTL 1320.0005arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)246537589217498710Rat
1331760Bp206Blood pressure QTL 2063.62454arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)256244671217498710Rat
1582246Cm60Cardiac mass QTL 605.8heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)25771560378466260Rat
1558648Smcn1Smooth muscle cell number QTL 10.039blood vessel smooth muscle cell quantity (VT:0010525)aorta smooth muscle cell count per unit vessel length (CMO:0001646)260131410135646395Rat
5684990Bmd82Bone mineral density QTL 822.8tibia mineral mass (VT:1000283)bone mineral content (CMO:0001554)260325352106432915Rat
5684996Bmd85Bone mineral density QTL 854.70.024tibia mineral mass (VT:1000283)bone mineral density (CMO:0001226)260325352106432915Rat
61438Cia7Collagen induced arthritis QTL 74.60.0001joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)260325352147522851Rat
631500Bp99Blood pressure QTL 992.5arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)260325686105059293Rat
1578777Stresp15Stress response QTL 1520.05blood aldosterone amount (VT:0005346)plasma aldosterone level (CMO:0000551)261924251106924251Rat
1298080Bp163Blood pressure QTL 1630.02arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)266828049217498710Rat
1354648Bp239Blood pressure QTL 2390.001arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)266828236243550655Rat
1581569Uae32Urinary albumin excretion QTL 320.0001urine protein amount (VT:0005160)urine albumin excretion rate (CMO:0000757)26886541480632096Rat
1581576Pur7Proteinuria QTL 70.0001total urine protein amount (VT:0000032)urine total protein excretion rate (CMO:0000756)26886541480632096Rat
1358900Bw48Body weight QTL 484.88body mass (VT:0001259)body weight (CMO:0000012)268865414169852800Rat
724534Uae6Urinary albumin excretion QTL 610urine albumin amount (VT:0002871)urine albumin level (CMO:0000130)26886645480631953Rat
1581578Cm49Cardiac mass QTL 494.90.01heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)268866454149614466Rat
7411551Bw131Body weight QTL 13129.60.001body mass (VT:0001259)body weight gain (CMO:0000420)270132175115132175Rat
2317041Aia14Adjuvant induced arthritis QTL 143.29joint integrity trait (VT:0010548)left rear ankle joint diameter (CMO:0002149)271495404116495404Rat
1359034Bp274Blood pressure QTL 274arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)27568749596556760Rat
1359034Bp274Blood pressure QTL 274arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)27568749596556760Rat
1354605Rf48Renal function QTL 482.9blood creatinine amount (VT:0005328)plasma creatinine level (CMO:0000537)275687495221880419Rat
2317058Aia13Adjuvant induced arthritis QTL 132.9joint integrity trait (VT:0010548)left rear ankle joint diameter (CMO:0002149)27832141079969856Rat
61465Bp13Blood pressure QTL 133.3blood pressure trait (VT:0000183)systolic blood pressure (CMO:0000004)278321410105089682Rat
61465Bp13Blood pressure QTL 133.3blood pressure trait (VT:0000183)diastolic blood pressure (CMO:0000005)278321410105089682Rat
631198Cm22Cardiac mass QTL 224.30.0008heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)278321410158159410Rat
61374Edpm2Estrogen-dependent pituitary mass QTL 24.420.86pituitary gland mass (VT:0010496)pituitary gland wet weight (CMO:0000853)278321410217498710Rat
2299162Iddm32Insulin dependent diabetes mellitus QTL 322.36blood glucose amount (VT:0000188)age at onset/diagnosis of type 1 diabetes mellitus (CMO:0001140)280631950149614623Rat
61392Bp6Blood pressure QTL 67arterial blood pressure trait (VT:2000000)pulse pressure (CMO:0000292)282574487127574487Rat
1598865Bp296Blood pressure QTL 2962.1arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)283656855128656855Rat
8662832Vetf7Vascular elastic tissue fragility QTL 73.5aorta elastin amount (VT:0003905)aorta wall extracellular elastin dry weight to aorta wall dry weight ratio (CMO:0002002)283754907237610852Rat
1354622Kidm16Kidney mass QTL 163kidney mass (VT:0002707)left kidney wet weight (CMO:0000083)283819608239166203Rat
1354649Kidm17Kidney mass QTL 172.9kidney mass (VT:0002707)calculated kidney weight (CMO:0000160)283819608243901375Rat
1578772Stresp14Stress response QTL 1450.001blood renin amount (VT:0003349)plasma renin activity level (CMO:0000116)284424139132130578Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 100360722 UniSTS
  310214 UniSTS
  685961 UniSTS
UniSTS 244156 UniSTS