RH144145 Marker Search Result - Rat Genome Database
Submit Data |  Help |  Video Tutorials |  News |  Publications |  FTP Download |  REST API |  Citing RGD |  Contact   

Marker: RH144145

Symbol: RH144145
Also known as: AW524253; 
RGD ID: 5056035
Expected Size: 154 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
Rnor_6.01034,934,717 - 34,934,870NCBIRnor6.0
Rnor_6.01037,028,091 - 37,028,244NCBIRnor6.0
Rnor_5.01036,800,373 - 36,800,526UniSTSRnor5.0
Rnor_5.01034,707,065 - 34,707,218UniSTSRnor5.0
RGSC_v3.41037,096,286 - 37,096,439UniSTSRGSC3.4
Celera1035,192,784 - 35,192,937UniSTS
Cytogenetic Map10q22UniSTS
RH 3.4 Map10346.71UniSTS
Is Marker For: Genes:   Col23a1   LOC100910384  


Annotation


References - curated
1. RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer CAGGGGTTTCAGTCACAGGT
Reverse Primer AGACAGGCCTCCTGTTCAGA
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
69405Zfp354czinc finger protein 354C103631134336322356Rat
621737Flt4Fms related receptor tyrosine kinase 4103507878235120296Rat
628847Mapk9mitogen-activated protein kinase 9103533385935374364Rat
727901Scgb3a1secretoglobin, family 3A, member 1103513356135134868Rat
628759Prop1PROP paired-like homeobox 1103644992036452381Rat
2967Zfp354azinc finger protein 354A103658649536600172Rat
620677Ltc4sleukotriene C4 synthase103573648635743088Rat
727898Col23a1collagen type XXIII alpha 1 chain103484661834934991Rat
2747Grm6glutamate metabotropic receptor 6103634550336363416Rat
69287Sqstm1sequestosome 1103570472835716316Rat
620840Hnrnph1heterogeneous nuclear ribonucleoprotein H1103587261935879911Rat
2266Canxcalnexin103580094235833939Rat
1305099Rufy1RUN and FYVE domain containing 1103588280535927268Rat
1303097Gfpt2glutamine-fructose-6-phosphate transaminase 2103527923735325506Rat
69255Hnrnpabheterogeneous nuclear ribonucleoprotein A/B103495571334961662Rat
1332779Olr1403-psolfactory receptor pseudogene 1403103645664336457198Rat
1308631Maml1mastermind-like transcriptional coactivator 1103576519635801375Rat
1332843Olr1409olfactory receptor 1409103653071936531660Rat
1311549Rasgef1cRasGEF domain family, member 1C103539276235459267Rat
1308356N4bp3Nedd4 binding protein 3103499670235005365Rat
1310783Cnot6CCR4-NOT transcription complex, subunit 6103514429135195126Rat
1309435Nhp2NHP2 ribonucleoprotein103497570134979082Rat
1310147Tbc1d9bTBC1 domain family member 9B103563710335677335Rat
1332794Olr1411olfactory receptor 1411103656720036568132Rat
1310274Clk4CDC-like kinase 4103671556536733473Rat
1332679Olr1412-psolfactory receptor pseudogene 1412103657728836577774Rat
1564036MrnipMRN complex interacting protein103568068735704685Rat
1334321Olr1404olfactory receptor 1404103646622936467176Rat
1561674LOC497899similar to hypothetical protein 4930503F14103670901836717989Rat
1334258Olr1405olfactory receptor 1405103647769236478615Rat
1334078Olr1410olfactory receptor 1410103655439136555003Rat
1333846Olr1408olfactory receptor 1408103651716936518110Rat
1562836Mgat4balpha-1,3-mannosyl-glycoprotein 4-beta-N-acetylglucosaminyltransferase B103572650135736338Rat
1559511Rmnd5brequired for meiotic nuclear division 5 homolog B103497990234990985Rat
1559512RGD1559512similar to tubulin, beta, 2103651968236521114Rat
1333596Olr1406olfactory receptor 1406103648560536486516Rat
1333856Olr1407olfactory receptor 1407103649936136500284Rat
1562041Rnf130ring finger protein 130103553797635610711Rat
1563273Zfp879zinc finger protein 879103632663336336628Rat
1565950Adamts2ADAM metallopeptidase with thrombospondin type 1 motif, 2103609805136304416Rat
1562610Zfp2zinc finger protein 2103638813636406721Rat
1593396LOC690675similar to Cytochrome c, somatic103650198036502362Rat
1594715Cby3chibby family member 3103585532035860266Rat
2293818Phykpl5-phosphohydroxy-L-lysine phospho-lyase103493866134960661Rat
2325403Mir336microRNA 336103534975635349851Rat
6499350Trappc2btrafficking protein particle complex 2B103503617635040918Rat
7500255LOC102555400uncharacterized LOC102555400103570812735711973Rat
7518009LOC102553843uncharacterized LOC102553843103499113934993804Rat
7529496Znf454zinc finger protein 454103636209736377774Rat
7644542LOC102546326uncharacterized LOC102546326103664927836663565Rat
7561849LOC102555091nuclear envelope pore membrane protein POM 121-like103505700435060920Rat
7562538Znf354bzinc finger protein 354B103641173036423346Rat
7732573LOC102547782uncharacterized LOC102547782103496160434962307Rat
7716133LOC10255545540S ribosomal protein S19-like103583815935838597Rat
7710009LOC102555689uncharacterized LOC102555689103596827835972662Rat
7729046LOC10255524360S ribosomal protein L29-like103525987735260396Rat
9129118LOC103693320uncharacterized LOC103693320103595471235966160Rat
9200412LOC103693324uncharacterized LOC103693324103696608537004832Rat
9221572LOC103689920uncharacterized LOC103689920103504485035054160Rat
9310824LOC103693323collagen alpha-1(XXIII) chain103674113937031200Rat
9429218LOC103693335olfactory receptor 1L4-like103657929836580312Rat
11359066LOC108352082uncharacterized LOC108352082103518735035191033Rat
11493989LOC10835217940S ribosomal protein S28 pseudogene103506568035065945Rat



QTLs in Region (Rnor_6.0)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
2293680Bss40Bone structure and strength QTL 405.660.0001femur strength trait (VT:0010010)femur total energy absorbed before break (CMO:0001677)10135538813Rat
634327Hc4Hypercalciuria QTL 42.4urine calcium amount (VT:0002985)urine calcium excretion rate (CMO:0000763)10138594330Rat
7411611Foco17Food consumption QTL 1718.70.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)10142669970Rat
10401803Kidm50Kidney mass QTL 50kidney mass (VT:0002707)both kidneys wet weight (CMO:0000085)10144902893Rat
631554Bp133Blood pressure QTL 1330.005arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1076442166221621Rat
2298544Neuinf9Neuroinflammation QTL 94.6nervous system integrity trait (VT:0010566)spinal cord complement component 1, q subcomponent, B chain mRNA level (CMO:0002126)10587753664401490Rat
8662860Vetf10Vascular elastic tissue fragility QTL 10artery integrity trait (VT:0010639)number of ruptures of the internal elastic lamina of the abdominal aorta and iliac arteries (CMO:0002562)10622909575983805Rat
631660Hcar1Hepatocarcinoma resistance QTL 13.40.0001liver integrity trait (VT:0010547)volume of individual liver tumorous lesion (CMO:0001078)10622928936185929Rat
61427Cia16Collagen induced arthritis QTL 163.2joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)10642907599492409Rat
1578761Stresp21Stress response QTL 213.3thymus mass (VT:0004954)thymus wet weight (CMO:0000855)10752145052521450Rat
2303118Mamtr7Mammary tumor resistance QTL 70.003mammary gland integrity trait (VT:0010552)mammary tumor growth rate (CMO:0000344)109841807108540162Rat
9590310Scort19Serum corticosterone level QTL 196.30.001blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)101263951357639513Rat
9590268Scort13Serum corticosterone level QTL 133.260.001blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)101263951357639513Rat
9589136Insul27Insulin level QTL 2710.460.001blood insulin amount (VT:0001560)plasma insulin level (CMO:0000342)101263951357639513Rat
2301967Cm73Cardiac mass QTL 734.55heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)101482789492423564Rat
631268Cia21Collagen induced arthritis QTL 213.1joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1014827894107857673Rat
2316949Gluco60Glucose level QTL 603.7blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)1014827894110992275Rat
1354587Kidm21Kidney mass QTL 213.3kidney mass (VT:0002707)right kidney wet weight (CMO:0000082)101537547462469074Rat
631564Apr3Acute phase response QTL 33.9blood interleukin-6 amount (VT:0008595)plasma interleukin-6 level (CMO:0001927)101646873661468736Rat
6893350Bw99Body weight QTL 990.870.16body mass (VT:0001259)body weight (CMO:0000012)11712154262121542Rat
6893352Bw100Body weight QTL 1000.330.6body mass (VT:0001259)body weight (CMO:0000012)11712154262121542Rat
631532Cm50Cardiac mass QTL 506.6heart mass (VT:0007028)calculated heart weight (CMO:0000073)101824639453637634Rat
1598852Anxrr19Anxiety related response QTL 195.07body movement coordination trait (VT:0005424)number of rearing movements in an experimental apparatus (CMO:0001752)101940281464402814Rat
1554317Bmd4Bone mineral density QTL 49.40.0001lumbar vertebra mineral mass (VT:0010511)volumetric bone mineral density (CMO:0001553)1020170031102897474Rat
70223Bp57Blood pressure QTL 575arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)102152390683549467Rat
70188BpQTLcluster1Blood pressure QTL cluster 14.864arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)12152390690312401Rat
70188BpQTLcluster1Blood pressure QTL cluster 14.864arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)12152390690312401Rat
70188BpQTLcluster1Blood pressure QTL cluster 14.864arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)12152390690312401Rat
70188BpQTLcluster1Blood pressure QTL cluster 14.864arterial blood pressure trait (VT:2000000)pulse pressure (CMO:0000292)12152390690312401Rat
70198BpQTLcluster9Blood pressure QTL cluster 92.94arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)102152390690312401Rat
1581497Esta1Estrogen-induced thymic atrophy QTL 1thymus mass (VT:0004954)thymus wet weight (CMO:0000855)102170776664648311Rat
631531Iresp2Immunoglobin response QTL26.3blood immunoglobulin E amount (VT:0002492)serum total immunoglobulin E level (CMO:0001542)102240281738204229Rat
724556Pur2Proteinuria QTL 25.5urine protein amount (VT:0005160)urine protein level (CMO:0000591)102290149793886300Rat
1331762Rf40Renal function QTL 403.873kidney blood vessel physiology trait (VT:0100012)absolute change in renal vascular resistance (CMO:0001900)102386101566539843Rat
1331791Cm31Cardiac mass QTL 313.84606heart mass (VT:0007028)heart wet weight (CMO:0000069)1023861015112626471Rat
631267Cia20Collagen induced arthritis QTL 203.2joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1024483076107857673Rat
61325Aia5Adjuvant induced arthritis QTL 50.01joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1024483076107857673Rat
61354Pia10Pristane induced arthritis QTL 100.01joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1024483076107857673Rat
634329Pia15Pristane induced arthritis QTL 153.1joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)102488408447487910Rat
70224Eae3Experimental allergic encephalomyelitis QTL 34.1nervous system integrity trait (VT:0010566)experimental autoimmune encephalomyelitis incidence/prevalence measurement (CMO:0001046)102723753064648311Rat
1298069Bp168Blood pressure QTL 1685.5blood pressure trait (VT:0000183)systolic blood pressure (CMO:0000004)1027237530101482600Rat
631542Bp82Blood pressure QTL 826.8arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1027237530102427718Rat
2300171Bmd58Bone mineral density QTL 584.90.0001lumbar vertebra mineral mass (VT:0010511)volumetric bone mineral density (CMO:0001553)102878928073789280Rat
1600371Mcs21Mammary carcinoma susceptibility QTL 213mammary gland integrity trait (VT:0010552)mammary tumor growth rate (CMO:0000344)103002135454057745Rat
2292441Bp308Blood pressure QTL 308arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)103009990975099909Rat
10402859Bp381Blood pressure QTL 3810.002arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)103009990975099909Rat
724527Bp148Blood pressure QTL 1480.0001arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)103098380575983805Rat
1576311Pia26Pristane induced arthritis QTL 26joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)103191939778343192Rat
1578779Tcas10Tongue tumor susceptibility QTL 103.12tongue integrity trait (VT:0010553)number of squamous cell tumors of the tongue with diameter greater than 3 mm (CMO:0001950)103317903078179030Rat
631557Bp136Blood pressure QTL 1360.003arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)103334319278343192Rat
1576319Cia29Collagen induced arthritis QTL 29joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)103513942480139424Rat
61332Eau3Experimental allergic uveoretinitis QTL 30.004uvea integrity trait (VT:0010551)experimental autoimmune uveitis score (CMO:0001504)103566946546851407Rat
2298480Eau7Experimental allergic uveoretinitis QTL 70.0049uvea integrity trait (VT:0010551)experimental autoimmune uveitis score (CMO:0001504)103566957336185929Rat
6893342Cm78Cardiac mass QTL 780.10.88heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)103618592982675365Rat
631552Vetf2Vascular elastic tissue fragility QTL 24.50.0002aorta elastic tissue integrity trait (VT:0010556)artery internal elastic lamina non-tumorous lesion count (CMO:0001913)103618592995845311Rat
1354614Hpcl1Hepatic cholesterol level QTL 13.3liver cholesterol amount (VT:0010498)liver cholesterol level (CMO:0001597)103658437353645194Rat
1358897Stresp6Stress response QTL 64.170.022blood norepinephrine amount (VT:0005663)plasma norepinephrine level (CMO:0001010)103658437366539843Rat
61441Btemp1Thermal response to stress QTL 14body temperature trait (VT:0005535)core body temperature (CMO:0001036)103658456066015527Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 100910384 UniSTS
  353303 UniSTS
UniGene Rn.206241 UniSTS
UniSTS 233391 UniSTS