RH143362 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: RH143362

Symbol: RH143362
Also known as: AI059303; 
RGD ID: 5054677
Expected Size: 224 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.2562,230,627 - 62,230,851 (+)MAPPERmRatBN7.2
mRatBN7.2166,446,471 - 6,446,695 (+)MAPPERmRatBN7.2
Rnor_6.0167,336,448 - 7,336,671NCBIRnor6.0
Rnor_6.0563,649,645 - 63,649,868NCBIRnor6.0
Rnor_5.0167,264,838 - 7,265,061UniSTSRnor5.0
Rnor_5.0568,166,750 - 68,166,973UniSTSRnor5.0
RGSC_v3.4166,684,233 - 6,684,456UniSTSRGSC3.4
RGSC_v3.4564,581,480 - 64,581,703UniSTSRGSC3.4
Celera565,364,011 - 65,364,234UniSTS
Celera168,742,338 - 8,742,561UniSTS
Cytogenetic Map16p16UniSTS
Is Marker For: Genes:   Phf7   Bap1  


Annotation


References - curated
1. RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer ACCACGTCTTGTGTCAACGA
Reverse Primer CCCGAAGTTAACAGCCAGAA
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
41286228LOC120102873uncharacterized LOC12010287356219883162234609Rat



QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
1357403Slep4Serum leptin concentration QTL 43.91blood leptin amount (VT:0005667)serum leptin level (CMO:0000780)1619639137Rat
1600369Hcas8Hepatocarcinoma susceptibility QTL 8liver integrity trait (VT:0010547)liver tumorous lesion number (CMO:0001068)16122477621Rat
631830Alc7Alcohol consumption QTL 72.9consumption behavior trait (VT:0002069)ethanol drink intake rate (CMO:0001407)16126727669Rat
634355Rends4Renal damage susceptibility QTL 40.05kidney blood vessel morphology trait (VT:0000530)organ lesion measurement (CMO:0000677)16126727669Rat
1582235Insul8Insulin level QTL 83.30.0063blood insulin amount (VT:0001560)calculated serum insulin level (CMO:0000359)16126727669Rat
9590151Scort8Serum corticosterone level QTL 88.450.001blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)16130836262Rat
2302380Slep6Serum leptin concentration QTL 63.36blood leptin amount (VT:0005667)serum leptin level (CMO:0000780)16132139025Rat
2307172Activ4Activity QTL 43.710.00023locomotor behavior trait (VT:0001392)number of entries into a discrete space in an experimental apparatus (CMO:0000960)16133418960Rat
1354584Despr6Despair related QTL 63.10.0067locomotor behavior trait (VT:0001392)amount of time spent in voluntary immobility (CMO:0001043)16139533930Rat
2303566Bw90Body weight QTL 902body mass (VT:0001259)body weight (CMO:0000012)16139533930Rat
631561Hcuc2Hepatic copper content QTL 22.8hepatic copper amount (VT:0003065)liver total copper weight (CMO:0001507)16139533949Rat
6903319Bw114Body weight QTL 1142.70.0037body mass (VT:0001259)body weight (CMO:0000012)16143534949Rat
7411664Foco30Food consumption QTL 30110.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)16144588133Rat
1354625Despr7Despair related QTL 73.160.016locomotor behavior trait (VT:0001392)amount of time spent in voluntary immobility (CMO:0001043)16144977551Rat
1600378Arunc4Aerobic running capacity QTL 40.03exercise endurance trait (VT:0002332)maximum distance run on treadmill (CMO:0001406)1638024580345693Rat
2293343Glom16Glomerulus QTL 167.4kidney glomerulus integrity trait (VT:0010546)kidney sclerotic glomeruli count to total glomeruli count ratio (CMO:0001269)1683223646053497Rat
2312660Bw95Body weight QTL 950.05inguinal fat pad mass (VT:0010424)inguinal fat pad weight to body weight ratio (CMO:0001253)1683223659492508Rat
2312663Slep9Serum leptin concentration QTL 90.001blood leptin amount (VT:0005667)serum leptin level (CMO:0000780)1683223659492508Rat
2312666Insul16Insulin level QTL 160.01blood insulin amount (VT:0001560)serum insulin level (CMO:0000358)1683223659492508Rat
2312669Stl23Serum triglyceride level QTL 230.01blood triglyceride amount (VT:0002644)serum triglyceride level (CMO:0000360)1683223659492508Rat
2301406Kidm39Kidney mass QTL 390.002kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)16285170915884239Rat
1300133Rf24Renal function QTL 243.64blood creatinine amount (VT:0005328)creatinine clearance (CMO:0000765)16338015021361552Rat
2306902Bp339Blood pressure QTL 3390.01arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)16338015043025077Rat
737825Alc13Alcohol consumption QTL 134.5consumption behavior trait (VT:0002069)ethanol drink intake rate (CMO:0001407)16422760916039848Rat
70183BpQTLcluster13Blood pressure QTL cluster 133.654arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)16422760943025077Rat
70183BpQTLcluster13Blood pressure QTL cluster 133.654arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)16422760943025077Rat
70183BpQTLcluster13Blood pressure QTL cluster 133.654arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)16422760943025077Rat
737819Hcas4Hepatocarcinoma susceptibility QTL 44.43liver integrity trait (VT:0010547)volume of individual liver tumorous lesion (CMO:0001078)16422760946975965Rat
61405Niddm6Non-insulin dependent diabetes mellitus QTL 63.660.001blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)16422760948972724Rat
61338Bp23Blood pressure QTL 234.3arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)16422760949227609Rat
737826Alc11Alcohol consumption QTL 113.2consumption behavior trait (VT:0002069)ethanol drink intake rate (CMO:0001407)16422760960252231Rat
61372Bp40Blood pressure QTL 402.2blood pressure trait (VT:0000183)systolic blood pressure (CMO:0000004)16422773017696785Rat
1331756Rf34Renal function QTL 344.16275kidney blood vessel physiology trait (VT:0100012)absolute change in renal blood flow rate (CMO:0001168)5190450412Rat
70212Niddm25Non-insulin dependent diabetes mellitus QTL 253.54blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)51131345958Rat
1331771Rf35Renal function QTL 354.36965kidney blood vessel physiology trait (VT:0100012)absolute change in renal blood flow rate (CMO:0001168)572947086724018Rat
1576314Eutr1Estrogen induced uterine response QTL 1uterus integrity trait (VT:0010575)pyometritis severity score (CMO:0002009)52138965166875058Rat
8662454Vetf3Vascular elastic tissue fragility QTL 327.4artery integrity trait (VT:0010639)number of ruptures of the internal elastic lamina of the abdominal aorta and iliac arteries (CMO:0002562)5228222669540447Rat
7394712Emca13Estrogen-induced mammary cancer QTL 13mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)5982326699753708Rat
634305Mamtr1Mammary tumor resistance QTL 10.0001mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)512789751113558310Rat
1600358Mamtr5Mammary tumor resistance QTL 5mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)51887394763873947Rat
1358353Srcrtb2Stress Responsive Cort Basal QTL 23.480.003blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)51887394774251464Rat
8552954Pigfal14Plasma insulin-like growth factor 1 level QTL 149blood insulin-like growth factor amount (VT:0010479)plasma insulin-like growth factor 1 level (CMO:0001299)52122674466226744Rat
1578767Stresp17Stress response QTL 174.30.01blood aldosterone amount (VT:0005346)plasma aldosterone level (CMO:0000551)52795544072955440Rat
1578776Stresp18Stress response QTL 182.9thymus mass (VT:0004954)thymus wet weight (CMO:0000855)52795544072955440Rat
6903292Stl28Serum triglyceride level QTL 282.60.0073blood triglyceride amount (VT:0002644)plasma triglyceride level (CMO:0000548)52851548973515489Rat
6903306Scl35Serum cholesterol QTL 352.60.0073blood cholesterol amount (VT:0000180)plasma total cholesterol level (CMO:0000585)52851548973515489Rat
2290448Scl54Serum cholesterol level QTL 542.93blood cholesterol amount (VT:0000180)plasma total cholesterol level (CMO:0000585)531663789131345958Rat
1598807Glom12Glomerulus QTL 122.7kidney glomerulus morphology trait (VT:0005325)index of glomerular damage (CMO:0001135)53321566578215665Rat
1298067Scl15Serum cholesterol level QTL 154.80.001blood cholesterol amount (VT:0000180)plasma total cholesterol level (CMO:0000585)53321566578215665Rat
1302786Kidm8Kidney mass QTL 828.15kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)53321566578215665Rat
1576317Eutr2Estrogen induced uterine response QTL 20.01uterus integrity trait (VT:0010575)pyometritis severity score (CMO:0002009)534730116104251008Rat
2316959Gluco59Glucose level QTL 594.7blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)534944474113558310Rat
1641922Alcrsp8Alcohol response QTL 8alcohol metabolism trait (VT:0015089)blood ethanol level (CMO:0000535)53518915368564008Rat
1641912Alcrsp18Alcohol response QTL 18response to alcohol trait (VT:0010489)duration of loss of righting reflex (CMO:0002289)535189153141643988Rat
1549845Scl44Serum cholesterol level QTL 446blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)540128307148607290Rat
1331773Scl26Serum cholesterol level QTL 263.065blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)54372665686724018Rat
1331801Rf33Renal function QTL 334.149kidney blood vessel physiology trait (VT:0100012)absolute change in renal vascular resistance (CMO:0001900)543726656129132602Rat
1578766Tcas11Tongue tumor susceptibility QTL 114.12tongue integrity trait (VT:0010553)number of squamous cell tumors of the tongue with diameter greater than 3 mm (CMO:0001950)546711509161317411Rat
1300115Hrtrt7Heart rate QTL 72.76heart pumping trait (VT:2000009)heart rate (CMO:0000002)54786906290099692Rat
9589025Epfw7Epididymal fat weight QTL 720.660.001epididymal fat pad mass (VT:0010421)epididymal fat pad weight to body weight ratio (CMO:0000658)54946360094463600Rat
7411561Bw134Body weight QTL 134240.001body mass (VT:0001259)body weight gain (CMO:0000420)54946360094463600Rat
1576312Emca8Estrogen-induced mammary cancer QTL 84.1mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)550328551141643988Rat
2303615Vencon7Ventilatory control QTL 70.001respiration trait (VT:0001943)respiration rate (CMO:0000289)55098389595983895Rat
2303574Gluco42Glucose level QTL 422blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)55349671998496719Rat
61359EaexExperimental allergic encephalomyelitis QTL x3nervous system integrity trait (VT:0010566)post-insult time to onset of experimental autoimmune encephalomyelitis (CMO:0001422)555715622100715622Rat
70189Mcs5Mammary carcinoma susceptibility QTL 510.51mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)555805606132207589Rat
1358895Bp254Blood pressure QTL 2543.60.0003arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)558829236128034027Rat
61426Scl2Serum cholesterol level QTL 27.30.001blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)559793399143070159Rat
2316954Rf57Renal function QTL 570kidney glomerulus morphology trait (VT:0005325)index of glomerular damage (CMO:0001135)55979352890450144Rat
2316957Pur21Proteinuria QTL 216.2urine protein amount (VT:0005160)urine protein level (CMO:0000591)559793528113558156Rat
61386Bp49Blood pressure QTL 4916.6cerebrum integrity trait (VT:0010549)brain infarction volume (CMO:0001013)56029343498603051Rat
61393Bp7Blood pressure QTL 74.50.0001arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)560293434161481680Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 306257 UniSTS
  364510 UniSTS
UniSTS 232609 UniSTS