RH142900 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: RH142900

Symbol: RH142900
Previously known as: AI716846; 
RGD ID: 5053873
Expected Size: 218 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.28122,816,755 - 122,816,973 (+)MAPPERmRatBN7.2
Rnor_6.08132,247,780 - 132,247,997NCBIRnor6.0
Rnor_5.08131,401,373 - 131,401,590UniSTSRnor5.0
RGSC_v3.48127,911,203 - 127,911,420UniSTSRGSC3.4
Celera8121,929,756 - 121,929,973UniSTS
RH 3.4 Map81276.29UniSTS


Annotation


References - curated
# Reference Title Reference Citation
1. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer CAACCCACAACCGAGAAGAT
Reverse Primer TGGTAGAAAGGCAATCTGGG
 

Region

Nucleotide Sequences
GenBank Nucleotide CH473954 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM000238 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
1554321Bmd3Bone mineral density QTL 37.90.0001femur mineral mass (VT:0010011)volumetric bone mineral density (CMO:0001553)840952565123900184Rat
738011Anxrr9Anxiety related response QTL 96.1exploratory behavior trait (VT:0010471)number of entries into a discrete space in an experimental apparatus (CMO:0000960)893535351123900184Rat
1358893Bp263Blood pressure QTL 2635.01arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)893965141123900184Rat
1358903Bp252Blood pressure QTL 25270.0001arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)893965141123900184Rat
738014Anxrr15Anxiety related response QTL 153.60.005locomotor behavior trait (VT:0001392)amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)895718998123900184Rat
2300182Bmd56Bone mineral density QTL 565.4femur mineral mass (VT:0010011)volumetric bone mineral density (CMO:0001553)895718998123900184Rat


Additional Information

Database Acc Id Source(s)
UniSTS 232147 UniSTS