RH134196 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: RH134196

Symbol: RH134196
Also known as: AI715979; 
RGD ID: 5050680
Expected Size: 184 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.22218,306,543 - 218,306,727 (-)MAPPER
mRatBN7.22218,306,543 - 218,306,727 (+)MAPPER
Rnor_6.0268,815,953 - 68,816,136NCBIRnor6.0
Rnor_6.02235,181,755 - 235,181,938NCBIRnor6.0
Rnor_5.0288,545,083 - 88,545,266UniSTSRnor5.0
Rnor_5.0274,742,094 - 74,742,277UniSTSRnor5.0
RGSC_v3.42227,199,542 - 227,199,725UniSTSRGSC3.4
Celera2210,592,521 - 210,592,704UniSTS
RH 3.4 Map21556.2UniSTS


Annotation


References - curated
1. RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer GATCACCAATGACAATGAAGGC
Reverse Primer GGGAAACCAGGAAAGGGAATAG
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
69433Leneplens epithelial protein2188727004188727670Rat
68953Fdpsfarnesyl diphosphate synthase2188403595188413219Rat
61814Pex2peroxisomal biogenesis factor 229825175698269185Rat
71044Cnn3calponin 32225005069225036179Rat
3659Sema6csemaphorin 6C2196330777196347218Rat
68436Gucy1a1guanylate cyclase 1 soluble subunit alpha 12181045694181103321Rat
3242P2ry1purinergic receptor P2Y12151314818151320312Rat
3245S100a4S100 calcium-binding protein A42189997278189999587Rat
71081Cldn11claudin 112115823541115836846Rat
71099Adaradenosine deaminase, RNA-specific2189045551189085448Rat
619896Serpini1serpin family I member 12174013058174111693Rat
619897Serpini2serpin family I member 22173640385173670790Rat
2755Gstm1glutathione S-transferase mu 12210803869210809461Rat
2756Gstm2glutathione S-transferase mu 22210778041210782807Rat
70961Hdgfheparin binding growth factor2187274898187284670Rat
2603Fgafibrinogen alpha chain2181997562182013726Rat
2613Fggfibrinogen gamma chain2181987080181994523Rat
2310Cd53Cd53 molecule2209489279209537098Rat
3098Mmemembrane metallo-endopeptidase2153799203153880910Rat
2620Flgfilaggrin2193565401193574297Rat
2194Bcanbrevican2187359674187373133Rat
619890Gpr149G protein-coupled receptor 1492152838836152912027Rat
2804Hmgcs23-hydroxy-3-methylglutaryl-CoA synthase 22200452623200480785Rat
2240Car2carbonic anhydrase 228809774088112868Rat
2241Ca3carbonic anhydrase 328812651988136063Rat
61848Psma5proteasome 20S subunit alpha 52211050344211073706Rat
3195Npr1natriuretic peptide receptor 12189840403189857032Rat
69254Impa1inositol monophosphatase 129367520393696355Rat
619999Sort1sortilin 12211078092211156312Rat
3122Muc1mucin 1, cell surface associated2188543137188547874Rat
61958S1pr1sphingosine-1-phosphate receptor 12218654406218658761Rat
70972Hao2hydroxyacid oxidase 22200785492200808868Rat
69309Fabp4fatty acid binding protein 429379266693797267Rat
3331Pitx2paired-like homeodomain 22233602732233621059Rat
3336Pklrpyruvate kinase L/R2188449158188458034Rat
3910Tshbthyroid stimulating hormone subunit beta2205207799205215199Rat
61964Gstm5glutathione S-transferase, mu 52210685338210688133Rat
70912P2ry14purinergic receptor P2Y142149331948149379336Rat
70997Fabp5fatty acid binding protein 529398166293985322Rat
69346Wnt2bWnt family member 2B2207433771207457094Rat
2110Ampd2adenosine monophosphate deaminase 22210861624210874348Rat
2113Amy1aamylase, alpha 1A2216428709216443518Rat
2120Anxa5annexin A52123162477123194730Rat
2942Jtbjumping translocation breakpoint2189591707189595926Rat
2206Bglapbone gamma-carboxyglutamate protein2187741770187748445Rat
3349Pld1phospholipase D12113651967113849403Rat
2109Ampd1adenosine monophosphate deaminase 12205568934205589961Rat
619741Cdh10cadherin 1026941517469636849Rat
3069Smcpsperm mitochondria-associated cysteine-rich protein2192775425192780631Rat
61862Gria2glutamate ionotropic receptor AMPA type subunit 22179584302179704629Rat
3938Ugt8UDP glycosyltransferase 82229644373229718678Rat
620041Atp5pbATP synthase peripheral stalk-membrane subunit b2208566385208577147Rat
620047Il2interleukin 22123847150123851854Rat
69295Asic5acid sensing ion channel subunit family member 52180935392180964365Rat
2007Abcd3ATP binding cassette subfamily D member 32225335708225389120Rat
62007Ensaendosulfine alpha2197752544197759882Rat
62012Syt6synaptotagmin 62206064181206119034Rat
2706Glrbglycine receptor, beta2179768040179842612Rat
2950Kcna2potassium voltage-gated channel subfamily A member 22209838607209852471Rat
2951Kcna3potassium voltage-gated channel subfamily A member 32209766767209768344Rat
2297Cd2Cd2 molecule2203666706203680073Rat
2391Cpb1carboxypeptidase B12105059293105089682Rat
67377Hsd3b2hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 22200712895200722429Rat
67399Insrrinsulin receptor-related receptor2187161817187181400Rat
3952Vcam1vascular cell adhesion molecule 12219071193219090931Rat
68391Pde7aphosphodiesterase 7A2104042124104134101Rat
68394Kcnd3potassium voltage-gated channel subfamily D member 32207923775208140727Rat
2167Atp1a1ATPase Na+/K+ transporting subunit alpha 12204003742204032023Rat
68410Pdgfcplatelet derived growth factor C2179952227180126897Rat
2714Gnai3G protein subunit alpha i32210896779210934733Rat
3674Shox2short stature homeobox 22164118175164126783Rat
3675Sisucrase-isomaltase2170220794170301348Rat
61987Phgdhphosphoglycerate dehydrogenase2200484245200513564Rat
628779Clrn1clarin 12149049925149088787Rat
628788Zfp455zinc finger protein 45528699677587011696Rat
621021PkiacAMP-dependent protein kinase inhibitor alpha29659318596668222Rat
620283Foxo1forkhead box O12141451234141527016Rat
628813Sars1seryl-tRNA synthetase 12211219743211235475Rat
3188Notch2notch receptor 22200187184200320403Rat
1303079Amigo1adhesion molecule with Ig like domain 12210977125210982582Rat
621228Enpepglutamyl aminopeptidase2233667253233743866Rat
631398Kcnmb2potassium calcium-activated channel subfamily M regulatory beta subunit 22118276298118585321Rat
620475Npy2rneuropeptide Y receptor Y22181528949181538145Rat
2350Chrnb2cholinergic receptor nicotinic beta 2 subunit2189088570189096785Rat
631440Aadacarylacetamide deacetylase2150146234150157480Rat
68362Lratlecithin retinol acyltransferase2181896304181905366Rat
620961Prkciprotein kinase C, iota2115941998116002550Rat
628890Gja8gap junction protein, alpha 82199050854199052470Rat
628668Mbnl1muscleblind-like splicing regulator 12150698248150867791Rat
628672Olfm3olfactomedin 32217779983218005710Rat
620691Hcn3hyperpolarization-activated cyclic nucleotide-gated potassium channel 32188458851188471916Rat
628722Lrrcc1leucine rich repeat and coiled-coil centrosomal protein 128838479688414012Rat
2390Cpa3carboxypeptidase A32105016798105047989Rat
621854Hapln2hyaluronan and proteoglycan link protein 22187395104187402076Rat
2902Il6rinterleukin 6 receptor2189196180189255987Rat
2904Il7interleukin 729642788496474979Rat
621356Nudt6nudix hydrolase 62124134301124149824Rat
621357E2f5E2F transcription factor 528835076488366913Rat
621489Mef2dmyocyte enhancer factor 2D2187511775187541285Rat
2692Gja5gap junction protein, alpha 52199162745199184942Rat
2387Cpceruloplasmin2104744249104803034Rat
620905Prkab2protein kinase AMP-activated non-catalytic subunit beta 22199831990199847623Rat
621287Gstm7glutathione S-transferase, mu 72210720719210726179Rat
620790Serp1stress-associated endoplasmic reticulum protein 12148718279148722263Rat
70924Pdzk1PDZ domain containing 12198965685198999323Rat
619715Sv2asynaptic vesicle glycoprotein 2a2198321100198336889Rat
619871Gclmglutamate cysteine ligase, modifier subunit2225827504225847876Rat
620388Efna1ephrin A12188588808188596156Rat
620390Efna3ephrin A32188636304188645302Rat
708413Pias3protein inhibitor of activated STAT, 32198821377198831533Rat
621397Ghsrgrowth hormone secretagogue receptor2113065953113071265Rat
621399SkilSKI-like proto-oncogene2115862932115891304Rat
708515Vom2r44vomeronasal 2 receptor 442154601995154636154Rat
621630Ssr3signal sequence receptor subunit 32156010997156023853Rat
621403Hey1hes-related family bHLH transcription factor with YRPW motif 129532014795322701Rat
628705Snx27sorting nexin 272195738613195821608Rat
631357S100vpS100 calcium-binding protein, ventral prostate2190628525190631821Rat
619705Arhgef11Rho guanine nucleotide exchange factor 112186979850187102523Rat
68361Lxnlatexin2164628565164634434Rat
621214Pi4kbphosphatidylinositol 4-kinase beta2196139724196172055Rat
68351Scamp3secretory carrier membrane protein 32188488907188495147Rat
727973Acad9acyl-CoA dehydrogenase family, member 92122782051122806166Rat
69237Celsr2cadherin, EGF LAG seven-pass G-type receptor 22211183410211207458Rat
620916Pik3caphosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha2118831350118861456Rat
620456Lmnalamin A/C2187842884187863552Rat
620472Rwdd3RWD domain containing 32224710351224723136Rat
708486Cymchymosin2209962848209973205Rat
620156Ank2ankyrin 22231224643231522655Rat
621109Psmd4proteasome 26S subunit ubiquitin receptor, non-ATPase 42196198303196207569Rat
620134Zmat3zinc finger, matrin type 32118715229118746109Rat
620571Selenbp1selenium binding protein 12196105592196146474Rat
620982Tspan2tetraspanin 22205160405205202766Rat
621784Tm4sf4transmembrane 4 L six family member 42147532032147547254Rat
621362Magi3membrane associated guanylate kinase, WW and PDZ domain containing 32206499467206699105Rat
2609Fgf2fibroblast growth factor 22124081072124134133Rat
735030Igsf10immunoglobulin superfamily, member 102149535199149564180Rat
621546Tpm3tropomyosin 32189423534189451340Rat
708407Pex5lperoxisomal biogenesis factor 5-like2119330330119405809Rat
620141Ivlinvolucrin2192761171192773346Rat
62078Rps3aribosomal protein S3a2185440477185444846Rat
3162Nesnestin2187343109187352972Rat
620144Ntrk1neurotrophic receptor tyrosine kinase 12187143568187160373Rat
621117Nlgn1neuroligin 12111057291111973681Rat
628880Dcm5Dcm5 protein2233909142233909909Rat
620505Crhcorticotropin releasing hormone2104459999104461863Rat
621681P2ry12purinergic receptor P2Y122149440807149482592Rat
727960Hax1HCLS1 associated protein X-12189330900189333305Rat
621059Ccna2cyclin A22123274727123282266Rat
621063Csf1colony stimulating factor 12210522370210550546Rat
68370Tdo2tryptophan 2,3-dioxygenase2180897059180914919Rat
727806Plppr4phospholipid phosphatase related 42220298239220341863Rat
708359Clcc1chloride channel CLIC-like 12211450426211479885Rat
2769Gucy1b1guanylate cyclase 1 soluble subunit beta 12180976939181026001Rat
620653Slc33a1solute carrier family 33 member 12154520170154542981Rat
2483Cyp7b1cytochrome P450 family 7 subfamily B member 12102701903102871257Rat
1304667Kcna10potassium voltage-gated channel subfamily A member 102209920590209932665Rat
620562Il12ainterleukin 12A2165076945165083996Rat
620264S100a6S100 calcium binding protein A62190007013190008512Rat
620426Phtf1putative homeodomain transcription factor 12206452115206518387Rat
68947Stmn2stathmin 229542425195471900Rat
1303193Sucnr1succinate receptor 12150211897150212848Rat
1303076Sh2d2aSH2 domain containing 2A2187218851187225000Rat
2296Cd1d1CD1d1 molecule2186330298186333805Rat
620295Snx16sorting nexin 1629351879693541056Rat
620898Prok1prokineticin 12209986503209994438Rat
621218Dpyddihydropyrimidine dehydrogenase2221823692222694627Rat
620525Mcl1MCL1 apoptosis regulator, BCL2 family member2197786212197788992Rat
620734Ctnnd2catenin delta 228322724784094315Rat
1304917Arsearylsulfatase E2122876645122884673Rat
1304919S100a13S100 calcium binding protein A132189906022189912516Rat
1304936Mtfr1mitochondrial fission regulator 12104005696104040914Rat
69238Prss12serine protease 122227657983227717884Rat
620995Pde5aphosphodiesterase 5A2226899604227044916Rat
620402Adam15ADAM metallopeptidase domain 152188661831188672337Rat
2276Casq2calsequestrin 22204512361204568643Rat
61827Kcnab1potassium voltage-gated channel subfamily A regulatory beta subunit 12155555798156011438Rat
1307047Atxn7l2ataxin 7-like 22210992904211001287Rat
1305808Slc44a3solute carrier family 44, member 32225038261225112859Rat
621513Ctsscathepsin S2197655780197679768Rat
1304837Gpr89bG protein-coupled receptor 89B2198999945199038702Rat
61921Gpr88G-protein coupled receptor 882219258346219263819Rat
1307339Trim33tripartite motif-containing 332205783252205863426Rat
620267S100a9S100 calcium binding protein A92190097436190100209Rat
735161Cct5chaperonin containing TCP1 subunit 528466757884678730Rat
735163Sfrp2secreted frizzled-related protein 22182723732182731277Rat
628734Tnfsf10TNF superfamily member 102113008008113026899Rat
620446Shc1SHC adaptor protein 12188745503188757066Rat
620778Siah2siah E3 ubiquitin protein ligase 22148874151148891900Rat
621267Vps45vacuolar protein sorting 45 homolog2198123747198184739Rat
620585Elovl6ELOVL fatty acid elongase 62234187490234296124Rat
620591Rap2bRAP2B, member of RAS oncogene family2151685251151685802Rat
727802Terctelomerase RNA component2116432723116433110Rat
735075Gask1bgolgi associated kinase 1B2178678946178751459Rat
1303058Chiachitinase, acidic2208750348208797388Rat
61973Trpc3transient receptor potential cation channel, subfamily C, member 32123329954123467574Rat
1304822Mettl14methyltransferase like 142227566811227583047Rat
620733Tas2r119taste receptor, type 2, member 11928530522585306232Rat
620880Rab13RAB13, member RAS oncogene family2189581209189586358Rat
735052Etfdhelectron transfer flavoprotein dehydrogenase2178367547178389641Rat
619726Csde1cold shock domain containing E12205525194205552987Rat
735138Tlr2toll-like receptor 22182840171182846061Rat
620886Txnipthioredoxin interacting protein2198683168198686971Rat
1304953TsaccTSSK6 activating co-chaperone2187659103187668781Rat
620285Fabp9fatty acid binding protein 929380350393807069Rat
3794Sycp1synaptonemal complex protein 12205274766205426869Rat
1303130Glmpglycosylated lysosomal membrane protein2187697528187701118Rat
2542Egfepidermal growth factor26882061668895537Rat
2587F3coagulation factor III, tissue factor2225310686225322281Rat
2604Fgbfibrinogen beta chain2182028044182035026Rat
1304593Ints3integrator complex subunit 32189766927189818327Rat
620357Ecm1extracellular matrix protein 12197855468197860973Rat
621826Pfn2profilin 22147953858147959692Rat
1304723Them4thioesterase superfamily member 42195554092195576710Rat
1304613Alpk1alpha-kinase 12231997360232117471Rat
621785Gyg1glycogenin 12104916734104958219Rat
620394Pag1phosphoprotein membrane anchor with glycosphingolipid microdomains 129426610494277680Rat
1306812Vom2r45vomeronasal 2 receptor, 452154670917154699533Rat
1303295S100a11S100 calcium binding protein A112193863185193868646Rat
708401Arfip1ADP-ribosylation factor interacting protein 12183503250183582798Rat
621276Trpc4transient receptor potential cation channel, subfamily C, member 42143433102143605757Rat
708410Pde4dipphosphodiesterase 4D interacting protein2199867965200066034Rat
728380Qrfprpyroglutamylated RFamide peptide receptor2122891321122949241Rat
3705Slc2a2solute carrier family 2 member 22114413427114445418Rat
628655S100a10S100 calcium binding protein A102193892589193901236Rat
61877Psmb4proteasome 20S subunit beta 42196043546196046320Rat
621460Mfn1mitofusin 12118929738118971689Rat
620864Ccnl1cyclin L12157747295157759838Rat
621744Ddx20DEAD-box helicase 202208144142208154764Rat
61810Ctskcathepsin K2196655469196666447Rat
620381Gstm3lglutathione S-transferase mu 3-like2210761729210766501Rat
1304636Sema4asemaphorin 4A2187799568187823014Rat
1304649Cdc14acell division cycle 14A2219302577219458345Rat
1304941Hipk1homeodomain interacting protein kinase 12206224015206274910Rat
2964Kcnn3potassium calcium-activated channel subfamily N member 32188837280188991794Rat
2591Fabp2fatty acid binding protein 22227080912227083654Rat
628602Fmo5flavin containing dimethylaniline monoxygenase 52199796870199823927Rat
1304659Arhgef2Rho/Rac guanine nucleotide exchange factor 22187964100188022847Rat
621045Rps27ribosomal protein S272189572175189573280Rat
621047Plrg1pleiotropic regulator 12182040338182056669Rat
735122Vom2r46vomeronasal 2 receptor, 462154729854154763094Rat
1305005Lamtor5late endosomal/lysosomal adaptor, MAPK and MTOR activator 52210034095210039451Rat
1305734Ilf2interleukin enhancer binding factor 22189857587189877777Rat
631396Gfm1G elongation factor, mitochondrial 12164601575164646478Rat
620260S100a3S100 calcium binding protein A32189955619189996029Rat
620265S100a8S100 calcium binding protein A82190073239190074333Rat
1307509Larp1bLa ribonucleoprotein 1B2127845034127876793Rat
1307808Efna4ephrin A42188655920188660179Rat
1307812Supt20hSPT20 homolog, SAGA complex component2143892609143925733Rat
1307231Rsbn1round spermatid basic protein 12206392200206451671Rat
68437Dclk1doublecortin-like kinase 12144646255144939389Rat
2372Col11a1collagen type XI alpha 1 chain2216863423217056523Rat
1305527Ankrd35ankyrin repeat domain 352198797136198817144Rat
619968Stxbp3syntaxin binding protein 32211595763211638756Rat
62042Syt11synaptotagmin 112188112301188138180Rat
1305152Itga10integrin subunit alpha 102198772937198792253Rat
1305844RalylRALY RNA binding protein-like28903999089842784Rat
1304890Ufm1ubiquitin-fold modifier 12143096268143104412Rat
1304699NaxeNAD(P)HX epimerase2187424319187426410Rat
1304701Prmt6protein arginine methyltransferase 62213173403213180721Rat
1305120Dennd2dDENN domain containing 2D2209097894209116978Rat
2263Camk2dcalcium/calmodulin-dependent protein kinase II delta2230900907231132207Rat
1304797B3galnt1beta-1,3-N-acetylgalactosaminyltransferase 1 (globoside blood group)2166226736166255978Rat
1306127Pip5k1aphosphatidylinositol-4-phosphate 5-kinase, type 1, alpha2196227669196270949Rat
1306920Jade1jade family PHD finger 12128461147128514298Rat
1309181Wdr47WD repeat domain 472211380894211441817Rat
71004Smad9SMAD family member 92143951725144002025Rat
3690Slc16a1solute carrier family 16 member 12207108552207129352Rat
1305624Palmdpalmdelphin2220481292220536004Rat
708377Zbtb10zinc finger and BTB domain containing 1029469293994730976Rat
1306376Aglamylo-alpha-1, 6-glucosidase, 4-alpha-glucanotransferase2219788234219843189Rat
1305813Fbxl7F-box and leucine-rich repeat protein 727906790779439987Rat
1306615Usp53ubiquitin specific peptidase 532227098795227160385Rat
1306036Slc10a5solute carrier family 10, member 529366996293671266Rat
1306044Usp13ubiquitin specific peptidase 132119197153119317507Rat
1306050Gdap2ganglioside-induced differentiation-associated-protein 22202470485202526849Rat
1306255Sass6SAS-6 centriolar assembly protein2219626851219660975Rat
68403Dbtdihydrolipoamide branched chain transacylase E22219563783219592651Rat
1307448Hist2h4histone cluster 2, H42198411955198412350Rat
1306336Acp6acid phosphatase 6, lysophosphatidic2199284177199305793Rat
1306434Rapgef2Rap guanine nucleotide exchange factor 22177836191178057378Rat
620641Dapdeath-associated protein28427588484328998Rat
621491Basp1brain abundant, membrane attached signal protein 127758642477632626Rat
3272Pcsk1proprotein convertase subtilisin/kexin type 129145016291497091Rat
1306121Vps72vacuolar protein sorting 72 homolog2196277961196289549Rat
1306398Tram1l1translocation associated membrane protein 1-like 12228544418228546599Rat
1306277Ccdc39coiled-coil domain containing 392120278605120367829Rat
1305653Pear1platelet endothelial aggregation receptor 12187114219187134209Rat
1307747Actl6aactin-like 6A2119112776119128870Rat
1307165Hist2h2aa3histone cluster 2 H2A family member A32198388766198389293Rat
1307956Tdpoz1TD and POZ domain containing 12194618508194619601Rat
1307595RGD1307595similar to RIKEN cDNA 1700018B242138194136138197442Rat
1307244Slc25a44solute carrier family 25, member 442187772013187786829Rat
1305751Mfsd1major facilitator superfamily domain containing 12164747655164767682Rat
1306350Ash1lASH1 like histone lysine methyltransferase2188252592188389251Rat
1305993Trim46tripartite motif-containing 462188548608188561617Rat
1306704RGD1306704hypothetical LOC2954832147010399147016261Rat
1306445Hist2h3c2histone cluster 2 H3 family member C22198390024198418075Rat
1305180Pbxip1PBX homeobox interacting protein 12188763887188776445Rat
1307684Extl2exostosin-like glycosyltransferase 22218951112218972576Rat
1309980Pogzpogo transposable element derived with ZNF domain2195995322196041500Rat
1307864Gatbglutamyl-tRNA amidotransferase subunit B2184600695184679980Rat
2051Adora3adenosine A3 receptor2208336909208379217Rat
2153Arntaryl hydrocarbon receptor nuclear translocator2196594178196651486Rat
1306526Inka2inka box actin regulator 22208170652208187088Rat
1306528Hspa4lheat shock protein family A (Hsp70) member 4 like2127625737127682864Rat
1306531Ndst4N-deacetylase and N-sulfotransferase 42229170781229496732Rat
1307384Il21interleukin 212123965021123972356Rat
1307640Arsjarylsulfatase family, member J2230163014230662084Rat
1310611Anp32eacidic nuclear phosphoprotein 32 family member E2198040573198057005Rat
1310615Mccc1methylcrotonyl-CoA carboxylase subunit 12122550777122690540Rat
1308520Pglyrp4peptidoglycan recognition protein 42190125655190204230Rat
1308524Ect2epithelial cell transforming 22112769385112831476Rat
1308526Cd5lCd5 molecule-like2186685104186696117Rat
3614S100a1S100 calcium binding protein A12189900505189905348Rat
727813RhbgRh family B glycoprotein2187610081187622408Rat
727883Kirrel1kirre like nephrin family adhesion molecule 12186420743186515209Rat
1308767Dhx36DEAH-box helicase 362152785844152824549Rat
1305900Spartspartin2144522382144548968Rat
1307193Myo10myosin X27786839878072443Rat
1305386Fnbp1lformin binding protein 1-like2226691435226742081Rat
1305390Plk4polo-like kinase 42127686911127705518Rat
1309509Rarres1retinoic acid receptor responder 12164650722164684982Rat
1309514Gnat2G protein subunit alpha transducin 22210880754210890765Rat
1309517Rpl22l1ribosomal protein L22 like 12115362799115364735Rat
1309519Zfand1zinc finger AN1-type containing 129365689593666745Rat
1305339Dap3death associated protein 32188225607188255324Rat
1304965Rhocras homolog family member C2207271692207278010Rat
1304968Rsrc1arginine and serine rich coiled-coil 12164126898164533652Rat
1306767Tpd52tumor protein D5229495973295041277Rat
1306770S100a16S100 calcium binding protein A162189923140189928850Rat
1305834Zgrf1zinc finger, GRF-type containing 12231881893231944760Rat
1305870Pcdh18protocadherin 182138819957138833932Rat
735038Cct3chaperonin containing TCP1 subunit 32187669051187693610Rat
1303283Cog6component of oligomeric golgi complex 62142197566142235054Rat
1305525Mllt11MLLT11, transcription factor 7 cofactor2196392936196402106Rat
1306107Fam189bfamily with sequence similarity 189, member B2188495237188501444Rat
1306110Msto1misato mitochondrial distribution and morphology regulator 12188212211188216482Rat
1307756Dcst1DC-STAMP domain containing 12188672549188690004Rat
1307796Igsf3immunoglobulin superfamily, member 32203768364203855573Rat
1307225Egfem1EGF-like and EMI domain containing 12116524965117153933Rat
1305909Ndufb5NADH:ubiquinone oxidoreductase subunit B52119139717119153753Rat
3205NrasNRAS proto-oncogene, GTPase2205553119205563716Rat
3437Ptgfrnprostaglandin F2 receptor inhibitor2203423143203494391Rat
1311086Gpatch4G patch domain containing 42187404731187424047Rat
1311090Stoml3stomatin like 32142717281142727026Rat
1311104Nceh1neutral cholesterol ester hydrolase 12112868834112932622Rat
1311106Olfml3olfactomedin-like 32206219419206222248Rat
1560498Eif3i-ps1eukaryotic translation initiation factor 3, subunit I, pseudogene 12145936797145937828Rat
1308632Zbbxzinc finger, B-box domain containing2173453609173565422Rat
1309275Slc7a11solute carrier family 7 member 112139453774139528479Rat
1310176Gpr61G protein-coupled receptor 612210937289210943727Rat
1310511Mybphlmyosin binding protein H-like2211158902211173036Rat
1308862Sec62SEC62 homolog, preprotein translocation factor2116188736116225510Rat
1309907Sypl2synaptophysin-like 22211003046211017778Rat
1309912Fcgr1aFc fragment of IgG receptor Ia2198430536198439453Rat
1308412Ankrd34aankyrin repeat domain 34A2198720277198725155Rat
1311992Cgncingulin2195909691195937130Rat
1309139RGD1309139similar to CG5435-PA2211320420211332327Rat
1308413Krtcap2keratinocyte associated protein 22188561548188565544Rat
1308940Tmod4tropomodulin 42196294990196299896Rat
1305220Ppm1lprotein phosphatase, Mg2+/Mn2+ dependent, 1L2165932240166218774Rat
1310209Elapor1endosome-lysosome associated apoptosis and autophagy regulator 12211243398211323283Rat
1310981Trim2tripartite motif-containing 22183145096183223819Rat
1310984Naa15N(alpha)-acetyltransferase 15, NatA auxiliary subunit2140471437140534259Rat
1310506Slitrk3SLIT and NTRK-like family, member 32170446582170461513Rat
1308903Crtc2CREB regulated transcription coactivator 22189615928189625646Rat
1309554Lrig2leucine-rich repeats and immunoglobulin-like domains 22206928708206997915Rat
1308305Tchhl1trichohyalin-like 12193807250193809696Rat
1559813Vom2r47vomeronasal 2 receptor, 472155351173155387002Rat
1309145Ttf2transcription termination factor 22203317673203350752Rat
1309146Zfp622zinc finger protein 62227840731278421152Rat
1308384Dclk2doublecortin-like kinase 22186116624186245937Rat
1311720Sec24dSEC24 homolog D, COPII coat complex component2227455704227562801Rat
1359407Chtopchromatin target of PRMT12189887850189900079Rat
1359413Isg20l2interferon stimulated exonuclease gene 20-like 22187302192187311677Rat
1309780Car1carbonic anhydrase 128818520488227486Rat
1311665Ankrd50ankyrin repeat domain 502125289071125323527Rat
1303244Kprpkeratinocyte proline-rich protein2193132222193136520Rat
1559887RGD1559887similar to Transducin-like enhancer protein 4 (Groucho-related protein 4) (Grg-4)27705771977112614Rat
1310822Cttnbp2nlCTTNBP2 N-terminal like2207495056207541808Rat
1311545Polr3cRNA polymerase III subunit C2198836282198852368Rat
1311546Aph1aaph-1 homolog A, gamma secretase subunit2198006247198009837Rat
1308353Rab33bRAB33B, member RAS oncogene family2140541619140552220Rat
1308360Triotrio Rho guanine nucleotide exchange factor28047139880769313Rat
1559714RGD1559714similar to TDPOZ32195277647195279177Rat
1306883Frrs1ferric-chelate reductase 12220415568220469559Rat
1306885Fcrl2Fc receptor-like 22186594442186605115Rat
1334052Olr1780-psolfactory receptor pseudogene 17802162694077162694715Rat
1359151TifaTRAF-interacting protein with forkhead-associated domain2232104394232137425Rat
1332614Olr1783-psolfactory receptor pseudogene 17832161035776161036126Rat
1310829Cyb561d1cytochrome b561 family, member D12210988869210992406Rat
1310997MecomMDS1 and EVI1 complex locus2117396084117993604Rat
1303174Ppidpeptidylprolyl isomerase D2178354830178366843Rat
1311970Zc2hc1azinc finger, C2HC-type containing 1A29648293896520202Rat
1310343Dclre1bDNA cross-link repair 1B2206285085206293599Rat
1311778Crnncornulin2193427097193432070Rat
1308370Setdb1SET domain bifurcated histone lysine methyltransferase 12196495867196527412Rat
1310812Pmvkphosphomevalonate kinase2188784329188793890Rat
1311577Etv3ETS variant transcription factor 32186872483186887294Rat
1560661RGD1560661similar to TDPOZ32194751392194753165Rat
1311428LrbaLPS responsive beige-like anchor protein2185590983186110491Rat
1311435Ap1aradaptor-related protein complex 1 associated regulatory protein2232146418232178813Rat
1309031Hltfhelicase-like transcription factor2104854571104914338Rat
1309037Prccproline rich mitotic checkpoint control factor2187232458187258140Rat
1308365Ssr2signal sequence receptor subunit 22187951316187960067Rat
1311483Kpna4karyopherin subunit alpha 42165684345165739874Rat
1311487Plekho1pleckstrin homology domain containing O12198112104198120202Rat
1560393Armc1armadillo repeat containing 12103926567103979607Rat
1302973Rxfp1relaxin family peptide receptor 12178402411178520213Rat
1310478Spata5spermatogenesis associated 52124149872124341138Rat
1310479Wdr77WD repeat domain 772208577292208587263Rat
1309007Mnd1meiotic nuclear divisions 12183073029183140768Rat
1310195Hjvhemojuvelin BMP co-receptor2198655437198659318Rat
1309886Tmem79transmembrane protein 792187701522187706452Rat
1308650Sema5asemaphorin 5A28537731885808970Rat
1308094Tbx15T-box transcription factor 152201289042201390752Rat
1311453Cd101CD101 molecule2203376593203413894Rat
1310250Nup210lnucleoporin 210-like2189453932189571918Rat
1560683RGD1560683similar to 40S ribosomal protein S212133607298133607513Rat
1560703RGD1560703similar to coated vesicle membrane protein2153905150153905617Rat
1308996S100a5S100 calcium binding protein A52189999669190005877Rat
1309635Tchhtrichohyalin2193778022193784793Rat
1309264Bbs7Bardet-Biedl syndrome 72123283402123322991Rat
1310639Ccna1cyclin A12144456689144503570Rat
1306169Exosc8exosome component 82143925643143932240Rat
1306171TiparpTCDD-inducible poly(ADP-ribose) polymerase2157316293157342979Rat
1308900Alg5ALG5, dolichyl-phosphate beta-glucosyltransferase2143932242143946472Rat
1310529Ap4b1adaptor related protein complex 4 subunit beta 12206293679206305705Rat
1306519RGD1306519similar to T-cell activation Rho GTPase-activating protein isoform b2228641911228671090Rat
1306520Lrif1ligand dependent nuclear receptor interacting factor 12209358668209448123Rat
1306858Fstl5follistatin-like 52174542667175234835Rat
1305234Ythdf3YTH N(6)-methyladenosine RNA binding protein 32100677388100711365Rat
1308177Maml3mastermind-like transcriptional coactivator 32140734138141276886Rat
1305451Bhlhe22basic helix-loop-helix family, member e222102685513102688624Rat
1309962Schip1schwannomin interacting protein 12172312290173087236Rat
1308468Nmd3NMD3 ribosome export adaptor2166402838166428331Rat
1308478Slc50a1solute carrier family 50 member 12188585118188587498Rat
1305241Slc39a1solute carrier family 39 member 12189609766189615367Rat
1310063Gmpsguanine monophosphate synthase2154555967154590662Rat
1309478BniplBCL2 interacting protein like2196415736196425727Rat
1307873Slc30a7solute carrier family 30 member 72218888431218951030Rat
1307888Exosc9exosome component 92123264679123275623Rat
1307889Mynnmyoneurin2116397154116414702Rat
1306485Bcas2BCAS2, pre-mRNA processing factor2205662633205670514Rat
1308217Veph1ventricular zone expressed PH domain-containing 12157869383158156266Rat
1309403Proser1proline and serine rich 12142686724142706359Rat
1308711Zfp697zinc finger protein 6972200546954200579926Rat
1308294Nhlh2nescient helix loop helix 22204427577204432946Rat
1311316Sike1suppressor of IKBKE 12205488182205496013Rat
1311318RGD1311318similar to Arylacetamide deacetylase (AADAC)2149969697150022733Rat
1306230Henmt1HEN methyltransferase 12211740571211753718Rat
1309293Spry1sprouty RTK signaling antagonist 12124400689124405331Rat
1307998Phc3polyhomeotic homolog 32116028735116103227Rat
1309208Slc7a12solute carrier family 7 (cationic amino acid transporter, y+ system), member 1228855967788660449Rat
1308694Mab21l3mab-21 like 32204231936204269235Rat
1310605Slc27a3solute carrier family 27 member 32189760747189765415Rat
1306952Cmblcarboxymethylenebutenolidase homolog28464508484666836Rat
1305963Zbtb7bzinc finger and BTB domain containing 7B2188704989188719674Rat
1310960Ndst3N-deacetylase and N-sulfotransferase 32227736491227903657Rat
1310948Golim4golgi integral membrane protein 42174321303174413847Rat
1310099Rbm8aRNA binding motif protein 8A2198755261198758028Rat
1310102Hnf4ghepatocyte nuclear factor 4, gamma2100225880100372710Rat
1308197Dennd2cDENN domain containing 2C2205592348205660619Rat
1307992Ptpn22protein tyrosine phosphatase, non-receptor type 222206342066206390348Rat
1308533Gatad2bGATA zinc finger domain containing 2B2189654871189735056Rat
1308535Pygo2pygopus family PHD finger 22188757167188762285Rat
1305305Ube2q1ubiquitin conjugating enzyme E2 Q12189106039189115110Rat
1305315Rnf115ring finger protein 1152198852392198920000Rat
1306680Smc4structural maintenance of chromosomes 42165600934165629415Rat
1309110RGD1309110similar to Hypothetical protein MGC589992208982251209004270Rat
1332861Olr1847-psolfactory receptor pseudogene 18472161914544161915382Rat
1308931Samd7sterile alpha motif domain containing 72116239812116269769Rat
1306934Bcl9BCL9, transcription coactivator2199334644199420083Rat
1308707Ubap2lubiquitin associated protein 2-like2189334341189400334Rat
1304885Sh3d19SH3 domain containing 192185268028185431834Rat
1305430Cdh18cadherin 1827365140874693342Rat
1309061Neurog2neurogenin 22231962517231963441Rat
1307100RGD1307100similar to RIKEN cDNA D630029K192123555742123766675Rat
1307852Gpr87G protein-coupled receptor 872149398949149418041Rat
1309358Sec24bSEC24 homolog B, COPII coat complex component2230286886230356887Rat
1305326Mcubmitochondrial calcium uniporter dominant negative subunit beta2230198346230274033Rat
1306185Arhgap29Rho GTPase activating protein 292225552075225613349Rat
1305951Iqgap3IQ motif containing GTPase activating protein 32187447477187489630Rat
1305780Tigd4tigger transposable element derived 42183597570183601776Rat
1308283Tars2threonyl-tRNA synthetase 2, mitochondrial2197861071197881347Rat
1306943Trim55tripartite motif-containing 552104416972104459117Rat
1307660Hrnrhornerin2193626283193639848Rat
1307669Myoz2myozenin 22227180887227207629Rat
1307531Mrpl47mitochondrial ribosomal protein L472119128311119139451Rat
1309567Plppr5phospholipid phosphatase related 52219895141220102333Rat
1308447Rab25RAB25, member RAS oncogene family2187903301187909398Rat
1305480Snx7sorting nexin 72221015302221099810Rat
1309445Abca4ATP binding cassette subfamily A member 42225645539225783288Rat
1309446Intuinturned planar cell polarity protein2127459089127521327Rat
1309453Lrrc71leucine rich repeat containing 712187101353187114005Rat
1310132Mfsd8major facilitator superfamily domain containing 82127706618127784129Rat
1310548Hps3HPS3, biogenesis of lysosomal organelles complex 2 subunit 12104789423104832964Rat
1311731Gstm6lglutathione S-transferase, mu 6-like2210698155210703265Rat
1309988Sec22bSEC22 homolog B, vesicle trafficking protein2200076079200096861Rat
1308273Ubqln4ubiquilin 42187915701187931035Rat
1308968Scnm1sodium channel modifier 12196300239196304419Rat
1308615Slc35a3solute carrier family 35 member A32219705618219741886Rat
1309168Trim45tripartite motif-containing 452203301838203310532Rat
1309652Tm4sf1transmembrane 4 L six family member 12147382866147392062Rat
1309189Fndc7fibronectin type III domain containing 72211655482211690802Rat
1308804Pgrmc2progesterone receptor membrane component 22127986106128002005Rat
1305285Postnperiostin2143656820143688087Rat
1303105Deardual endothelin 1, angiotensin II receptor2184243976184247228Rat
1310353Pex11bperoxisomal biogenesis factor 11 beta2198762138198771040Rat
1310585Elf2E74 like ETS transcription factor 22140310374140399312Rat
1310586Bola1bolA family member 12198338114198339130Rat
1309667Sf3b4splicing factor 3b, subunit 42198312428198317180Rat
1309668Dcun1d1defective in cullin neddylation 1 domain containing 12122476173122527153Rat
1309589Sprr3small proline-rich protein 32192641472192643942Rat
1308790Chi3l3chitinase 3-like 32208899871208936858Rat
1306196Eif5a2eukaryotic translation initiation factor 5A22115336646115354203Rat
1310555Prpf3pre-mRNA processing factor 32197947010197971464Rat
1310037Fam102bfamily with sequence similarity 102, member B2211762479211831837Rat
1310045Ttc14tetratricopeptide repeat domain 142120266883120277505Rat
1310059Cers2ceramide synthase 22196487656196495930Rat
1311733Fxr1FMR1 autosomal homolog 12120529716120570356Rat
1309767Man1a2mannosidase, alpha, class 1A, member 22202891537203043847Rat
1309768Ahcyl1adenosylhomocysteinase-like 12210438884210474350Rat
1307480Wdr3WD repeat domain 32202447749202470398Rat
1305398Taf13TATA-box binding protein associated factor 132211359623211370285Rat
1307867Dph5diphthamide biosynthesis 52218834034218866763Rat
1310373Tuft1tuftelin 12195861772195907471Rat
1306854Mlf1myeloid leukemia factor 12164549423164582645Rat
1562486Dnajc5bDnaJ heat shock protein family (Hsp40) member C5 beta2104290726104382846Rat
1562940Prpf38bpre-mRNA processing factor 38B2211706245211715271Rat
1562025Lingo4leucine rich repeat and Ig domain containing 42195617044195643502Rat
1560484RGD1560484similar to ribosomal protein L42234973369234975268Rat
1334199Olr1788-psolfactory receptor pseudogene 17882160750707160751099Rat
1562059Them5thioesterase superfamily member 52195582781195588000Rat
1562344Bcl2l15BCL2-like 152206307778206319662Rat
1565211Trmt13tRNA methyltransferase 13 homolog2219615665219628824Rat
1359711Clk2CDC-like kinase 22188476789188488809Rat
1562936RGD1562936similar to Heat shock protein HSP 90-beta (HSP 84)27295968172963589Rat
2071Agtr1bangiotensin II receptor, type 1b2105149020105224335Rat
1563598Cd160CD160 molecule2198933681198965380Rat
1561457Actrt3actin-related protein T32116416561116418521Rat
1562174Fnip2folliculin interacting protein 22178223561178334925Rat
1563943RGD1563943similar to mcdc21 protein2147477397147480564Rat
1561807Dpm3dolichyl-phosphate mannosyltransferase subunit 3, regulatory2188583664188584179Rat
1563710LOC499565LRRGT0003828795736387970337Rat
1565052Lrrc34leucine rich repeat containing 342116370013116391964Rat
1562064Otol1otolin 12166845543166866513Rat
1563109Tmem212transmembrane protein 2122113578614113616786Rat
1561499Lrrc31leucine rich repeat containing 312116299380116343089Rat
1564472Rexo1l1-ps1REX1, RNA exonuclease 1 homolog-like 1, pseudogene 12143830019143832825Rat
1564469Rplp0l1ribosomal protein lateral stalk subunit P0 like 12206902776206903920Rat
1561700Cdc42se1CDC42 small effector 12196402837196410664Rat
1563391Gstm6glutathione S-transferase, mu 62210733594210738368Rat
1563392RGD1563392similar to TDPOZ22195039193195040393Rat
1560010RGD1560010RGD15600102178389986178393118Rat
1563445RGD1563445similar to glyceraldehyde-3-phosphate dehydrogenase27622567476226656Rat
1565000Fabp12fatty acid binding protein 1229371246893766665Rat
1311204Vtcn1V-set domain containing T cell activation inhibitor 12203200435203274264Rat
1311218Mgst2microsomal glutathione S-transferase 22140708396140727381Rat
1560453Ca13carbonic anhydrase 1328828296188314254Rat
1562346Hist2h2behistone cluster 2 H2B family member E2198360837198363399Rat
1561508RGD1561508similar to ribosomal protein S102201417516201424289Rat
1560096RGD1560096similar to TDPOZ1; POZ 56 protein2194310427194311561Rat
1563314RGD1563314similar to phosphoglycerate mutase (EC 5.4.2.1) B chain - rat2186932296186933345Rat
1565003Retreg1reticulophagy regulator 127839192178401569Rat
1565007Fhip1aFHF complex subunit HOOK interacting protein 1A2184684851184993350Rat
1566022LOC499573LRRGT0005629508425495106157Rat
1565088RGD1565088similar to UPF0197 protein C11orf10 homolog2232314611232314984Rat
1563987Abhd18abhydrolase domain containing 182127770588127828218Rat
1565941Vav3vav guanine nucleotide exchange factor 32212247061212585818Rat
1563869Zfp704zinc finger protein 70429437705994559838Rat
1563197Aadacl2arylacetamide deacetylase-like 22150344307150365033Rat
1563168Celf3CUGBP, Elav-like family member 32195716373195732872Rat
1561998RGD1561998similar to hypothetical protein C130079G132149843238149871729Rat
1560200Gpr160G protein-coupled receptor 1602116105110116162036Rat
1560205Rbm46RNA binding motif protein 462181828931181874223Rat
1560208RGD1560208similar to Farnesyl pyrophosphate synthetase (FPP synthetase)2193722588193723138Rat
1560220Dnajc19DnaJ heat shock protein family (Hsp40) member C192120503093120531782Rat
1359694Rap1aRAP1A, member of RAS oncogene family2208193950208215186Rat
1565775Khdc4KH domain containing 4, pre-mRNA splicing factor2188051657188080280Rat
1563262Tmem154transmembrane protein 1542183674361183714232Rat
1564454Tmem167btransmembrane protein 167B2211348762211352540Rat
1564099Dram2DNA-damage regulated autophagy modulator 22209160901209189641Rat
1559622RGD1559622similar to hypothetical protein C130079G132149714565149754734Rat
1564227Ankrd33bankyrin repeat domain 33B28436106184436912Rat
1560965H2ac20H2A clustered histone 202198360271198360735Rat
1560967Gpsm2G-protein signaling modulator 22211480120211528096Rat
1563726Spata16spermatogenesis associated 162112281326112659911Rat
1560109RGD1560109similar to TDPOZ22194350100194352331Rat
1560053Tbl1xr1TBL1X receptor 12107221913107359229Rat
1359625LOC361985similar to NICE-32189400696189413614Rat
1563847RGD1563847similar to karyopherin (importin) alpha 22133880368133882115Rat
1565757Marchf6membrane associated ring-CH-type finger 628453354684608743Rat
1332726Olr1280olfactory receptor 12802115074344115075303Rat
1559684Zfp458zinc finger protein 45828697112986980519Rat
1334307Olr389-psolfactory receptor pseudogene 38929287452692875568Rat
1359321Gnb4G protein subunit beta 42118978965119007877Rat
1359329Pdcd10programmed cell death 102173966701174012730Rat
1559451Erich6glutamate-rich 62148812060148861470Rat
1559609Wwtr1WW domain containing transcription regulator 12147577149147693033Rat
1359508RGD1359508similar to protein C33A12.32128675786128738215Rat
1311935Chd1lchromodomain helicase DNA binding protein 1-like2199714044199792270Rat
1359104Ppm1jprotein phosphatase, Mg2+/Mn2+ dependent, 1J2207263307207268601Rat
1359267Ptbp2polypyrimidine tract binding protein 22223261444223323075Rat
1559993Loricrinloricrin cornified envelope precursor protein2191984455191990713Rat
1563205OtulinlOTU deubiquitinase with linear linkage specificity like28038364280408672Rat
1564313RGD1564313similar to TDPOZ32194433847194434941Rat
1311982Slc25a24solute carrier family 25 member 242211930371211967511Rat
1311955Fhdc1FH2 domain containing 12183450608183487820Rat
1311956Trim59tripartite motif-containing 592165629903165641751Rat
1311673Fndc3bfibronectin type III domain containing 3B2113109949113415171Rat
1311677Rfx5regulatory factor X52196119054196128109Rat
1560629AtpsckmtATP synthase c subunit lysine N-methyltransferase28467889284694152Rat
1359128Selenotselenoprotein T2148765412148781080Rat
1311265Mettl25bmethyltransferase like 25B2187294052187302691Rat
1311687Rptnrepetin2193722394193729040Rat
1311688Bcar3BCAR3 adaptor protein, NSP family member2226563050226679449Rat
1564247RGD1564247similar to SUMO/sentrin specific protease 529769429797697653Rat
1564249Strip1striatin interacting protein 12210393708210413757Rat
1560368Map9microtubule-associated protein 92181331426181367245Rat
1359309Adad1adenosine deaminase domain containing 12123790798123848598Rat
628721Sclt1sodium channel and clathrin linker 12128523376128675668Rat
1564171RGD1564171RGD15641712189413966189417000Rat
1560263RGD1560263similar to nuclear receptor binding factor 22195855521195857093Rat
1559660Mindy1MINDY lysine 48 deubiquitinase 12196458229196470133Rat
1562088RGD1562088similar to 60S ribosomal protein L23a2214093503214099966Rat
1359334RGD1359334similar to hypothetical protein FLJ205192196411937196415530Rat
1359270Alx3ALX homeobox 32210376510210386928Rat
1310519Tnfaip8l2TNF alpha induced protein 8 like 22196309789196329495Rat
1312003Alg14ALG14, UDP-N-acetylglucosaminyltransferase subunit2224851352224931461Rat
1312006Ift80intraflagellar transport 802165506878165600748Rat
1359521Prune1prune exopolyphosphatase 12196427714196457105Rat
1561111RGD1561111similar to Eno1 protein2193362511193363843Rat
1334143Olr1818-psolfactory receptor pseudogene 18182162424828162425001Rat
1359655Slc16a4solute carrier family 16, member 42210045122210161017Rat
1563022Zfhx4zinc finger homeobox 429842356598610368Rat
1559967RGD1559967similar to M2-type pyruvate kinase2134178506134179766Rat
1560377SnapinSNAP-associated protein2189878159189880743Rat
1559791Mtx1Metaxin 12188522605188528747Rat
1333855Olr1846-psolfactory receptor pseudogene 18462196735196196735826Rat
619925AnkhANKH inorganic pyrophosphate transport regulator28013156380256948Rat
1333718Olr1864-psolfactory receptor pseudogene 18642196798669196799287Rat
1562104RGD1562104similar to TDPOZ32194929421194931184Rat
1333023Olr392olfactory receptor 3922209581677209582627Rat
1359533LOC365778similar to RIKEN cDNA 1700034I232127776103127778350Rat
1333446Olr1815-psolfactory receptor pseudogene 18152163724778163725405Rat
1564291Fat4FAT atypical cadherin 42125751818125879398Rat
1334203Olr390olfactory receptor 3902199528902199529864Rat
1311184Slc22a15solute carrier family 22, member 152204281638204344026Rat
1311196Tdrkhtudor and KH domain containing2195649813195674217Rat
1561012Adamtsl4ADAMTS-like 42197803572197815058Rat
619996Bchebutyrylcholinesterase2171104476171196186Rat
1303341Reg4regenerating family member 42200395253200410009Rat
1564691Gon4lgon-4 like2188139730188212902Rat
1563041Tlcd4TLC domain containing 42224768034224843198Rat
1333002Olr391-psolfactory receptor pseudogene 3912199562484199563386Rat
1359419Vom1r56vomeronasal 1 receptor 562168228099168229055Rat
1564904Mex3amex-3 RNA binding family member A2187893678187902546Rat
1560162RGD1560162similar to hypothetical protein C130079G132150057577150082441Rat
1560177Lhfpl6LHFPL tetraspan subfamily member 62142262236142461980Rat
1308111Otud7bOTU deubiquitinase 7B2198231353198302220Rat
1359558tGap1GTPase activating protein testicular GAP129254941392625942Rat
1332961Olr1802-psolfactory receptor pseudogene 18022163904825163905463Rat
1333741Olr1279olfactory receptor 12792115092263115093210Rat
1560081LOC499584LRRGT002022110306363110329642Rat
1311852Kcnmb3potassium calcium-activated channel subfamily M regulatory beta subunit 32118868225118882562Rat
1560826RGD1560826similar to glyceraldehyde-3-phosphate dehydrogenase2226825623226826642Rat
1560828Dnah5dynein, axonemal, heavy chain 528115906081337560Rat
1560828Dnah5dynein, axonemal, heavy chain 528094773081143997Rat
1561865Lysmd1LysM domain containing 12196304492196312520Rat
1560320Dennd4bDENN domain containing 4B2189626922189642732Rat
1560324RGD1560324similar to hypothetical protein C130079G132149899527150023909Rat
1359171mrpl9mitochondrial ribosomal protein L92195684750195689470Rat
1359174LOC365791similar to T-cell activation Rho GTPase-activating protein isoform b2137292879137342348Rat
1303111RtcaRNA 3'-terminal phosphate cyclase2219537213219558489Rat
1302941P2ry13purinergic receptor P2Y132149429648149432864Rat
1359446Tent5cterminal nucleotidyltransferase 5C2202797766202816562Rat
1561906RGD1561906similar to RIKEN cDNA 4930430F0827381996073822243Rat
1585081LOC691336similar to Glyceraldehyde-3-phosphate dehydrogenase (GAPDH)2167926734167927858Rat
1565351Rfxapregulatory factor X-associated protein2144003453144007636Rat
1566235Rpl36a-ps1ribosomal protein L36a, pseudogene 12147817956147818351Rat
1566255LOC499643similar to hypothetical protein FLJ253712178117385178231388Rat
1566258RGD1566258similar to Spindlin-like protein 2 (SPIN-2)2196968178196968855Rat
1586050LOC367650similar to Thioredoxin-like protein 4A (Thioredoxin-like U5 snRNP protein U5-15kD) (Spliceosomal U5 snRNP-specific 15 kDa protein) (DIM1 protein homolog)2156339387156341104Rat
1586056LOC367639similar to Spindlin-like protein 3 (SPIN-3) (Protein DXF34)2159411972159412623Rat
1565422RGD1565422similar to 60S ribosomal protein L3527165212171755719Rat
1565425Lekr1leucine, glutamate and lysine rich 12157451912157621908Rat
1585689Zfp639zinc finger protein 6392118906479118917491Rat
1565059RGD1565059similar to hypothetical protein E130311K132154485133154508907Rat
1583573LOC681117similar to ribosomal protein L626916003469204472Rat
1585106Lrrc39leucine rich repeat containing 392219598162219617498Rat
1585265LOC688743similar to TD and POZ domain containing 42193998595194000163Rat
62070Crabp2cellular retinoic acid binding protein 22187322416187326794Rat
1585271Gpr171G protein-coupled receptor 1712149319445149328055Rat
1585973LOC679616similar to heterogeneous nuclear ribonucleoprotein A32181398893181400355Rat
1587185Slc6a17solute carrier family 6 member 172210249663210299770Rat
1583285Hspd1-ps25heat shock protein 1, pseudogene 2527549530575498884Rat
1566380Ciartcircadian associated repressor of transcription2197987705197991198Rat
1584731Smg5SMG5 nonsense mediated mRNA decay factor2187708247187735355Rat
1586489Cetn4centrin 42124045092124048441Rat
1584541LOC683610similar to protein phosphatase 1, regulatory (inhibitor) subunit 3B2165882373165883347Rat
1585655LOC683539similar to Nonhistone chromosomal protein HMG-17 (High-mobility group nucleosome binding domain 2)28614065586140925Rat
1585903LOC679686similar to Alpha-enolase (2-phospho-D-glycerate hydro-lyase) (Non-neural enolase) (NNE) (Enolase 1)2181655422181662679Rat
1561709RGD1561709similar to ribosomal protein S182122732106122732790Rat
1587997LOC683372similar to 60S ribosomal protein L22 (Heparin-binding protein HBp15)2202138627202139093Rat
1584722Paqr6progestin and adipoQ receptor family member 62187736774187741696Rat
1359727Cept1choline/ethanolamine phosphotransferase 12209118140209162071Rat
1564513RGD1564513similar to TDPOZ22194014013194015389Rat
1582903LOC690204similar to interferon induced transmembrane protein 22198497622198498494Rat
1583677Tmem131ltransmembrane 131 like2182897332183031273Rat
1585037Psrc1proline and serine rich coiled-coil 12211176437211181078Rat
1583881LOC691492similar to heat shock protein 82226105727226109691Rat
1583884LOC691489similar to Cellular tumor antigen p53 (Tumor suppressor p53)2214925460214934856Rat
1587796LOC685979similar to Transducin-like enhancer protein 4 (Groucho-related protein 4) (Grg-4)28765712687668202Rat
1583215SheSrc homology 2 domain containing E2189169691189194934Rat
1564926LOC499607similar to GTPase activating protein testicular GAP12133075993133123187Rat
1587550Anxa9annexin A92196470318196481568Rat
1587573LOC689807similar to ribosomal protein L18a2139315700139316768Rat
1559607RGD1559607similar to 60S ribosomal protein L132219043055219047767Rat
1587421Mrps17-ps1mitochondrial ribosomal protein S17, pseudogene 12212435669212436261Rat
1583957Aknad1AKNA domain containing 12211541800211585332Rat
1585227LOC688781similar to Saccharomyces cerevisiae Nip7p homolog2194041512194057900Rat
1359336St7lsuppression of tumorigenicity 7-like2207350651207421082Rat
1562501Lamtor2late endosomal/lysosomal adaptor, MAPK and MTOR activator 22187911530187914930Rat
1562890RGD1562890RGD15628902104400402104404083Rat
1584592LOC682357similar to homolog of yeast ribosome biogenesis regulatory protein RRS12104677767104681233Rat
1561719Atp11bATPase phospholipid transporting 11B (putative)2122337757122445090Rat
1561608Bbs12Bardet-Biedl syndrome 122124048513124057026Rat
1562196RGD1562196similar to ubiquitin A-52 residue ribosomal protein fusion product 12198086856198087288Rat
1583925Slc25a54solute carrier family 25, member 542211880241211927191Rat
1583859LOC295077similar to Protein kinase C-binding protein 1 (Rack7) (Cutaneous T-cell lymphoma associated antigen se14-3) (CTCL tumor antigen se14-3) (Zinc finger MYND domain containing protein 8)2150901527150902716Rat
1564378RGD1564378similar to 60S ribosomal protein L23a2125253104125257745Rat
1563465Ntng1netrin G12212695464213073046Rat
1565414Nhlrc3NHL repeat containing 32142672188142686593Rat
1564595Pramel3preferentially expressed antigen in melanoma-like 32102443276102455605Rat
1563620RGD1563620similar to retinoblastoma binding protein 42166348373166350259Rat
1564557Dcst2DC-STAMP domain containing 22188689090188703367Rat
1565825Gstm4glutathione S-transferase mu 42210834013210839242Rat
1565469Nudt17nudix hydrolase 172198831546198836191Rat
1565811Pcdh10protocadherin 102136992355137017705Rat
1583489LOC682402hypothetical protein LOC6824022104996271105001713Rat
1582776Rnpc3RNA-binding region (RNP1, RRM) containing 32216481457216510051Rat
1564972RGD1564972RGD15649722193311868193313055Rat
1562234S100a7l2S100 calcium binding protein A7 like 22191291478191294828Rat
1563329Dchs2dachsous cadherin-related 22182112787182319003Rat
1561817TnikTRAF2 and NCK interacting kinase2113984599114391805Rat
1562620Etv3lETS variant transcription factor 3 like2186899060186911913Rat
1565626Lce1flate cornified envelope 1F2192990607192992193Rat
1563562RGD1563562similar to GTPase activating protein testicular GAP12132238755132304243Rat
1561797Cks1bCDC28 protein kinase regulatory subunit 1B2188740564188745144Rat
1560510RGD1560510similar to TDPOZ22194508831194511446Rat
1565475LOC361914similar to solute carrier family 7 (cationic amino acid transporter, y+ system), member 1228845379288553113Rat
1564779Synpo2synaptopodin 22227255243227411924Rat
1566337RGD1566337similar to TDPOZ22194874803194879455Rat
1566350Cdh12cadherin 1227131022872540063Rat
1562629Nbeaneurobeachin2145011648145513439Rat
1565641Rbisribosomal biogenesis factor28833801888350785Rat
1564583RGD1564583similar to ribosomal protein S232207576914207577344Rat
1582784LOC691530similar to Transcription elongation regulator 1 (TATA box-binding protein-associated factor 2S) (Transcription factor CA150) (p144) (Formin-binding protein 28) (FBP 28)2216317216216320055Rat
1559874Rit1Ras-like without CAAX 12188087486188099444Rat
1563340RGD1563340similar to ribosomal protein S242146952507146952929Rat
1565270Cox6b1-ps1cytochrome c oxidase subunit VIb polypeptide 1, pseudogene 12211337261211337668Rat
1584971LOC310579similar to Annexin A7 (Annexin VII) (Synexin)2192969392192971803Rat
1582794LOC691520similar to Pancreatic alpha-amylase precursor (PA) (1,4-alpha-D-glucan glucanohydrolase)2216198543216202324Rat
1359278Creb3l4cAMP responsive element binding protein 3-like 42189596657189602243Rat
1561991Plch1phospholipase C, eta 12154256382154468166Rat
1566273RGD1566273similar to exo-alpha-sialidase (EC 3.2.1.18) - Trypanosoma cruzi27775599077772012Rat
1566121Flg2filaggrin family member 22193480880193485463Rat
1566012Frem2FRAS1 related extracellular matrix 22142747501142885604Rat
1584142LOC688824similar to 60S ribosome subunit biogenesis protein NIP7 homolog (PEachy) (KD93)2194405396194406147Rat
1565198LOC304239similar to RalA binding protein 12157031044157071062Rat
1359289mrpl24mitochondrial ribosomal protein L242187288460187294676Rat
1564622Wdr49WD repeat domain 492173675780173800840Rat
1560554RGD1560554similar to TDPOZ22195485668195553986Rat
1565369RGD1565369similar to TDPOZ32194557578194558660Rat
1563451RGD1563451similar to TDPOZ22194373815194374898Rat
1563667RGD1563667similar to TDPOZ32195152284195554013Rat
1582857Polr3glRNA polymerase III subunit GL2198698044198719609Rat
1565646Sox2SRY-box transcription factor 22121165137121167545Rat
1564543Chmp4ccharged multivesicular body protein 4C29357455493641497Rat
1566159RGD1566159similar to preferentially expressed antigen in melanoma-like 32102407173102422428Rat
1565234Gabpb2GA binding protein transcription factor subunit beta 22196357030196392514Rat
1582979LOC688928hypothetical protein LOC6889282194267643194268739Rat
1565989RGD1565989similar to FLJ10378 protein2127916157127948154Rat
1559945Marchf11membrane associated ring-CH-type finger 1127882505378926402Rat
1564960Hormad1HORMA domain containing 12197681820197720197Rat
1565845Tmem144transmembrane protein 1442178585586178617094Rat
1589753LOC310177similar to RIKEN cDNA 0610040D2027778378877784626Rat
1589379Fcrl5Fc receptor-like 52186776466186797900Rat
1588592LOC294660similar to peroxiredoxin 12142969693142970366Rat
1592474Larp7La ribonucleoprotein 7, transcriptional regulator2231866888231882002Rat
1596780Thbs3thrombospondin 32188528979188540738Rat
1588790LOC688498similar to Transcription factor Spi-C (Pu.1-related factor) (Prf)29112583191148869Rat
1586346Setd7SET domain containing 7, histone lysine methyltransferase2140576188140618405Rat
1589577Sohlh2spermatogenesis and oogenesis specific basic helix-loop-helix 22144591755144614065Rat
1589578LOC502594similar to Adenosylhomocysteinase (S-adenosyl-L-homocysteine hydrolase) (AdoHcyase)2231663960231666002Rat
1589579LOC502589similar to Cofilin-1 (Cofilin, non-muscle isoform)2203162397203162903Rat
1589580LOC502588similar to 3 beta-hydroxysteroid dehydrogenase type 3 (3 beta-hydroxysteroid dehydrogenase type III) (3Beta-HSD III) (NADPH-dependent 3-beta-hydroxy-delta(5)-steroid dehydrogenase) (3-beta-hydroxy-5-ene steroid dehydrogenase) (Progesterone reductas...2200681300200692452Rat
1593760LOC685499similar to MYST histone acetyltransferase 128156538081567407Rat
1586362Ndufc1NADH:ubiquinone oxidoreductase subunit C12140460749140464588Rat
1586369Mgarpmitochondria-localized glutamic acid-rich protein2140444963140453719Rat
1588660LOC691033similar to GTPase activating protein testicular GAP12155074308155087768Rat
1591412LOC685600similar to peptidoglycan recognition protein 32190505051190519822Rat
1589965Mtmr11myotubularin related protein 112198301666198311787Rat
1593779S100a7aS100 calcium binding protein A7A2190058093190063132Rat
1588671LOC691020similar to Carboxy-terminal domain RNA polymerase II polypeptide A small phosphatase 1 (Nuclear LIM interactor-interacting factor 3) (NLI-interacting factor 3) (Golli-interacting protein) (GIP)2205682093205690483Rat
1589149Gbaglucosylceramidase beta2188511781188522602Rat
1589984Mab21l1mab-21 like 12145174876145177265Rat
1592771Hsd3b3hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 32200756557200762492Rat
1591367Ropn1lrhophilin associated tail protein 1-like28452042184531192Rat
1587344Noctnocturnin2140286661140306869Rat
1587345LOC310385similar to heat shock protein 82133460745133462694Rat
1590821Dusp14l1dual specificity phosphatase 14-like 12140835793140837188Rat
1589125Ubl4bubiquitin-like 4B2210337303210370534Rat
1586190LOC294831similar to ubiquitin-conjugating enzyme E2R 227022468870343525Rat
1590829LOC365940similar to proteasome (prosome, macropain) subunit, beta type 72233877171233878110Rat
1590830LOC365932similar to Glyceraldehyde-3-phosphate dehydrogenase (GAPDH)2146829995146830692Rat
1590831LOC365926similar to amphoretin-induced gene and ORF2227218384227219312Rat
1592010LOC365897similar to 40S ribosomal protein S62207473262207473888Rat
1592014LOC365852similar to TD and POZ domain containing 52194457790194506489Rat
1592072LOC307328similar to Spindlin-like protein 2 (SPIN-2)2163645325163651378Rat
1587862Sprr1bsmall proline-rich protein 1B2192622972192624848Rat
1589989LOC688389similar to solute carrier family 7 (cationic amino acid transporter, y+ system), member 1228874452788763968Rat
1591091LOC689536similar to cyclin D binding myb-like transcription factor 12130505006130507171Rat
1587849Rsl1regulator of sex limited protein 128701590487040788Rat
1585218Pmp2peripheral myelin protein 229382750493831419Rat
1593160Amy2-ps2amylase 2, pancreatic, pseudogene 22216231732216237692Rat
1593161Lix1llimb and CNS expressed 1 like2198726110198751987Rat
1593162LOC499662similar to DnaJ homolog subfamily B member 6 (Heat shock protein J2) (HSJ-2) (MRJ) (mDj4)2192982056192984685Rat
1593163Sprr1asmall proline-rich protein 1A2192669143192671059Rat
1593164Pglyrp3peptidoglycan recognition protein 32191903626192264872Rat
1593166LOC499644similar to heat shock protein 1, beta2181296061181299751Rat
1593169Tsc22d2TSC22 domain family, member 22148607148148659632Rat
1593170Ccdc169coiled-coil domain containing 1692144551382144581044Rat
1592212Med12lmediator complex subunit 12L2149213134149316569Rat
1590976LOC690857similar to mitochondrial transcription termination factor 12150980439150985305Rat
1592323LOC689439similar to myc induced nuclear antigen2136827953136829821Rat
1589176LOC684509similar to NADH-ubiquinone oxidoreductase B9 subunit (Complex I-B9) (CI-B9)2210115719210116074Rat
1589590LOC502545similar to Pre-mRNA-splicing factor 19 (PRP19/PSO4 homolog) (Neuronal differentiation-related gene protein)2193785668193786981Rat
1589591Eif2aeukaryotic translation initiation factor 2A2148722343148755781Rat
1589592LOC502522similar to mitochondrial ribosomal protein L542112937805112938362Rat
1589593LOC502512similar to 60S ribosomal protein L7a27640964176423866Rat
1590215LOC685753similar to peptidylprolyl isomerase D2120637313120638592Rat
1589422Med14-ps1mediator complex subunit 14, pseudogene 12105594070105611706Rat
1588803LOC688485similar to heat shock protein 229106567491067564Rat
1588810Commd2COMM domain containing 22147774767147779013Rat
1585613LOC683581similar to ADP-ribosylation factor 72165759333165791609Rat
1586221LOC691290similar to Vacuolar ATP synthase catalytic subunit A, ubiquitous isoform2166316268166319889Rat
1587462Tafa3TAFA chemokine like family member 32207249000207258962Rat
1587056LOC680827similar to Mitogen-activated protein kinase 6 (Extracellular signal-regulated kinase 3) (ERK-3) (p55-MAPK)2108525465108611473Rat
1584694Pmf1polyamine-modulated factor 12187751770187771933Rat
1587814Sirpb2l1signal-regulatory protein beta 2-like 128752884787620311Rat
1586670LOC686026similar to eukaryotic translation initiation factor 5A28795479287965583Rat
1559517Pabpc4lpoly(A) binding protein, cytoplasmic 4-like2130656212130658202Rat
1589858LOC690921similar to MAPKK-like protein kinase2152512221152513579Rat
1589169Kcnc4potassium voltage-gated channel subfamily C member 42210220908210241447Rat
1589156Ctsocathepsin O2180857178180881677Rat
1586098LOC365085similar to nidogen 22156622791156807695Rat
1586216LOC691296similar to phosphoserine aminotransferase 12166330544166331705Rat
1586282Pifoprimary cilia formation2208616592208633961Rat
1359281Golph3lgolgi phosphoprotein 3-like2197720259197749060Rat
1584037Hist2h2aa2histone cluster 2 H2A family member A22198381678198382247Rat
1589797LOC690988similar to ribosomal protein L152205497424205500522Rat
1590650LOC680510similar to 40S ribosomal protein S62184846853184847564Rat
1590660LOC680500similar to CCR4-NOT transcription complex, subunit 82104555623104557255Rat
1585492Ccdc144bcoiled-coil domain containing 144B2122702354122747848Rat
1585003LOC294985similar to 3-phosphoglycerate dehydrogenase2124761699124768754Rat
1585005LOC294909similar to Inosine-5-monophosphate dehydrogenase 1 (IMP dehydrogenase 1) (IMPDH-I) (IMPD 1)29879266598794481Rat
1585007LOC294901hypothetical LOC29490129540647595406979Rat
1588875Lce1mlate cornified envelope 1M2193333799193336789Rat
1588876LOC688412similar to Fructose-bisphosphate aldolase A (Muscle-type aldolase) (Aldolase 1)28996727989968449Rat
1583236LOC685066similar to Ferritin light chain 1 (Ferritin L subunit 1)2189157469189160663Rat
1583237LOC685065similar to heat shock protein 82116295605116299029Rat
1582963LOC688944similar to eukaryotic translation initiation factor 4A, isoform 12126147704126148434Rat
1589949LOC689629similar to GTPase activating protein testicular GAP12132883598132969563Rat
1565147Naaladl2N-acetylated alpha-linked acidic dipeptidase-like 22109092931110424885Rat
1583267Gpx2-ps1glutathione peroxidase 2, pseudogene 12116263844116264654Rat
1585279LOC688728similar to TD and POZ domain containing 52193968774193971161Rat
1589926LOC689652similar to prohibitin2132979721132990069Rat
1585474Lce1llate cornified envelope 1L2193164403193165736Rat
1586030LOC500213similar to T-box transcription factor TBX15 (T-box protein 15) (MmTBx8)2201400320201405299Rat
1584042LOC690126hypothetical protein LOC6901262198379864198381026Rat
1584064H2ac21H2A clustered histone 212198359754198360146Rat
1586171LOC310487similar to purinergic receptor P2Y, G-protein coupled, 42164777960164779046Rat
1584812LOC679729hypothetical protein LOC6797292181819796181820402Rat
1586682LOC686014similar to AP-2 complex subunit sigma-1 (Adapter-related protein complex 2 sigma-1 subunit) (Sigma-adaptin 3b) (Clathrin coat assembly protein AP17) (Clathrin coat-associated protein AP17) (Plasma membrane adaptor AP-2 17 kDa protein) (Clathrin ass...28767714287677583Rat
1587438Capza1capping actin protein of muscle Z-line subunit alpha 12207305748207350812Rat
1585456LOC686143similar to keratinocytes proline-rich protein2193183789193185796Rat
1586257LOC691253similar to Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (38 kDa BFA-dependent ADP-ribosylation substrate) (BARS-38)2209005397209006941Rat
1589269LOC683212similar to keratin complex 1, acidic, gene 1828087826380879814Rat
1590934LOC692120similar to heterogeneous nuclear ribonucleoprotein R2216060500216062449Rat
1588194LOC680772similar to heterogeneous nuclear ribonucleoprotein F2186936999186938478Rat
1590834Amd1-ps1adenosylmethionine decarboxylase 1, pseudogene 12215920160215927383Rat
1590835LOC365910similar to Glyceraldehyde-3-phosphate dehydrogenase (GAPDH)2215567587215582022Rat
1588275LOC679491hypothetical protein LOC6794912140805576140806314Rat
1593206LOC365784similar to Fructose-bisphosphate aldolase A (Muscle-type aldolase)2131485704131486986Rat
1593207LOC365777similar to D-3-phosphoglycerate dehydrogenase (3-PGDH)2126190906126192575Rat
1593209LOC365768similar to 60S ribosomal protein L72123428021123428831Rat
1593212LOC365742similar to testis expressed gene 229692357997028648Rat
1593213LOC365740hypothetical LOC36574029614384596147001Rat
1593292Flad1flavin adenine dinucleotide synthetase 12188726994188736462Rat
1595785RorcRAR-related orphan receptor C2195612471195636797Rat
2838Hsd3b5hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 52200615910200633317Rat
1592025LOC365824similar to FtsJ homolog 3 (E. coli)2175308050175311662Rat
1592026LOC365821similar to Voltage-dependent anion-selective channel protein 1 (VDAC-1) (mVDAC1) (mVDAC5) (Outer mitochondrial membrane protein porin 1) (Plasmalemmal porin)2173434961173436479Rat
1592027LOC365820similar to enolase 1, alpha non-neuron2171754658171756732Rat
1592028LOC365817similar to BRCA1/BRCA2-containing complex subunit 36 isoform 22169899357169900225Rat
1592031LOC365805similar to Eukaryotic translation initiation factor 5 (eIF-5)2153752883153756067Rat
1592032LOC365803hypothetical LOC3658032150664790150671984Rat
1596195Slc25a31solute carrier family 25 member 312127538323127554276Rat
1593216LOC365729similar to N-terminal acetyltransferase complex ARD1 subunit homolog A29056985790571294Rat
1593218LOC365720similar to BMP/retinoic acid-inducible neural-specific protein28162815981632045Rat
1593219LOC365713similar to 60S ribosomal protein L927852928578529861Rat
1593220LOC365709similar to SWI/SNF-related matrix-associated actin-dependent regulator of chromatin e127020335270204638Rat
1596137LOC689167similar to Saccharomyces cerevisiae Nip7p homolog2194986831194987542Rat
1596656LOC682635similar to CG31855-PA27471190674714279Rat
1597355Sertm1serine-rich and transmembrane domain containing 12144303700144323509Rat
1593476Ptx3pentraxin 32158097843158103653Rat
1595438LOC680186hypothetical protein LOC6801862101741331101742652Rat
1598327Mov10Mov10 RISC complex RNA helicase2207277088207301245Rat
1598328Ngfnerve growth factor2204886158204939523Rat
1596990LOC503282similar to Spindlin-like protein 3 (SPIN-3) (Protein DXF34)2160344060160345612Rat
1593187Amy2a3amylase 2a32216373674216382260Rat
1596077Nr1h5nuclear receptor subfamily 1, group H, member 52205431237205457409Rat
1594062Rnf13ring finger protein 132147853423147948277Rat
1595520Mab21l2mab-21 like 22185849749185852833Rat
1597460LOC689026similar to Saccharomyces cerevisiae Nip7p homolog2194598122194599119Rat
1597461Mrps28mitochondrial ribosomal protein S2829507757795080825Rat
1597469LOC689017similar to 60S ribosome subunit biogenesis protein NIP7 homolog (PEachy) (KD93)2195004590195006412Rat
1594660LOC691807hypothetical protein LOC6918072227095487227097247Rat
1595598LOC678817similar to GTPase activating protein testicular GAP12132491051132551249Rat
1596973LOC678711similar to tropomyosin 2 (beta) isoform 229519735395198228Rat
1593421LOC690649similar to 60S ribosomal protein L82201156385201162603Rat
1593429Snrpgl2small nuclear ribonucleoprotein polypeptide G-like 22201111393201111773Rat
1592730LOC684215similar to forkhead box K2 isoform 12176503613176505582Rat
1592619LOC685528similar to nudix-type motif 52190114091190114727Rat
1593204LOC365790similar to heat shock protein 82137712190137714142Rat
1593205LOC365789similar to histone deacetylase 12138284493138285832Rat
1592017LOC365846similar to Choline-phosphate cytidylyltransferase A (Phosphorylcholine transferase A) (CTP:phosphocholine cytidylyltransferase A) (CT A) (CCT A) (CCT-alpha)2191935954191937333Rat
1592018LOC365839similar to elongation protein 4 homolog2186630203186631703Rat
1592019LOC365837similar to Multisynthetase complex auxiliary component p432186359416186361359Rat
1592021LOC365829similar to grancalcin2180800652180803316Rat
1592022LOC365828similar to DJ-1 protein2178868474178869217Rat
1592023LOC365827similar to 60S ribosomal protein L72178212078178213029Rat
1592024LOC365825similar to Voltage-dependent anion-selective channel protein 1 (VDAC-1) (mVDAC1) (mVDAC5) (Outer mitochondrial membrane protein porin 1) (Plasmalemmal porin)2176681055176682000Rat
1591950LOC499706similar to Heat shock protein HSP 90-beta (HSP 84)2229799117229801236Rat
1592330Mrps21mitochondrial ribosomal protein S212197974758197982385Rat
1593417Wars2tryptophanyl tRNA synthetase 2 (mitochondrial)2201170363201256115Rat
1597150LOC310891similar to heat shock protein 82229131814229133738Rat
1597181LOC295200similar to TD and POZ domain containing 12194756433194757333Rat
1592056LOC361966similar to Heat shock protein HSP 90-beta (HSP 84)2177641905177650737Rat
1592057LOC361963similar to phosphoglycerate mutase (EC 5.4.2.1) B chain - rat2169531412169532338Rat
1592058LOC361937similar to Galectin-92124537252124539068Rat
1592059LOC361908similar to 40S ribosomal protein S1028227462582275183Rat
1593351Fam241afamily with sequence similarity 241 member A2232214331232245319Rat
1592713Rbm15RNA binding motif protein 152210079678210090200Rat
1592218Spag17sperm associated antigen 172202159659202452361Rat
1594621LOC691855similar to 60S ribosomal protein L72228676702228698985Rat
1590374LOC683192similar to zinc finger, DHHC domain containing 32203032664203033842Rat
1596041LOC690468similar to 60S ribosomal protein L382199478992199479316Rat
1588992LOC685894similar to heterogeneous nuclear ribonucleoprotein A32121129239121130650Rat
1593483LOC689381similar to WD repeat domain 61 isoform a2135628973135630081Rat
1589411Fcrl1Fc receptor-like 12186702311186724205Rat
1594628LOC691847similar to ribosomal protein L192228475954228476536Rat
1594630Hspd1-ps12heat shock protein 1, pseudogene 122228042093228043029Rat
1593375LOC691901similar to Histidine triad nucleotide-binding protein 1 (Adenosine 5-monophosphoramidase) (Protein kinase C inhibitor 1) (Protein kinase C-interacting protein 1) (PKCI-1)2230705727230706550Rat
1597284Rps27a-ps24ribosomal protein S27a, pseudogene 242219059494219060021Rat
1594802LOC689250similar to Saccharomyces cerevisiae Nip7p homolog2194973604194974248Rat
1594713Adam30ADAM metallopeptidase domain 302200328498200331938Rat
1590321LOC684446similar to ubiquitin C2161600250161600711Rat
1591978Hsc70-ps1heat shock cognate protein 70, pseudogene 12177651231177653349Rat
1597324Vangl1VANGL planar cell polarity protein 12204575592204625835Rat
1595983LOC691737similar to glyceraldehyde-3-phosphate dehydrogenase2224737842224738840Rat
1595140LOC685308similar to Heat shock protein HSP 90-beta (HSP 84) (Tumor-specific transplantation 84 kDa antigen) (TSTA)27956880279571074Rat
1597335LOC690353similar to Protein C14orf1112199141471199142093Rat
1595487LOC680137similar to tropomyosin 3, gamma isoform 12101137061101138421Rat
1594375Slc7a14solute carrier family 7, member 142115678344115788688Rat
1594376LOC499576similar to phosphoglycerate kinase 12103345400103347198Rat
1594609LOC691870hypothetical protein LOC6918702229045068229045438Rat
1591779LOC680421similar to 60S ribosomal protein L132104267277104267940Rat
1595052LOC685396hypothetical protein LOC6853962189963603189977127Rat
1595053LOC685395hypothetical protein LOC68539528083671480837319Rat
1598096Tceal6transcription elongation factor A (SII)-like 62102369895102371888Rat
1598157LOC679913similar to Chromobox protein homolog 3 (Heterochromatin protein 1 homolog gamma) (HP1 gamma) (Modifier 2 protein) (HECH)29793788497938425Rat
1598348LOC295194similar to SUMO/sentrin specific protease 22193837023193838863Rat
1598349LOC295184hypothetical LOC2951842193200026193201367Rat
1598350LOC295168hypothetical LOC2951682185260853185263557Rat
1598353LOC295122similar to G protein-binding protein CRFG2169231832169233827Rat
1598354LOC295112similar to heat shock protein 82107917502107919525Rat
1595934Vom1r55vomeronasal 1 receptor 552168259640168260536Rat
1595063S100a14S100 calcium binding protein A142189913433189919947Rat
1597731Atp8b2ATPase phospholipid transporting 8B22189285961189306947Rat
1596307LOC686596similar to aquaporin 102189309151189314092Rat
1599277Ca14carbonic anhydrase 142198010142198017635Rat
1599278Oaz3ornithine decarboxylase antizyme 32195675925195678859Rat
1597905LOC682571similar to spindlin2109317280109321345Rat
1626029LOC691049hypothetical protein LOC6910492155343176155343718Rat
1625999Vom2r-ps74vomeronasal 2 receptor, pseudogene 742155492036155492928Rat
2303311Riiad1regulatory subunit of type II PKA R-subunit domain containing 12195703259195712479Rat
2319721Lce6alate cornified envelope 6A2192811593192813142Rat
2319734LOC100361638hypothetical LOC10036163829207814692082457Rat
2319742LOC100361630hypothetical LOC1003616302200333391200339103Rat
2319129Lce3elate cornified envelope 3E2193275472193276006Rat
2319887Ttc24tetratricopeptide repeat domain 242187426432187438482Rat
2319935LOC100361532hypothetical LOC1003615322186922821186924115Rat
2318707LOC100362177DnaJ (Hsp40) homolog, subfamily B, member 6-like2204463835204495700Rat
2318708LOC100362176hypothetical protein LOC1003621762165486809165489356Rat
2319318Lce3dlate cornified envelope 3D2193248807193249881Rat
2318158LOC100362430FUS interacting protein (serine-arginine rich) 1-like2151632662151633167Rat
2319355LOC100361820putative ARM-1 protein-like2139322209139323853Rat
2318290LOC100362397ubiquitin-conjugating enzyme E2L 3-like27821294278213944Rat
2318910LOC100362072hypothetical LOC1003620722142921192142921726Rat
2319479LOC100361795von Hippel-Lindau binding protein 1-like29318528693185797Rat
2318933LOC100362048DC2 protein2189827360189835482Rat
2319549LOC100361725rCG57360-like2139148461139149301Rat
2318370LOC100362315Uncharacterized protein C12orf32 homolog2199263118199264236Rat
2318371LOC100362314choline phosphate cytidylyltransferase 1 alpha-like2190473354190475030Rat
2319570LOC100361704eukaryotic translation initiation factor 1A, Y-linked29293246592933590Rat
2320329LOC100361336hypothetical LOC1003613362233203981233205275Rat
2320351Prr9proline rich 92192025457192036073Rat
2320352LOC100361313rCG49992-like2148597526148597982Rat
2322046LOC100363910hypothetical LOC1003639102148086654148087280Rat
2321312LOC100360846proteasome subunit beta type 6-like29603196796033538Rat
2323412LOC100363228hypothetical LOC1003632282208554849208562862Rat
2322139Rusc1RUN and SH3 domain containing 12188394114188403391Rat
2322140LOC100360416hypothetical LOC1003604162127106622127108221Rat
2322827LOC100363520mCG16729-like2196587056196590834Rat
2322842LOC100363505hypothetical LOC10036350529631446296315268Rat
2320718LOC100361143ribosomal protein L30-like2102919226102919567Rat
2321483LOC100360775BCL2/adenovirus E1B interacting protein 32182326041182332156Rat
2321484LOC100360774signal-regulatory protein alpha-like27695503876962306Rat
2321502LOC100360756EWSR1/NFATC2 fusion protein-like2136163785136182753Rat
2322874LOC100360072succinate dehydrogenase-like2104594113104594698Rat
2322903LOC100360042ARP3 actin-related protein 3 homolog (yeast)-like28218230282183522Rat
2322273LOC100360380zinc finger protein 457-like28688080686922446Rat
2322289LOC100360364hypothetical LOC1003603642106934819106936005Rat
2320742LOC100361118hypothetical LOC10036111828831419888324356Rat
2321536Sirpdsignal-regulatory protein delta27669410776941002Rat
2321558LOC100360700hypothetical LOC1003607002112013796112033122Rat
2322330LOC100360323hypothetical LOC1003603232227995109227995875Rat
2322332Rxfp4relaxin family peptide/INSL5 receptor 42188026531188027685Rat
2320792Rprd2regulation of nuclear pre-mRNA domain containing 22197882666197937844Rat
2322995LOC100363450hypothetical LOC1003634502226412098226413744Rat
2322996LOC100363449RAF domain and POZ/BTB containing protein T2-like2194499751194505759Rat
2320862LOC10036109828S ribosomal protein L42, mitochondrial-like2100955014100955815Rat
2321697LOC100360660chromosome 13 open reading frame 1-like2134289954134290501Rat
2321698LOC100360659PARK2 co-regulated-like2137911688137912510Rat
2323099Hmox2-ps1heme oxygenase (decycling) 2, pseudogene 12215370196215372406Rat
2323100Zfp267zinc finger protein 2672122855036122873696Rat
2323101LOC100359944hypothetical LOC1003599442175414789175444100Rat
2322487LOC100360264tripartite motif-containing 59-like2180315808180316494Rat
2323147LOC100363397hypothetical LOC1003633972163440379163441210Rat
2322521LOC100360229hypothetical LOC1003602292198591363198591751Rat
2322522LOC100360228hypothetical LOC10036022828481804084819425Rat
2322538LOC100360212hypothetical LOC1003602122194717200194718294Rat
2323165Prdx1l1peroxiredoxin 1-like 12208738117208738952Rat
2323182Zfp687zinc finger protein 6872196172266196180946Rat
2323202Lrriq4leucine-rich repeats and IQ motif containing 42116347125116372930Rat
2323281LOC100359862hypothetical LOC1003598622198452914198453352Rat
2321145Fbxw7F-box and WD repeat domain containing 72184230191184309805Rat
2321897LOC100360560rCG41410-like2127530326127531489Rat
2321898LOC100360559ras-related nuclear protein-like2137080504137082285Rat
2323372LOC100363268rCG31129-like2195940655195941140Rat
2320491Ankub1ankyrin repeat and ubiquitin domain containing 12147783762147819863Rat
2323451LOC100359789hypothetical LOC1003597892122019319122020986Rat
4888540Mir2985microRNA 29852179591312179591421Rat
2323618LOC100359576multifunctional protein ADE2-like2100096289100099785Rat
2324347LOC100362611Uncharacterized protein C8orf59 homolog2205959642205959943Rat
2324348LOC100362610CG5323-like2193070301193078938Rat
2323670LOC100359524arginine/serine-rich coiled-coil 22120049729120051050Rat
2324500OtulinOTU deubiquitinase with linear linkage specificity28026772480293204Rat
2323877LOC100359416small nuclear ribonucleoprotein polypeptide C-like2215671350215671826Rat
2323879LOC100359414NSA2 ribosome biogenesis homolog2166487073166488184Rat
2325355Mir551bmicroRNA 551b2116867647116867744Rat
2323921LOC100362858hypothetical LOC10036285828531483985315170Rat
2323965LOC100362813tetratricopeptide repeat domain 112154058118154070323Rat
2325488Mir92bmicroRNA 92b2188541034188541116Rat
2325489Mir760microRNA 7602225873354225873433Rat
2325504Mir190bmicroRNA 190b2189421137189421214Rat
2325570Mir137microRNA 1372221658106221658207Rat
2325576Mir124-2microRNA 124-22102311603102311711Rat
2325603Mir9-1microRNA 9-12187582799187582887Rat
2324122LOC100362736glutaredoxin-like2161018890161020099Rat
4888599Mir3597-1microRNA 3597-12187582790187582897Rat
4888563Mir3541microRNA 35412188487004188487107Rat
2324712Tmigd3transmembrane and immunoglobulin domain containing 32208478373208557356Rat
2324725LOC100363165thioredoxin-like 429255966692559872Rat
2324777C2cd4dC2 calcium-dependent domain containing 4D2195599706195604730Rat
2324778LOC100363110thioredoxin-like 429056943390994443Rat
2324614Sptssbserine palmitoyltransferase, small subunit B2166654036166682325Rat
2324841LOC100363048rCG47273-like2177654521177654799Rat
6489815LOC100911952ubiquitin-conjugating enzyme E2 variant 1-like2128850346128851138Rat
6488232LOC100912172thioredoxin-like protein 4A-like2156343221156343611Rat
6488544LOC10091211140S ribosomal protein S19-like28234065082341155Rat
6489178LOC100911992uncharacterized LOC1009119922187573857187596346Rat
6488659LOC10091213360S ribosomal protein L7a-like2198202412198203187Rat
6488716LOC100912139thioredoxin-like protein 4A-like2156338015156339388Rat
6489504LOC10091203340S ribosomal protein S21-like2129513158129513373Rat
6489583LOC100911982late cornified envelope protein 3C-like2193286148193287221Rat
6485043LOC100912995zinc finger protein 733-like28658575586588902Rat
6488949LOC100912064prohibitin-like2129924665129925515Rat
6485085LOC100913005zinc finger protein 99-like28661557686902946Rat
6486316LOC100912576heterogeneous nuclear ribonucleoprotein F-like2134737869134748340Rat
6486316LOC100912576heterogeneous nuclear ribonucleoprotein F-like2133961474133982862Rat
6494071LOC100911298heterogeneous nuclear ribonucleoprotein M-like27828131778283487Rat
6494152LOC10091119160 kDa heat shock protein, mitochondrial-like2152514551152516372Rat
6495134LOC1009111163 beta-hydroxysteroid dehydrogenase type 5-like2200616215200633379Rat
6486969LOC100912440N-alpha-acetyltransferase 11-like2156343610156345521Rat
6493533LOC100911347protein ADORA3, isoform 3-like2208323728208399716Rat
6492943LOC100911493mediator of RNA polymerase II transcription subunit 14-like2105404820105422454Rat
6485762LOC10091275660S ribosomal protein L31-like2209637845209676732Rat
6494692LOC100911153TD and POZ domain-containing protein 2-like2194319036194325542Rat
6494695LOC1009111543 beta-hydroxysteroid dehydrogenase/Delta 5-->4-isomerase type 4-like2200712893200722448Rat
6491091LOC100911796adenosine receptor A3-like2208492231208536910Rat
6491125LOC100911679TD and POZ domain-containing protein 2-like2194084048194085124Rat
6491220LOC100911693eukaryotic translation initiation factor 4 gamma 1-like2105856110105866784Rat
6493160LOC10091138714-3-3 protein theta-like2191947071191950835Rat
6487716LOC100912312uncharacterized LOC1009123122209095615209100185Rat
6487821LOC100912338histone H2B type 2-B-like2198418625198419131Rat
6491483LOC100911617protein arginine N-methyltransferase 6-like2213173403213180727Rat
6490274LOC100911902cellular retinoic acid-binding protein 2-like2187321661187326794Rat
6490378LOC100911916methylglutaconyl-CoA hydratase, mitochondrial-like2214083558214085136Rat
6491656LOC100911650TD and POZ domain-containing protein 1-like2195152167195153485Rat
6498725LOC100910449aldose reductase-related protein 2-like2172662771172676468Rat
6501779LOC100909772glyceraldehyde-3-phosphate dehydrogenase-like2157687800157688141Rat
6501927LOC100909721cyclin-dependent kinase 1-like2113481799113487416Rat
6495511LOC100910956protein kinase C-binding protein 1-like2150871607150872797Rat
6495614LOC10091097660S ribosomal protein L24-like2116020955116025202Rat
6495798LOC100910892UPF0368 protein Cxorf26 homolog2234629278234634286Rat
6499243LOC100910294olfactory receptor 8D1-like2115303322115304251Rat
6502425LOC100909688zinc finger protein 43-like28646872686559141Rat
6496250LOC100910852uncharacterized LOC10091085229045948590582294Rat
6496250LOC100910852uncharacterized LOC10091085229021121490251921Rat
6499495LOC100910227olfactory receptor 149-like2115290243115291178Rat
6499628LOC100910260olfactory receptor 8D1-like2115296011115296937Rat
6502911LOC100909539uncharacterized LOC10090953928537414285377163Rat
6499659LOC100910149uncharacterized LOC1009101492184817632184818507Rat
6499729LOC100910162olfactory receptor 8D1-like2115238435115239364Rat
6499766LOC100910178pro-epidermal growth factor-like26882060568895943Rat
6496535LOC100910774uncharacterized LOC10091077428984295089844052Rat
6499944LOC100910199olfactory receptor 146-like2115272156115273088Rat
6499955LOC100910086olfactory receptor 149-like2115225356115226291Rat
6500144LOC100910112phosphoglycerate kinase 1-like2103184835103186633Rat
6500205LOC100910128olfactory receptor 8D1-like2115231124115232050Rat
6500254S100a2S100 calcium binding protein A22189981650189985109Rat
6497111LOC100910737uncharacterized LOC1009107372192459490192459660Rat
6497192Dnttip2deoxynucleotidyltransferase, terminal, interacting protein 22225854618225867103Rat
6500436LOC100910051olfactory receptor 146-like2115207270115208202Rat
6503563LOC100909434protocadherin-16-like2182796272182799981Rat
6503572LOC10090943360S ribosomal protein L12-like2147710501147711217Rat
6497472LOC100910674zinc finger CCCH domain-containing protein 11A-like2194709804194712728Rat
6500561LOC100910078spindlin-2-like2158997695159175419Rat
6500570LOC100909968olfactory receptor 8D1-like2115158504115159430Rat
6503741LOC100909470fragile X mental retardation syndrome-related protein 1-like2122174149122174778Rat
6504224LOC100909397PRAME family member 17-like2121878619121898611Rat
6497622LOC100910586proteasome subunit beta type-7-like2234108398234109337Rat
6497753LOC100910626ras-related protein Rab-5C-like2103750638103751377Rat
6500885LOC100909910non-POU domain-containing octamer-binding protein-like2148085166148087741Rat
6576126Trnak-cuutransfer RNA lysine (anticodon CUU)2198636994198637066Rat
6576126Trnak-cuutransfer RNA lysine (anticodon CUU)2198630130198630202Rat
6576126Trnak-cuutransfer RNA lysine (anticodon CUU)2198567936198568008Rat
6576126Trnak-cuutransfer RNA lysine (anticodon CUU)2141888434141888506Rat
6497939LOC100910544proteasome subunit beta type-7-like2234103413234104352Rat
6498023LOC100910566solute carrier family 7 member 13-like28866835988669438Rat
6501036LOC100909949N-lysine methyltransferase SETD8-like2148262128148264689Rat
6501293LOC100909879tyrosine-protein phosphatase non-receptor type substrate 1-like28741842587419918Rat
6501432LOC100909896ras-related protein Rap-1A-like2115055917115056823Rat
6501578LOC100909792vomeronasal type-1 receptor 2-like2168228046168229055Rat
7528166LOC102549888rho GTPase-activating protein 20-like2137147947137157012Rat
7498945LOC102552298uncharacterized LOC1025522982184000972184002940Rat
7515013LOC102555118uncharacterized LOC1025551182112717809112728526Rat
7515371LOC102552578succinate dehydrogenase [ubiquinone] cytochrome b small subunit, mitochondrial-like2198716518198717957Rat
7521532LOC102549889uncharacterized LOC1025498892143638479143642590Rat
7523289LOC102547647uncharacterized LOC1025476472115928629115929281Rat
7523639LOC102554929uncharacterized LOC10255492927599649976004872Rat
7525014LOC102555872uncharacterized LOC1025558722132555048132557483Rat
7525227LOC102550297uncharacterized LOC1025502972210749469210752352Rat
7525273LOC102550864uncharacterized LOC1025508642183488993183497671Rat
7488974Mir16microRNA 162165606072165606166Rat
7525762LOC102549474uncharacterized LOC1025494742105393742105398616Rat
7488977Mir15bmicroRNA 15b2165605923165606020Rat
7527473LOC102550512small proline-rich protein 2D-like2192538885192539473Rat
7541014LOC102553446uncharacterized LOC1025534462214429790214431115Rat
7504645LOC102547575uncharacterized LOC1025475752207021285207026884Rat
7488973Mir6314microRNA 63142211682675211682813Rat
7505893LOC102553058late cornified envelope-like proline-rich protein 1-like2192268841192270799Rat
7505957LOC102553625uncharacterized LOC10255362526963236169726367Rat
7502014LOC102555481chitinase-3-like protein 3-like2208942745208944715Rat
7528988Lelp1late cornified envelope-like proline-rich 12192035927192037885Rat
7507131LOC102556687uncharacterized LOC10255668729434777294372089Rat
7507353LOC102547680ribosome biogenesis protein NSA2 homolog2146046260146047108Rat
7507361LOC102548099NEDD8-activating enzyme E1 catalytic subunit-like2166061467166064180Rat
7497089LOC102547265uncharacterized LOC1025472652206216373206222179Rat
7530586LOC102551810uncharacterized LOC10255181028286282782882446Rat
7531036LOC102555139uncharacterized LOC1025551392157764465157765082Rat
7509898LOC102550104uncharacterized LOC1025501042137625006137640643Rat
7510030LOC10254676760S ribosomal protein L29-like2124290881124291413Rat
7510660LOC102553838ribosome biogenesis protein NSA2 homolog2128532054128533430Rat
7510695LOC102554691uncharacterized LOC1025546912192114886192116009Rat
7532496LOC102552128late cornified envelope protein 1C-like2193007315193008931Rat
7511798LOC102553273N-alpha-acetyltransferase 11-like29255889792559665Rat
7534134LOC102550255uncharacterized LOC1025502552234780420234796820Rat
7534470LOC102548481peptidyl-prolyl cis-trans isomerase D-like2104472196104475893Rat
7512582LOC102550802ubiquitin-60S ribosomal protein L40-like2197157822197159271Rat
7512608LOC102549579uncharacterized LOC1025495792136870873136992247Rat
7513228LOC102554364ubiquitin-conjugating enzyme E2 variant 1-like2128856384128857198Rat
7513587LOC102555512TD and POZ domain-containing protein 4-like2195294047195294684Rat
7496120LOC102550257small proline-rich protein 2H-like2192615139192616498Rat
7503655LOC102556166surfeit locus protein 6-like2122862265122864624Rat
7503841LOC102549355uncharacterized LOC1025493552206746714206778676Rat
7516215LOC102555991uncharacterized LOC1025559912132577540132718088Rat
7516893LOC102553773uncharacterized LOC1025537732128380569128386369Rat
7537942LOC102546934uncharacterized LOC10254693429500307095010185Rat
7538134LOC102549153uncharacterized LOC1025491532119553217119627543Rat
7538180LOC102551187uncharacterized LOC1025511872107252394107254871Rat
7517624LOC102552833uncharacterized LOC1025528332139951755139959315Rat
7539988LOC102554758uncharacterized LOC1025547582202794523202795717Rat
7646363LOC102547749high mobility group protein B1-like2186398470186399544Rat
7662046LOC102548354TD and POZ domain-containing protein 4-like2195073927195075186Rat
7612486LOC102552432uncharacterized LOC1025524322184110909184144557Rat
7631535LOC102549317H/ACA ribonucleoprotein complex subunit 2-like2142677682142678808Rat
7631924LOC102553085uncharacterized LOC1025530852122641859122650375Rat
7646821LOC102555509uncharacterized LOC1025555092113468086113473658Rat
7662935LOC102553734uncharacterized LOC10255373426976306569809916Rat
7663005LOC102554656uncharacterized LOC1025546562225257792225266371Rat
7663391LOC102547111uncharacterized LOC1025471112142079409142164866Rat
7663730LOC102546391uncharacterized LOC1025463912154030401154033265Rat
7613089LOC102550890small proline-rich protein 2D-like2192381119192382478Rat
7647914LOC102551839uncharacterized LOC1025518392165564042165564873Rat
7664166LOC102552778uncharacterized LOC1025527782145221431145223982Rat
7614516LOC102556854uncharacterized LOC1025568542178621336178626251Rat
7649571LOC102549541uncharacterized LOC1025495412204039350204048426Rat
7649644LOC10255400240S ribosomal protein S2-like2178346532178348036Rat
7621135LOC102546663tyrosine-protein phosphatase non-receptor type substrate 1-like27727777577286844Rat
7666268LOC102555937uncharacterized LOC1025559372132583138132654268Rat
7621937LOC102549793uncharacterized LOC1025497932204962632204982254Rat
7651650LOC102554278uncharacterized LOC1025542782157254284157319194Rat
7652577LOC102555026uncharacterized LOC1025550262157700635157703906Rat
7559659Sprr2dsmall proline-rich protein 2D2192480676192481990Rat
7559921LOC102547484uncharacterized LOC1025474842172796805172801793Rat
7653266LOC102551030uncharacterized LOC1025510302183798012183805444Rat
7653667LOC102552233uncharacterized LOC1025522332183982024184000661Rat
7574969LOC102553341uncharacterized LOC1025533412208586954208594719Rat
7623948LOC102549721uncharacterized LOC1025497212143311741143357703Rat
7624666LOC102552326late cornified envelope protein 5A-like2192959220192961921Rat
7654558Sprr2fsmall proline rich protein 2F2192604978192605208Rat
7639661LOC102549046uncharacterized LOC1025490462221230413221244382Rat
7655727LOC102554147uncharacterized LOC10255414727302672573031439Rat
7587027LOC102547750uncharacterized LOC1025477502207141488207165121Rat
7656055LOC102555566uncharacterized LOC1025555662113592263113598593Rat
7641108LOC102554180ubiquitin-conjugating enzyme E2 variant 1-like2128843709128846527Rat
7656864LOC102555173uncharacterized LOC1025551732225979212225984199Rat
7657283LOC102546358uncharacterized LOC1025463582232592047232719204Rat
7594971LOC102547324eukaryotic translation elongation factor 1 epsilon-1-like2196658283196659895Rat
7594981LOC102546356uncharacterized LOC1025463562186973941186979695Rat
7595026LOC102553378uncharacterized LOC10255337828361228883613687Rat
7595603LOC102556705uncharacterized LOC1025567052225801080225803653Rat
7627512LOC102556203uncharacterized LOC1025562032114567828114569535Rat
7628168LOC102550046uncharacterized LOC1025500462199435376199451573Rat
7628240LOC10255397260S ribosomal protein L21-like2169041050169055653Rat
7642297LOC102550446rho GTPase-activating protein 20-like2137363124137405118Rat
7658407LOC102547113uncharacterized LOC1025471132187564786187570731Rat
7608682LOC102547718uncharacterized LOC1025477182115929806115931551Rat
7628277LOC102556029keratin, type II cytoskeletal 8-like2173771800173772597Rat
7659008LOC102556113uncharacterized LOC1025561132181974182181979858Rat
7659767LOC102548697uncharacterized LOC10254869729149607591509908Rat
7630239LOC102552651small proline-rich protein 2H-like2192462489192463827Rat
7611669LOC102551095uncharacterized LOC1025510952183808108183811378Rat
7615983LOC102553245NEDD4-like E3 ubiquitin-protein ligase WWP1-like2214343426214345385Rat
7616575LOC102554756Y-linked testis-specific protein 1-like2153074599153076378Rat
7616854LOC102549945uncharacterized LOC1025499452143736055143740571Rat
7593080LOC102554693uncharacterized LOC1025546932202825327202845586Rat
7593757LOC102550635uncharacterized LOC1025506352183230577183249162Rat
7617897LOC10254925460S ribosomal protein L35a-like2206579750206580131Rat
7590540LOC102551358uncharacterized LOC1025513582108748894108752296Rat
7596073LOC102555028uncharacterized LOC1025550282225812756225827048Rat
7619002LOC102549693uncharacterized LOC1025496932204847561204880202Rat
7619243LOC102548510uncharacterized LOC1025485102219693728219713439Rat
7572182LOC102546772uncharacterized LOC1025467722233622237233643504Rat
7591929LOC102555909uncharacterized LOC1025559092181874329181900539Rat
7572896LOC102556487uncharacterized LOC1025564872232633262232636136Rat
7573183LOC102550122uncharacterized LOC1025501222210643308210646368Rat
7543964LOC102555065thioredoxin-like protein 4A-like2172529917172530835Rat
7597556LOC102549015uncharacterized LOC1025490152118282723118289007Rat
7556623LOC102552069uncharacterized LOC1025520692122520921122529437Rat
7573616LOC102550593uncharacterized LOC1025505932127245777127293781Rat
7574026LOC102548297uncharacterized LOC1025482972207581064207597156Rat
7544216LOC102546353uncharacterized LOC10254635329384452893848324Rat
7544419LOC102552358uncharacterized LOC1025523582184074396184079851Rat
7544661LOC102547815uncharacterized LOC1025478152116162054116167061Rat
7544750LOC102551838uncharacterized LOC1025518382122291354122299600Rat
7544832LOC102555268uncharacterized LOC1025552682209054717209082897Rat
7556978LOC102555205uncharacterized LOC1025552052112744241112749202Rat
7574575LOC102553016uncharacterized LOC1025530162201387188201388475Rat
7560306LOC102547393uncharacterized LOC1025473932211577034211584923Rat
7578185LOC102547523uncharacterized LOC1025475232197756413197759190Rat
7561027LOC102553210uncharacterized LOC10255321029335296693362431Rat
7562763LOC102547151uncharacterized LOC1025471512153379326153388347Rat
7580306LOC102552799thioredoxin-like protein 4A-like2157088072157088284Rat
7548606LOC102554443uncharacterized LOC1025544432128956872128965184Rat
7602244LOC102548700uncharacterized LOC1025487002220599130220612638Rat
7602661LOC102550295uncharacterized LOC10255029529717718097200728Rat
7602709LOC102554113uncharacterized LOC1025541132128834060128835125Rat
7581938LOC102552324uncharacterized LOC1025523242144796935144809582Rat
7603843LOC102551226uncharacterized LOC10255122628172254081739144Rat
7550261LOC102551815guanine nucleotide-binding protein G(I)/G(S)/G(T) subunit beta-1-like2157009673157012505Rat
7564391LOC102548546zinc finger protein 709-like28708546187092882Rat
7551138LOC102550192uncharacterized LOC1025501922210756627210758706Rat
7551151LOC102555482uncharacterized LOC1025554822225301381225310534Rat
7606083LOC102546891uncharacterized LOC1025468912206143287206152322Rat
7606094LOC102546729uncharacterized LOC10254672929431142694316348Rat
7566142LOC102547648uncharacterized LOC1025476482213222930213238894Rat
7552351LOC102549654uncharacterized LOC1025496542199420157199431316Rat
7552390LOC102555450uncharacterized LOC1025554502112982322112983704Rat
7552769LOC102552193uncharacterized LOC1025521932115394494115413345Rat
7567274LOC102548358uncharacterized LOC1025483582218726202218730361Rat
7553439LOC102548417uncharacterized LOC1025484172207769244207783269Rat
7553727LOC102549944uncharacterized LOC1025499442125067026125086092Rat
7553768LOC102552503uncharacterized LOC1025525032139674968139685768Rat
7608249LOC102546847uncharacterized LOC1025468472141818785141832266Rat
7586473LOC102547006uncharacterized LOC1025470062164184320164186665Rat
7554840LOC102553474tubulin alpha-1C chain-like2199174087199174891Rat
7690861LOC102550598small proline-rich protein 2I-like2192520019192521188Rat
7690977LOC102555656uncharacterized LOC1025556562132280407132336676Rat
7691289LOC102551936late cornified envelope protein 1C-like2193083594193085303Rat
7736144LOC102551458uncharacterized LOC1025514582150232235150242240Rat
7736595LOC102556766glyceraldehyde-3-phosphate dehydrogenase-like2225907331225908092Rat
7751664LOC102552542small proline-rich protein 2D-like2192553266192554307Rat
7752279LOC102552912uncharacterized LOC1025529122140123519140138593Rat
7673112LOC102546437uncharacterized LOC10254643729400283894044098Rat
7678070LOC102553736uncharacterized LOC10255373628453140384534742Rat
7708651LOC102547008uncharacterized LOC1025470082196160697196161673Rat
7723395LOC102554967uncharacterized LOC1025549672157689520157729296Rat
7724888LOC102547227uncharacterized LOC1025472272174426558174453469Rat
7725390LOC102548736uncharacterized LOC1025487362118377528118393104Rat
7725447LOC102554786uncharacterized LOC1025547862225277182225293305Rat
7688731LOC102557194uncharacterized LOC1025571942209936714209957443Rat
7689133LOC102553943uncharacterized LOC1025539432224297119224363296Rat
7726710LOC102552834uncharacterized LOC1025528342145137593145146515Rat
7690111LOC102550637uncharacterized LOC1025506372200096732200107006Rat
7690161LOC102552711N-alpha-acetyltransferase 11-like2157088354157090082Rat
7683221LOC102548788developmental pluripotency-associated protein 4-like2198261907198263366Rat
7738003LOC102549828late cornified envelope protein 1E-like2193051404193052020Rat
7738059LOC10255184060S ribosomal protein L17-like2206862074206862647Rat
7713747LOC102551394RING finger protein 175-like2182806670182829114Rat
7713810LOC102553665uncharacterized LOC1025536652199226531199255349Rat
7733168LOC102546477uncharacterized LOC1025464772119057359119059085Rat
7733551LOC102552940small proline-rich protein 2H-like2192305205192306554Rat
7738496LOC102551935uncharacterized LOC1025519352122313349122319987Rat
7715390LOC102551157uncharacterized LOC1025511572189637655189654588Rat
7740121LOC102554341protein S100-A9-like2191741476191744132Rat
7740519LOC102551357uncharacterized LOC10255135728200026582030519Rat
7667287LOC102552646uncharacterized LOC1025526462139708637139715452Rat
7667351LOC102546311histone H3.3-like27827345178275631Rat
7667725LOC102554526heterogeneous nuclear ribonucleoprotein A3-like27409123674092283Rat
7696554LOC102550012uncharacterized LOC1025500122196553903196568142Rat
7716615LOC102553057uncharacterized LOC1025530572177434092177489610Rat
7716881LOC10254742340S ribosomal protein S27-like2197692354197693143Rat
7718047LOC102548573uncharacterized LOC1025485732220411466220413049Rat
7699151LOC102549582uncharacterized LOC1025495822154921630155308940Rat
7699193LOC102549180uncharacterized LOC1025491802221737498221756720Rat
7671171LOC102556330uncharacterized LOC1025563302182711753182713253Rat
7744866LOC102548639uncharacterized LOC1025486392220527216220533296Rat
7700278LOC102554277dedicator of cytokinesis protein 2-like2152708216152709498Rat
7720574LOC102556590uncharacterized LOC1025565902188068084188073599Rat
7720583LOC102556390uncharacterized LOC1025563902195692935195696260Rat
7671897LOC102553574uncharacterized LOC10255357428423991884242373Rat
7672274LOC102550696uncharacterized LOC10255069629766292897680496Rat
7746019LOC102552980farnesyl pyrophosphate synthase-like2184459569184461385Rat
7746293LOC102547038uncharacterized LOC1025470382141812335141829861Rat
7673957LOC102550634uncharacterized LOC1025506342155592718155601621Rat
7674945LOC102550474uncharacterized LOC1025504742227074805227095400Rat
7747030LOC102550325uncharacterized LOC1025503252188600577188601934Rat
7702535LOC102550008uncharacterized LOC1025500082164720483164731075Rat
7722057LOC102550575uncharacterized LOC1025505752199859304199868300Rat
7722217LOC102554994protein NYNRIN-like2128775663128779741Rat
7675313LOC102549890spindlin-1-like2155282027155283228Rat
7675361LOC102550011uncharacterized LOC1025500112188510207188511498Rat
7675821LOC102547682uncharacterized LOC1025476822207047407207056399Rat
7703555LOC102547004uncharacterized LOC1025470042124511346124537204Rat
7709305LOC102547848uncharacterized LOC1025478482147445138147450563Rat
7709661LOC102548822uncharacterized LOC1025488222208271991208288376Rat
7728955LOC102548357uncharacterized LOC1025483572207577552207611691Rat
7729355LOC10254807260S ribosomal protein L5-like2216510334216513292Rat
7681417LOC102553875transcriptional regulator ATRX-like2168818716168819913Rat
7710894LOC102550702small integral membrane protein 15-like2200119732200121586Rat
7711567LOC102553503TD and POZ domain-containing protein 3-like2194788488194791853Rat
9087173LOC103691570uncharacterized LOC1036915702155088886155098048Rat
9087741LOC103691485uncharacterized LOC10369148527044576070453754Rat
9087750LOC103691526uncharacterized LOC1036915262120340269120367845Rat
9089372LOC103691600uncharacterized LOC1036916002184441483184449402Rat
9131465LOC103691615Fc receptor-like protein 22186792420186794113Rat
9132743LOC103691522telomeric repeat-binding factor 2-like2114565719114566600Rat
9092849LOC103691525uncharacterized LOC1036915252118885059118885881Rat
9092856LOC103691580uncharacterized LOC1036915802157046932157052184Rat
9131464LOC103691605glyceraldehyde-3-phosphate dehydrogenase pseudogene2175573357175574572Rat
9134989LOC10369170260S ribosomal protein L29-like2221571856221572312Rat
9135513LOC103691577uncharacterized LOC1036915772156534494156536913Rat
9136213LOC10369162360S ribosomal protein L35a pseudogene2190029912190030266Rat
9212549LOC103691513uncharacterized LOC1036915132102305885102311282Rat
9213283LOC103691581ATP synthase-coupling factor 6, mitochondrial pseudogene2161515064161515431Rat
9172612LOC103691622uncharacterized LOC1036916222189861915189863287Rat
9174059LOC103691545keratin-associated protein 10-11-like2120422568120440856Rat
9137798LOC103691690uncharacterized LOC1036916902228544102228569039Rat
9098830LOC103691546basic proline-rich protein-like2127842970127856012Rat
9176013LOC103691504uncharacterized LOC10369150429062185790638028Rat
9139953LOC103691687uncharacterized LOC1036916872227381185227382094Rat
9101027LOC10369156360S ribosomal protein L31 pseudogene2138489364138489758Rat
9101468LOC103691688uncharacterized LOC1036916882227718789227721052Rat
9102738LOC103691568uncharacterized LOC1036915682152919641152939819Rat
9141577LOC103691596peflin pseudogene2183067302183069004Rat
9142237LOC103691660uncharacterized LOC1036916602207189120207192797Rat
9075725LOC103691658uncharacterized LOC1036916582206871789206898406Rat
9178193LOC103691680uncharacterized LOC1036916802220560421220566089Rat
9178472LOC103691656uncharacterized LOC1036916562206422509206429010Rat
9081782LOC103691531uncharacterized LOC1036915312124629217124637033Rat
9148085LOC103691502U1 small nuclear ribonucleoprotein C pseudogene28903562889037495Rat
9149530LOC103691613uncharacterized LOC1036916132185482702185515388Rat
9103824LOC103691523uncharacterized LOC1036915232116942260116961183Rat
9185104LOC103691500uncharacterized LOC10369150028078324480792403Rat
9185105LOC103691575uncharacterized LOC1036915752156362298156379729Rat
9186314LOC103691679uncharacterized LOC1036916792218566209218579637Rat
9152455LOC103691631uncharacterized LOC1036916312193120022193121741Rat
9153539LOC103691542la-related protein 1B-like2127878696127881293Rat
9106577LOC103691686uncharacterized LOC1036916862225234926225244427Rat
9187168LOC103691597uncharacterized LOC1036915972183493313183497671Rat
9154798LOC103691697NADH dehydrogenase [ubiquinone] 1 beta subcomplex subunit 3 pseudogene2232033117232033600Rat
9156217LOC103691584uncharacterized LOC1036915842165652468165687197Rat
9111671LOC103691643uncharacterized LOC1036916432198016128198031613Rat
9191309LOC103691624uncharacterized LOC1036916242192078778192080632Rat
9191676LOC103691547histone H3-like2130844831130845223Rat
9158000LOC103691561activated RNA polymerase II transcriptional coactivator p15 pseudogene2149741315149741841Rat
9158335LOC103691501zinc finger protein 345-like28592692886463583Rat
9112018LOC103691537uncharacterized LOC1036915372128401640128410475Rat
9112695LOC103691592uncharacterized LOC1036915922177994418177997399Rat
9160266LOC103691633gamma-gliadin-like2186794518186794892Rat
9160273LOC103691685uncharacterized LOC1036916852224969927224971085Rat
9117034LOC103691562radixin-like2134827663134854382Rat
9162749LOC103691653complex III assembly factor LYRM7-like2205502456205505973Rat
9168487LOC103691662uncharacterized LOC1036916622207871551207877323Rat
9121826LOC103691599uncharacterized LOC1036915992184502249184519377Rat
9202401LOC103691527uncharacterized LOC1036915272121061909121217335Rat
9203311LOC103691618uncharacterized LOC1036916182187750660187752220Rat
9204587LOC103691569uncharacterized LOC1036915692155032759155034914Rat
9204592LOC103691646putative thymosin beta-4-like protein 62199260817199262272Rat
9124566LOC103691617uncharacterized LOC1036916172187654122187657062Rat
9205258LOC103691574uncharacterized LOC1036915742156373097156379605Rat
9074613LOC103691524uncharacterized LOC1036915242118795190118796957Rat
9082324LOC103691499signal-regulatory protein beta-1-like27729973977302572Rat
9082962LOC103691558serine/threonine-protein kinase DCLK1-like2144646161144661705Rat
9126076LOC103691543la-related protein 1B-like2127914666127916237Rat
9128437LOC103691578ubiquitin-like2156755189156758467Rat
9210656LOC103691559uncharacterized LOC1036915592145127494145130929Rat
9083622LOC103691588uncharacterized LOC1036915882173893931173911517Rat
9086576LOC103691528uncharacterized LOC1036915282121345496121390514Rat
9349171LOC103691692uncharacterized LOC1036916922230377742230387868Rat
9349712LOC103691511uncharacterized LOC10369151129345967193495066Rat
9349950LOC103691553uncharacterized LOC1036915532140468950140471333Rat
9216830LOC103691628uncharacterized LOC1036916282192977279192980378Rat
9216837LOC103691635hornerin-like2193634990193637739Rat
9266109LOC103691684uncharacterized LOC1036916842223576500223591850Rat
9269374LOC103691629uncharacterized LOC1036916292193041551193043412Rat
9307829LOC10369153560S ribosomal protein L34 pseudogene2127663009127663675Rat
9222950LOC103691666zinc finger protein 513 pseudogene2209169771209176876Rat
9269847LOC10369511960S ribosomal protein L34 pseudogene2148003771148005500Rat
9271705LOC103691515uncharacterized LOC1036915152104217153104230672Rat
9271714LOC103691583ATP synthase-coupling factor 6, mitochondrial pseudogene2156213942156217266Rat
9311256LOC103691536la-related protein 1B-like2127884724127886528Rat
9311257LOC103691645uncharacterized LOC1036916452198678519198680294Rat
9355797LOC103691641uncharacterized LOC1036916412196590838196593552Rat
9227187LOC103691640uncharacterized LOC1036916402196574557196576568Rat
9272775LOC103691594uncharacterized LOC1036915942178109783178117371Rat
9272784LOC103691626uncharacterized LOC1036916262192342764192344236Rat
9313899LOC103691534myoneurin-like2127529491127529897Rat
9315201LOC103691638TD and POZ domain-containing protein 5-like2195111188195111612Rat
9277088LOC103691665uncharacterized LOC1036916652208635174208652878Rat
9318596LOC103691579uncharacterized LOC1036915792157096159157115301Rat
9318917LOC103691538uncharacterized LOC1036915382128892241128899503Rat
9367825LOC103691554uncharacterized LOC1036915542140952552140954564Rat
9367832LOC10369169660S ribosomal protein L29 pseudogene2232033695232038525Rat
9368178LOC103691552uncharacterized LOC1036915522139944455139945600Rat
9368185LOC103691691uncharacterized LOC1036916912229079041229083376Rat
9232686LOC103691510uncharacterized LOC10369151029275843592764588Rat
9233673LOC103691530THUMP domain-containing protein 1-like2123684846123689222Rat
9277639LOC103691698uncharacterized LOC1036916982232578671232596350Rat
9278625LOC103691620uncharacterized LOC1036916202189139325189148261Rat
9321667LOC103691573uncharacterized LOC1036915732156341171156425863Rat
9383010LOC103691700high mobility group protein B1-like2219582576219583495Rat
9384455LOC103691533uncharacterized LOC1036915332125400460125428494Rat
9384966LOC103691648protein SET-like2202387847202391200Rat
9234840LOC103691560uncharacterized LOC1036915602148805008148809425Rat
9236588LOC103691576uncharacterized LOC1036915762156547601156558830Rat
9323704LOC103691484putative hydrolase RBBP9 pseudogene26946220669464200Rat
9325302LOC103691555uncharacterized LOC1036915552141445106141450847Rat
9325406LOC103691572uncharacterized LOC1036915722156433734156449842Rat
9368208LOC103695131late cornified envelope protein 1C-like2192854127192855581Rat
9376104LOC103691593histone H3.3-like2177934099177935059Rat
9242295LOC103691551uncharacterized LOC1036915512139415342139418396Rat
9242875LOC103691627small proline-rich protein 2E-like2192416570192416935Rat
9242885LOC103691652uncharacterized LOC1036916522204032153204048727Rat
9287828LOC103691647uncharacterized LOC1036916472203092510203099705Rat
9326604LOC103691669uncharacterized LOC1036916692210007084210027032Rat
9328325LOC103690673vomeronasal type-2 receptor 116-like2122106860122118565Rat
9332260LOC103691672uncharacterized LOC1036916722215873635215895580Rat
9245979LOC103695116serine/arginine-rich splicing factor 3 pseudogene2127220857127221392Rat
9246337LOC103691634late cornified envelope protein 1C-like2192952775192953176Rat
9248744LOC103691639cytochrome c, somatic pseudogene2195659192195662001Rat
9291825LOC103690172small proline-rich protein 2I-like2192282800192284159Rat
9334199LOC103691591uncharacterized LOC1036915912178049955178051670Rat
9251158LOC103691517uncharacterized LOC1036915172107055859107058612Rat
9251686LOC103691539uncharacterized LOC1036915392132348181132355303Rat
9292945LOC103689947selenium-binding protein 12195416472195423665Rat
9294064Mfsd14amajor facilitator superfamily domain containing 14A2219661204219697548Rat
9294127LOC103691582uncharacterized LOC1036915822161655215161659385Rat
9337598LOC103691674activated RNA polymerase II transcriptional coactivator p15-like2208356542208363716Rat
9254022LOC103690210carboxy-terminal domain RNA polymerase II polypeptide A small phosphatase 1 pseudogene2205697184205699521Rat
9295729LOC103691637TD and POZ domain-containing protein 1-like2194936495194937171Rat
9296842LOC103691649vegetative cell wall protein gp1-like2203767247203767929Rat
9339724LOC10369164260S ribosomal protein L34 pseudogene2197937363197937853Rat
9256846LOC103691516uncharacterized LOC1036915162105272805105277986Rat
9258539LOC10369167560S ribosomal protein L34 pseudogene2209974574209977060Rat
9343708LOC10369165560S ribosomal protein L36a-like2206348652206349200Rat
9382406LOC103691589uncharacterized LOC1036915892173997202174002922Rat
9261171LOC103690241uncharacterized LOC1036902412177434092177535213Rat
9303217LOC103691520U1 small nuclear ribonucleoprotein C pseudogene2113047448113047879Rat
9303218Rfxapl1regulatory factor X-associated protein-like 12144213414144217637Rat
9303726LOC1036901873 beta-hydroxysteroid dehydrogenase type 5-like2200675665200678742Rat
9304207LOC103691505uncharacterized LOC10369150529060514490615226Rat
9304689LOC103691488uncharacterized LOC10369148827796872877976188Rat
9305039LOC103691619uncharacterized LOC1036916192188624145188626941Rat
9345038LOC103691630uncharacterized LOC1036916302193100473193102134Rat
9372491LOC103691548Golgi apparatus membrane protein TVP23 homolog B pseudogene2132727693132729342Rat
9266108LOC103691514ras-related protein Rab-5C pseudogene2104170380104171271Rat
9346448LOC103691657uncharacterized LOC1036916572206783592206857935Rat
9365434LOC103691612UDP-N-acetylglucosamine transferase subunit ALG13 homolog2185151717185160067Rat
9365443LOC103691689uncharacterized LOC1036916892228497596228508315Rat
9421098LOC103691681uncharacterized LOC1036916812221654140221658069Rat
9421618LOC103691489histone H3.3-like27841767378419853Rat
9424688LOC103691636hornerin-like2193637742193639848Rat
9425810LOC103691701cellular nucleic acid-binding protein pseudogene2231898076231898866Rat
9465124Arl14ADP-ribosylation factor like GTPase 142165835196165836291Rat
9329744LOC103691487uncharacterized LOC10369148727639188176396195Rat
9426501LOC103691512uncharacterized LOC10369151229446693794470068Rat
9467540LOC103691694uncharacterized LOC1036916942231458716231465494Rat
9331231LOC103691704elastin-like2232380028232381985Rat
9389439LOC103691550uncharacterized LOC1036915502139370093139392616Rat
9429209LOC103691486uncharacterized LOC10369148627571237975743591Rat
9430170LOC103691671uncharacterized LOC1036916712211650550211654208Rat
9468847LOC103689940pancreatic alpha-amylase-like2216339154216348215Rat
9470100LOC10369510660S ribosomal protein L34 pseudogene28967366789674975Rat
9390986LOC103691614alpha-enolase pseudogene2185804658185809103Rat
9390987LOC103691621uncharacterized LOC1036916212189334963189336062Rat
9391504LOC103691632uncharacterized LOC1036916322194813538194814103Rat
9431470LOC103691490uncharacterized LOC10369149028069699180712318Rat
9396008LOC103691693uncharacterized LOC1036916932230203234230220134Rat
9436054LOC103691661uncharacterized LOC1036916612207505650207511051Rat
9398746LOC103691595uncharacterized LOC1036915952182944563182955432Rat
9399534LOC103691654uncharacterized LOC1036916542206173223206174118Rat
9437192LOC103695108cytochrome c, somatic pseudogene29510110695102018Rat
9437635LOC103691564uncharacterized LOC1036915642140618308140622961Rat
9438146LOC103691586uncharacterized LOC1036915862170934000170951930Rat
9444651LOC103690087uncharacterized LOC1036900872105272747105309620Rat
9407645LOC103691585uncharacterized LOC1036915852166255893166256826Rat
9445296LOC103691603zinc finger B-box domain-containing protein 1 pseudogene2173489063173490081Rat
9445967LOC103691644uncharacterized LOC1036916442198589569198603260Rat
9447164LOC103691518eukaryotic translation initiation factor 2 subunit 3 pseudogene2101871010101877680Rat
9409902LOC103691668uncharacterized LOC1036916682209769929209779316Rat
9410442LOC103691540uncharacterized LOC1036915402133808909133874895Rat
9452260LOC10369151960S ribosomal protein L9 pseudogene2106702784106703392Rat
9452808LOC103691670uncharacterized LOC1036916702210629453210632786Rat
9452817LOC10369168340S ribosomal protein S25 pseudogene2223249954223250369Rat
9412486LOC103691503RNA-binding Raly-like protein28949087589499635Rat
9412497LOC103691590uncharacterized LOC1036915902177252918177260506Rat
9455317LOC103690206cadherin-18-like27436035974451902Rat
9455736LOC103691602uncharacterized LOC1036916022184418061184425021Rat
11359479LOC108350038uncharacterized LOC1083500382175657100175697647Rat
11456971LOC108350044uncharacterized LOC1083500442181212408181224548Rat
11456980LOC108350057uncharacterized LOC1083500572188136744188138815Rat
11368573LOC108350015uncharacterized LOC1083500152147779124147788998Rat
11361776Trnae-uuc2transfer RNA glutamic acid (anticodon UUC) 22198513155198513226Rat
11370486LOC10835028360S ribosomal protein L7a pseudogene2213604973213605760Rat
11362385Mindy4bMINDY family member 4B2149004738149025388Rat
11362903LOC108350054uncharacterized LOC1083500542186908857186916668Rat
11364131Trnag-ccc2transfer RNA glycine (anticodon CCC) 22198516709198516779Rat
11366183NEWGENE_2324572small proline rich protein 42192697162192699250Rat
11359058LOC10834996760S ribosomal protein L7a pseudogene27813403578138432Rat
11455569LOC108350056uncharacterized LOC1083500562188064847188067079Rat
11356950Trnan-guu2transfer RNA asparagine (anticodon GUU) 22198481043198481116Rat
11367342LOC108350232uncharacterized LOC10835023229632176496325294Rat
11357164LOC10835025360S ribosomal protein L19 pseudogene2159233605159234186Rat
11356765LOC108350041uncharacterized LOC1083500412177334931177344193Rat
11356774LOC10835026760S ribosomal protein L19 pseudogene2164012129164012710Rat
11356258LOC10835000060S ribosomal protein L26 pseudogene2124623209124623707Rat
11449060LOC108350001uncharacterized LOC1083500012126215662126222979Rat
11433414LOC108349989uncharacterized LOC1083499892115580763115664155Rat
11433429LOC108350006uncharacterized LOC1083500062140096877140112800Rat
11433855LOC108350273small proline-rich protein 2D-like2192286861192287231Rat
11443353LOC108350053uncharacterized LOC1083500532186748906186764475Rat
11443600LOC108350075uncharacterized LOC1083500752203458120203461326Rat
11461178LOC10835023760S ribosomal protein L17 pseudogene2113518075113519418Rat
11461439LOC108350248uncharacterized LOC1083502482140004634140006567Rat
11461856LOC10835020760S ribosomal protein L7a pseudogene2223670769223718559Rat
11461857LOC108350212uncharacterized LOC1083502122111498367111511686Rat
11462373LOC10835028460S ribosomal protein L19 pseudogene2218156392218157092Rat
11463101LOC10835018160S ribosomal protein L15 pseudogene2113871819113873432Rat
11463145LOC108350011cytochrome c oxidase assembly protein COX16 homolog, mitochondrial pseudogene2141553348141554004Rat
11463543LOC10835028160S ribosomal protein L21 pseudogene2203528146203528674Rat
11463850LOC108350105uncharacterized LOC1083501052230594927230614434Rat
11464133LOC108349988uncharacterized LOC1083499882106574969106593494Rat
11464142LOC108350172igE-binding protein-like27506221675063246Rat
11465045LOC10835024760S ribosomal protein L35 pseudogene2138489925138490277Rat
11465292LOC108349975uncharacterized LOC10834997528869235788695245Rat
11466902LOC108350079uncharacterized LOC1083500792206749720206761700Rat
11467317Trnag-ucc1transfer RNA glycine (anticodon UCC) 12198631647198631718Rat
11467539Trnay-gua2transfer RNA tyrosine (anticodon GUA) 22104404682104404771Rat
11467540Trnar-ucu3transfer RNA arginine (anticodon UCU) 32225872688225872772Rat
11468839LOC108350288uncharacterized LOC1083502882233532002233542076Rat
11469001LOC108350035uncharacterized LOC1083500352165453764165462443Rat
11469006LOC108350059small proline-rich protein 2B2192147229192148625Rat
11469315LOC108349999glyceraldehyde-3-phosphate dehydrogenase pseudogene2124486733124488852Rat
11470504LOC108350200igE-binding protein-like2191870435191880038Rat
11471039Trnah-gug4transfer RNA histidine (anticodon GUG) 42198595583198595654Rat
11471287LOC108350183glyceraldehyde-3-phosphate dehydrogenase pseudogene2124486223124486737Rat
11473249LOC108349984uncharacterized LOC1083499842104143140104152339Rat
11474771LOC108350028uncharacterized LOC1083500282157071122157175848Rat
11475605LOC108350249endogenous retrovirus group K member 9 Pol protein-like2152621010152621678Rat
11435214LOC108350073uncharacterized LOC1083500732202785298202794148Rat
11457724LOC108349973zinc finger protein 728-like28695178986968928Rat
11362072LOC10835028260S ribosomal protein L21 pseudogene2211868721211869238Rat
11436036Prss48serine protease 482185286485185304588Rat
11436639LOC108350034uncharacterized LOC1083500342161596687161599272Rat
11363159LOC108350058uncharacterized LOC1083500582189417048189418787Rat
11364908LOC108348218high mobility group protein B2-like2197992874198002483Rat
11364935LOC10835005160S ribosomal protein L7a-like2185186545185189667Rat
11437210LOC108349979uncharacterized LOC10834997929492979794938468Rat
11437223Trnae-cuc2transfer RNA glutamic acid (anticodon CUC) 22198632043198632114Rat
11445903LOC108350231uncharacterized LOC10835023127571089175711808Rat
11446373Trnan-guu5transfer RNA asparagine (anticodon GUU) 52198596571198596644Rat
11446747LOC108350180uncharacterized LOC1083501802107013790107038637Rat
11446748LOC10835020860S ribosomal protein L29 pseudogene2232966420232966876Rat
11459489Trnak-cuu8transfer RNA lysine (anticodon CUU) 82198636994198637066Rat
11459913LOC108350251uncharacterized LOC1083502512153365695153375168Rat
11369036LOC108350191igE-binding protein-like2157019755157024312Rat
11437633LOC108350215uncharacterized LOC1083502152231800028231815720Rat
11438193LOC108349985uncharacterized LOC1083499852104691509104698190Rat
11438247LOC108350274uncharacterized LOC1083502742192628436192659092Rat
11447466LOC108350175zinc finger protein 737-like28642569186435068Rat
11447753LOC108350179serine/arginine repetitive matrix protein 1 pseudogene29814306798159684Rat
11358634LOC108350157guanine nucleotide-binding protein G(I)/G(S)/G(O) subunit gamma-5 pseudogene2188373990188375187Rat
11359983LOC108350084acidic mammalian chitinase-like2208636485208651737Rat
11427815LOC10835028760S ribosomal protein L21 pseudogene2232372898232373409Rat
11438648LOC108350241uncharacterized LOC1083502412121238483121243625Rat
11448318Trnan-guu4transfer RNA asparagine (anticodon GUU) 42198540317198540390Rat
11361538LOC108350244uncharacterized LOC1083502442127359295127363392Rat
11362924LOC108350027uncharacterized LOC1083500272156536175156537493Rat
11428098Trnav-cac1transfer RNA valine (anticodon CAC) 12198491452198491524Rat
11440273LOC108349993uncharacterized LOC1083499932121546418121552094Rat
11365372LOC108350046uncharacterized LOC1083500462183271465183288246Rat
11366023LOC108353416uncharacterized LOC1083534162114861795114865678Rat
11429484LOC108350037uncharacterized LOC1083500372175038469175052016Rat
11451529LOC108350188heterogeneous nuclear ribonucleoprotein A1 pseudogene2152298815152302655Rat
11369952LOC10835015860S ribosomal protein L7a pseudogene2233684345233690542Rat
11370167Trnap-agg3transfer RNA proline (anticodon AGG) 329833926998339340Rat
11430131LOC108350088uncharacterized LOC1083500882209828204209840889Rat
11430999LOC108350065uncharacterized LOC1083500652196046429196052903Rat
11440616LOC108350090uncharacterized LOC1083500902210934846210936609Rat
11373430LOC10835018540S ribosomal protein S6-like2125017431125064282Rat
11460360LOC108350030uncharacterized LOC1083500302157279310157286061Rat
11431841Trnar-acg1transfer RNA arginine (anticodon ACG) 12104403855104403927Rat
11432237LOC10835019760S ribosomal protein L7a pseudogene2181570908181571422Rat
11441417LOC108349981uncharacterized LOC10834998129566947295832885Rat
11442081LOC108350102uncharacterized LOC1083501022226652020226661291Rat
11453452LOC108349992uncharacterized LOC1083499922120805948120826210Rat
11460672Trnae-uuc3transfer RNA glutamic acid (anticodon UUC) 32198544235198544306Rat
11460842LOC108350196ATP synthase F(0) complex subunit C2, mitochondrial pseudogene2181292239181295641Rat
11432435Trnaq-cug1transfer RNA glutamine (anticodon CUG) 12198503162198503233Rat
11432616LOC10835026260S ribosomal protein L19 pseudogene2161077642161078223Rat
11433016LOC108350055uncharacterized LOC1083500552187500762187509219Rat
11433166LOC10835024260S ribosomal protein L7a pseudogene2124358493124359313Rat
11442315LOC10835026560S ribosomal protein L19 pseudogene2162064015162064597Rat
11442376LOC108350106uncharacterized LOC1083501062231045457231070028Rat
11454091LOC108349996uncharacterized LOC1083499962122867164122870554Rat
11394448LOC10835026360S ribosomal protein L19 pseudogene2161396485161397066Rat
11395218LOC10835026660S ribosomal protein L19 pseudogene2164006416164006997Rat
11405608LOC108350040uncharacterized LOC1083500402175709823175711735Rat
11405617LOC10835025860S ribosomal protein L19 pseudogene2160129865160130447Rat
11405760LOC108350070uncharacterized LOC1083500702198597797198598762Rat
11406497LOC108350086uncharacterized LOC1083500862209686749209708844Rat
11406694LOC108350100uncharacterized LOC1083501002225427718225430795Rat
11406875LOC108350042uncharacterized LOC1083500422178203116178214955Rat
11412602LOC108349994uncharacterized LOC1083499942121769189121774191Rat
11413171LOC108350091uncharacterized LOC1083500912211210914211226109Rat
11413827LOC108350269uncharacterized LOC1083502692168123784168177984Rat
11414904LOC108350071uncharacterized LOC1083500712200683628200684693Rat
11415392LOC108350206protein FAM162B-like2217460228217460639Rat
11415819LOC108350198uncharacterized LOC1083501982182716671182752870Rat
11415832LOC108350234endogenous retrovirus group K member 8 Pol protein-like29812833598130914Rat
11416318LOC108350076uncharacterized LOC1083500762205068867205171361Rat
11416565LOC108350003endogenous retrovirus group K member 25 Pol protein-like2128795384128796632Rat
11416806LOC108350216uncharacterized LOC1083502162231724704231824433Rat
11417312LOC108350043uncharacterized LOC1083500432178520260178536779Rat
11417321Trnah-gug5transfer RNA histidine (anticodon GUG) 52198630958198631029Rat
11417335LOC10835027060S ribosomal protein L26-like 1 pseudogene2170132682170133118Rat
11417765LOC108349990uncharacterized LOC1083499902118210564118256252Rat
11417770LOC108350077uncharacterized LOC1083500772206261924206270669Rat
11417777LOC108350236uncharacterized LOC1083502362108964096108983280Rat
11417786LOC108350239serine/arginine-rich splicing factor 7 pseudogene2116438859116439582Rat
11418243LOC108350068endogenous retrovirus group K member 8 Pol protein-like2197116299197124602Rat
11418558LOC108349977uncharacterized LOC10834997729376094593766500Rat
11418567LOC108349987uncharacterized LOC1083499872106570533106576630Rat
11418576LOC108350214uncharacterized LOC1083502142231685406231687029Rat
11418901LOC10834997060S ribosomal protein L27 pseudogene28092006780921048Rat
11418902LOC108349974uncharacterized LOC10834997428775422187782286Rat
11419887LOC108350060igE-binding protein-like2191968331191969176Rat
11421492Trnag-ucc2transfer RNA glycine (anticodon UCC) 22198638511198638582Rat
11421493Trnae-cuc3transfer RNA glutamic acid (anticodon CUC) 32198638907198638978Rat
11421872LOC108349986uncharacterized LOC1083499862105525669105538521Rat
11421876LOC10835009740S ribosomal protein S19 pseudogene2224879262224879773Rat
11422776LOC10835019440S ribosomal protein S6 pseudogene2166887545166888269Rat
11423168LOC108350235succinate dehydrogenase [ubiquinone] cytochrome b small subunit, mitochondrial pseudogene2104593295104595213Rat
11423490Trnah-gug6transfer RNA histidine (anticodon GUG) 62198637822198637893Rat
11423748LOC10835027960S ribosomal protein L19 pseudogene2197507369197507930Rat
11424028LOC108350193Y-linked testis-specific protein 1-like2163234641163235935Rat
11424933Trnan-guu3transfer RNA asparagine (anticodon GUU) 32198493307198493380Rat
11425228LOC108350240uncharacterized LOC1083502402120413321120415508Rat
11425377LOC108349995uncharacterized LOC1083499952121978834122014412Rat
11425657LOC10835026160S ribosomal protein L19 pseudogene2160496452160497029Rat
11426017Trnam-cau1transfer RNA methionine (anticodon CAU) 12189865653189865724Rat
11426141LOC108350285uncharacterized LOC1083502852221466422221485974Rat
11355185LOC108350176zinc finger protein 728 pseudogene28686824286869229Rat
11426711Trnap-ugg2transfer RNA proline (anticodon UGG) 22140414837140414908Rat
11427065LOC108350202peptidyl-prolyl cis-trans isomerase A-like2203702068203702960Rat
11427226LOC108349972uncharacterized LOC10834997228691000386913443Rat
11384578LOC108350213uncharacterized LOC1083502132221822256221823540Rat
11384727Smim43small integral membrane protein 432123227621123235170Rat
11384865LOC108349983uncharacterized LOC1083499832101942123102302821Rat
11384874Trnaa-agc2transfer RNA alanine (anticodon AGC) 22104404891104404963Rat
11385010LOC108350026nidogen-2-like2156435078156443198Rat
11373688LOC108350177voltage-dependent anion-selective channel protein 1 pseudogene29608229296112313Rat
11373689LOC108350190Y-linked testis-specific protein 1-like2155138404155140267Rat
11374296LOC108350013uncharacterized LOC1083500132145398003145399903Rat
11374300LOC108350067uncharacterized LOC1083500672196368594196378164Rat
11374486LOC108350233glyceraldehyde-3-phosphate dehydrogenase pseudogene29636073996361744Rat
11407430LOC10835010460S ribosomal protein L7 pseudogene2229269304229270107Rat
11385321LOC10835000860S ribosomal protein L35a pseudogene2140545260140545651Rat
11385799Egfl1epidermal growth factor like 12235057226235177294Rat
11408202LOC108350080uncharacterized LOC1083500802207201645207211386Rat
11408212LOC10835025960S ribosomal protein L19 pseudogene2160291429160292011Rat
11386321LOC108350094uncharacterized LOC1083500942221605536221650845Rat
11386574LOC108349982heterogeneous nuclear ribonucleoprotein K pseudogene2101739380101744693Rat
11386619LOC10835018760S ribosomal protein L39 pseudogene2144106220144106375Rat
11386721LOC108350173charged multivesicular body protein 5 pseudogene27777163977772609Rat
11386981LOC108350012uncharacterized LOC1083500122144675083144680463Rat
11398137LOC108350023uncharacterized LOC1083500232153888650153901001Rat
11375706LOC108350047uncharacterized LOC1083500472183686266183689332Rat
11376320LOC108350050uncharacterized LOC1083500502184534439184599505Rat
11376457LOC108350189igE-binding protein-like2153997897153999718Rat
11409306LOC10835025560S ribosomal protein L19 pseudogene2159589152159589733Rat
11409796LOC108350002uncharacterized LOC1083500022128778066128779706Rat
11409802LOC108350029uncharacterized LOC1083500292157099856157115301Rat
11388190Trnah-gug2transfer RNA histidine (anticodon GUG) 22198577670198577741Rat
11377500LOC108350268Y-linked testis-specific protein 1-like2165296992165299642Rat
11410500Trnan-guu6transfer RNA asparagine (anticodon GUU) 62198635027198635100Rat
11410614LOC108350007uncharacterized LOC1083500072140139063140151196Rat
11410625LOC108350093uncharacterized LOC1083500932221250563221271047Rat
11410912Trnav-aac1transfer RNA valine (anticodon AAC) 12116415357116415429Rat
11389079LOC108350016uncharacterized LOC1083500162148109843148132314Rat
11389356LOC108350289uncharacterized LOC1083502892233542172233542892Rat
11400669Trnag-ccc1transfer RNA glycine (anticodon CCC) 12198461976198462046Rat
11379162LOC108350184keratin-associated protein 4-4-like2124992685124993323Rat
11411735LOC108350061uncharacterized LOC1083500612193436888193457752Rat
11411744LOC108350246uncharacterized LOC1083502462133499955133502346Rat
11402023Trnah-gug1transfer RNA histidine (anticodon GUG) 12198546107198546178Rat
11402080Gstm3glutathione S-transferase mu 32210685204210688273Rat
11379963LOC108350072uncharacterized LOC1083500722202021649202042533Rat
11380114LOC10835001860S ribosomal protein L7a-like2149100278149101177Rat
11380439LOC108349976eukaryotic translation initiation factor 1 pseudogene28934639189347397Rat
11402449LOC108350078uncharacterized LOC1083500782206835111206842321Rat
11380966Trnak-cuu7transfer RNA lysine (anticodon CUU) 72198630130198630202Rat
11391863LOC108350087uncharacterized LOC1083500872209759397209766383Rat
11392116LOC108350009uncharacterized LOC1083500092140658698140681558Rat
11403233LOC108349968uncharacterized LOC10834996827809281578096188Rat
11404987LOC108349980uncharacterized LOC10834998029532343695329781Rat
11383061LOC108350271glyceraldehyde-3-phosphate dehydrogenase pseudogene2189266306189267311Rat
11383150LOC10835008260S ribosomal protein L21 pseudogene2208222424208225979Rat
11393894LOC108350101uncharacterized LOC1083501012225487888225516097Rat
11394130LOC10835025060S ribosomal protein L19 pseudogene2153140333153140915Rat
11500356LOC108350020uncharacterized LOC1083500202150259701150265219Rat
11500711LOC108350062uncharacterized LOC1083500622193538594193574723Rat
11519496LOC108350174endogenous retrovirus group K member 25 Pol protein-like28247397682475092Rat
11520363LOC108348190uncharacterized LOC1083481902235049338235052642Rat
11478123Trnaq-cug2transfer RNA glutamine (anticodon CUG) 22198536096198536167Rat
11502478LOC108350245uncharacterized LOC1083502452128024823128040099Rat
11478542LOC108350063uncharacterized LOC1083500632194478552194479186Rat
11504758LOC108350252endogenous retrovirus group K member 11 Pol protein-like2153995389153997663Rat
11479748LOC10835025660S ribosomal protein L19 pseudogene2159778619159779270Rat
11480030LOC108350081uncharacterized LOC1083500812207704511207837145Rat
11480249LOC108350099uncharacterized LOC1083500992225389452225396504Rat
11480253LOC108350195igE-binding protein-like2176451859176456265Rat
11504996Trnaq-cug4transfer RNA glutamine (anticodon CUG) 42199857347199857418Rat
11505970LOC108349971uncharacterized LOC10834997128446621584483673Rat
11489382LOC108350096uncharacterized LOC1083500962223607642223641749Rat
11507548LOC108350092uncharacterized LOC1083500922213673451213687727Rat
11496110LOC108350103uncharacterized LOC1083501032227631098227658379Rat
11496123LOC10835020560S ribosomal protein L29 pseudogene2209979576209980072Rat
11509230LOC108350095uncharacterized LOC1083500952223481833223483059Rat
11509625Trnak-cuu6transfer RNA lysine (anticodon CUU) 62198567936198568008Rat
11509905LOC10835026460S ribosomal protein L19 pseudogene2161960977161961544Rat
11510228LOC10835026060S ribosomal protein L19 pseudogene2160376604160377186Rat
11498829Eps8l3EPS8 like 32210668249210681930Rat
11511420LOC108349998uncharacterized LOC1083499982124177865124187096Rat
11512072LOC108350192Y-linked testis-specific protein 1-like2163146640163230235Rat
11500035LOC108349991uncharacterized LOC1083499912119484695119491037Rat
11500042LOC108350069uncharacterized LOC1083500692198091158198100209Rat
11512390LOC108350203glyceraldehyde-3-phosphate dehydrogenase pseudogene2205471332205473409Rat
11494299LOC108350201uncharacterized LOC1083502012192423024192434422Rat
11482435LOC10835027240S ribosomal protein S23 pseudogene2189820691189821082Rat
11483268LOC108350033uncharacterized LOC1083500332158225214158237200Rat
11483277Trnak-cuu5transfer RNA lysine (anticodon CUU) 52141888434141888506Rat
11513955LOC108350243uncharacterized LOC1083502432124565677124568553Rat
11513964LOC108350286uncharacterized LOC1083502862225532189225542155Rat
11514399LOC10835003160S ribosomal protein L36a-like2157343897157350580Rat
11514812LOC108350048uncharacterized LOC1083500482184169472184179963Rat
11484247LOC108348232uncharacterized LOC1083482322184816453184818545Rat
11515844LOC108350199ATP synthase subunit g, mitochondrial pseudogene2187693662187695364Rat
11515845LOC10835027760S ribosomal protein L19 pseudogene2196872161196872731Rat
11485614LOC10835025460S ribosomal protein L19 pseudogene2159415774159416341Rat
11516975LOC108350049uncharacterized LOC1083500492184538414184570458Rat
11516992LOC10835009840S ribosomal protein S26-like2225093659225095887Rat
11517145LOC108350089uncharacterized LOC1083500892210120639210145956Rat
11485677LOC108350024uncharacterized LOC1083500242155997368156000906Rat
11486183LOC108350019uncharacterized LOC1083500192150100198150117868Rat
11486192LOC108350085uncharacterized LOC1083500852209584851209635468Rat
11486538LOC108350032histone H3.3-like2157854652157855115Rat
11517695LOC108350182endogenous retrovirus group K member 10 Pol protein-like2115560729115570108Rat
11517846LOC108350064high mobility group protein B1 pseudogene2196013034196013805Rat
11486967Trnap-agg4transfer RNA proline (anticodon AGG) 42140415824140415895Rat
11487146LOC108350036uncharacterized LOC1083500362174203732174296254Rat
11487723LOC108350022uncharacterized LOC1083500222151129537151209966Rat
11487965LOC108350066uncharacterized LOC1083500662196138497196139650Rat
11518440LOC108350083uncharacterized LOC1083500832208319898208323666Rat
11488032LOC108350005uncharacterized LOC1083500052139370607139419752Rat
11488042LOC10835025760S ribosomal protein L19 pseudogene2159919102159919684Rat
11490901LOC108350021uncharacterized LOC1083500212150651022150652665Rat
11491212LOC10835028060S ribosomal protein L15 pseudogene2198194658198195278Rat
11491673Trnaq-cug3transfer RNA glutamine (anticodon CUG) 32198615413198615484Rat
11492656LOC108350178endogenous retrovirus group K member 9 Pol protein-like29813116098139603Rat
11492703LOC108350204uncharacterized LOC1083502042206997834207010199Rat
11493112LOC108349969tubulin alpha-1C chain-like28131814081321598Rat
11493370LOC108350276uncharacterized LOC1083502762192730912192733123Rat
11493497Trnag-ccc3transfer RNA glycine (anticodon CCC) 32198562804198562874Rat

Nucleotide Sequences
GenBank Nucleotide JH613325 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (Rnor_6.0)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
61355Bp36Blood pressure QTL 362.9blood pressure trait (VT:0000183)systolic blood pressure (CMO:0000004)23127638105149020Rat
1578671Bmd10Bone mineral density QTL 105.4femur mineral mass (VT:0010011)cortical volumetric bone mineral density (CMO:0001730)2944467968866454Rat
10755499Bp389Blood pressure QTL 3892.61arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)216679272245624402Rat
10402051Gdil2Gastrointestinal dilation QTL 2enteric ganglion morphology trait (VT:0001045)length of intestine affected by colonic aganglionosis to total length of colon ratio (CMO:0001836)22328064775687607Rat
1302794Stl27Serum triglyceride level QTL 274.40.0001blood triglyceride amount (VT:0002644)plasma triglyceride level (CMO:0000548)223837491149614623Rat
1358894Kidm24Kidney mass QTL 244.03kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)223837491169852800Rat
1358899Kidm23Kidney mass QTL 233.88kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)223837491169852800Rat
1358901Cm38Cardiac mass QTL 382heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)223837491169852800Rat
1358904Cm39Cardiac mass QTL 392.26heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)223837491169852800Rat
1358910Kidm27Kidney mass QTL 275.77kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)223837491169852800Rat
1358911Kidm28Kidney mass QTL 285.42kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)223837491169852800Rat
1358913Cm41Cardiac mass QTL 412.73heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)223837491218957222Rat
1358917Cm42Cardiac mass QTL 422.82heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)223837491218957222Rat
1358887Bw50Body weight QTL 502.39body mass (VT:0001259)body weight (CMO:0000012)223837719169852670Rat
1358908Bw49Body weight QTL 493.36body mass (VT:0001259)body weight (CMO:0000012)223837719169852670Rat
1354617Bp240Blood pressure QTL 2404arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)22618609783819822Rat
1354617Bp240Blood pressure QTL 2404arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)22618609783819822Rat
1354617Bp240Blood pressure QTL 2404arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)22618609783819822Rat
1354603Bp243Blood pressure QTL 2433.9arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)226186097135654963Rat
2290453Scl55Serum cholesterol level QTL 552.83blood cholesterol amount (VT:0000180)plasma total cholesterol level (CMO:0000585)226186097142053534Rat
12879841Cm87Cardiac mass QTL 870.026heart mass (VT:0007028)heart wet weight to body weight ratio (CMO:0002408)227161361148295267Rat
12879842Cm88Cardiac mass QTL 880.042heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)227161361148295267Rat
12879843Am3Aortic mass QTL 30.016aorta mass (VT:0002845)aorta weight to aorta length to body weight ratio (CMO:0002722)227161361148295267Rat
12879844Kidm62Kidney mass QTL 620.001kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)227161361148295267Rat
9590095Sffal3Serum free fatty acids level QTL 36.780.001blood free fatty acid amount (VT:0001553)plasma free fatty acids level (CMO:0000546)22776030172760301Rat
10755434Coatc7Coat color QTL 70.04794coat/hair pigmentation trait (VT:0010463)pigmented ventral coat/hair area to total ventral coat/hair area ratio (CMO:0001812)23127237976272379Rat
61371Edpm1Estrogen-dependent pituitary mass QTL 140.05pituitary gland mass (VT:0010496)pituitary gland wet weight (CMO:0000853)23408817591101903Rat
10755436Coatc8Coat color QTL 80.02431coat/hair pigmentation trait (VT:0010463)pigmented ventral coat/hair area to total ventral coat/hair area ratio (CMO:0001812)23513320280133202Rat
2306903Bp336Blood pressure QTL 3360.01arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)236245223112175725Rat
70174BpQTLCluster2Blood pressure QTL cluster 24.24arterial blood pressure trait (VT:2000000)absolute change in mean arterial blood pressure (CMO:0000533)240171834105089682Rat
70174BpQTLCluster2Blood pressure QTL cluster 24.24arterial blood pressure trait (VT:2000000)pulse pressure (CMO:0000292)240171834105089682Rat
70174BpQTLCluster2Blood pressure QTL cluster 24.24arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)240171834105089682Rat
70174BpQTLCluster2Blood pressure QTL cluster 24.24arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)240171834105089682Rat
70174BpQTLCluster2Blood pressure QTL cluster 24.24arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)240171834105089682Rat
2293835Kiddil5Kidney dilation QTL 53.8kidney pelvis morphology trait (VT:0004194)hydronephrosis severity score (CMO:0001208)242776916169852800Rat
2293843Kiddil6Kidney dilation QTL 63.1kidney pelvis morphology trait (VT:0004194)hydronephrosis severity score (CMO:0001208)242776916195645082Rat
1298085Bp165Blood pressure QTL 1650.0006arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)242776916217498710Rat
1298074Bp164Blood pressure QTL 1640.003arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)242776916217498710Rat
61467Bp14Blood pressure QTL 142.2arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)243133606217498545Rat
61467Bp14Blood pressure QTL 142.2arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)243133606217498545Rat
2293676Bmd19Bone mineral density QTL 1910.70.0001femur mineral mass (VT:0010011)total volumetric bone mineral density (CMO:0001728)243141290114164944Rat
2293682Bmd24Bone mineral density QTL 248.90.0001femur mineral mass (VT:0010011)cortical volumetric bone mineral density (CMO:0001730)243141290114164944Rat
2293671Bss44Bone structure and strength QTL 4410.970.0001lumbar vertebra morphology trait (VT:0010494)lumbar vertebra cortical cross-sectional area (CMO:0001690)243141290154583160Rat
631208Bw1Body weight QTL15.09mesenteric fat pad mass (VT:0010427)mesenteric fat pad weight as a percentage of body weight (CMO:0000654)24314978885642672Rat
1354601Slep1Serum leptin concentration QTL 15.39blood leptin amount (VT:0005667)serum leptin level (CMO:0000780)243149788198704485Rat
631266Bp132Blood pressure QTL 1320.0005arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)246537589217498710Rat
1354592Rf50Renal function QTL 503.5urine output (VT:0003620)timed urine volume (CMO:0000260)25443669875687607Rat
1331760Bp206Blood pressure QTL 2063.62454arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)256244671217498710Rat
1582246Cm60Cardiac mass QTL 605.8heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)25771560378466260Rat
6480225Gdil1Gastrointestinal dilation QTL 1enteric ganglion morphology trait (VT:0001045)length of intestine affected by colonic aganglionosis to total length of colon ratio (CMO:0001836)25834410075687607Rat
1558648Smcn1Smooth muscle cell number QTL 10.039blood vessel smooth muscle cell quantity (VT:0010525)aorta smooth muscle cell count per unit vessel length (CMO:0001646)260131410135646395Rat
5684990Bmd82Bone mineral density QTL 822.8tibia mineral mass (VT:1000283)bone mineral content (CMO:0001554)260325352106432915Rat
5684996Bmd85Bone mineral density QTL 854.70.024tibia mineral mass (VT:1000283)bone mineral density (CMO:0001226)260325352106432915Rat
61438Cia7Collagen induced arthritis QTL 74.60.0001joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)260325352147522851Rat
631500Bp99Blood pressure QTL 992.5arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)260325686105059293Rat
1578777Stresp15Stress response QTL 1520.05blood aldosterone amount (VT:0005346)plasma aldosterone level (CMO:0000551)261924251106924251Rat
1298080Bp163Blood pressure QTL 1630.02arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)266828049217498710Rat
1354648Bp239Blood pressure QTL 2390.001arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)266828236243550655Rat
1581569Uae32Urinary albumin excretion QTL 320.0001urine protein amount (VT:0005160)urine albumin excretion rate (CMO:0000757)26886541480632096Rat
1581576Pur7Proteinuria QTL 70.0001total urine protein amount (VT:0000032)urine total protein excretion rate (CMO:0000756)26886541480632096Rat
1358900Bw48Body weight QTL 484.88body mass (VT:0001259)body weight (CMO:0000012)268865414169852800Rat
724534Uae6Urinary albumin excretion QTL 610urine albumin amount (VT:0002871)urine albumin level (CMO:0000130)26886645480631953Rat
1581578Cm49Cardiac mass QTL 494.90.01heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)268866454149614466Rat
7411551Bw131Body weight QTL 13129.60.001body mass (VT:0001259)body weight gain (CMO:0000420)270132175115132175Rat
2317041Aia14Adjuvant induced arthritis QTL 143.29joint integrity trait (VT:0010548)left rear ankle joint diameter (CMO:0002149)271495404116495404Rat
1359034Bp274Blood pressure QTL 274arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)27568749596556760Rat
1359034Bp274Blood pressure QTL 274arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)27568749596556760Rat
1354605Rf48Renal function QTL 482.9blood creatinine amount (VT:0005328)plasma creatinine level (CMO:0000537)275687495221880419Rat
2317058Aia13Adjuvant induced arthritis QTL 132.9joint integrity trait (VT:0010548)left rear ankle joint diameter (CMO:0002149)27832141079969856Rat
61465Bp13Blood pressure QTL 133.3blood pressure trait (VT:0000183)systolic blood pressure (CMO:0000004)278321410105089682Rat
61465Bp13Blood pressure QTL 133.3blood pressure trait (VT:0000183)diastolic blood pressure (CMO:0000005)278321410105089682Rat
631198Cm22Cardiac mass QTL 224.30.0008heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)278321410158159410Rat
61374Edpm2Estrogen-dependent pituitary mass QTL 24.420.86pituitary gland mass (VT:0010496)pituitary gland wet weight (CMO:0000853)278321410217498710Rat
2299162Iddm32Insulin dependent diabetes mellitus QTL 322.36blood glucose amount (VT:0000188)age at onset/diagnosis of type 1 diabetes mellitus (CMO:0001140)280631950149614623Rat
61392Bp6Blood pressure QTL 67arterial blood pressure trait (VT:2000000)pulse pressure (CMO:0000292)282574487127574487Rat
1598865Bp296Blood pressure QTL 2962.1arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)283656855128656855Rat
8662832Vetf7Vascular elastic tissue fragility QTL 73.5aorta elastin amount (VT:0003905)aorta wall extracellular elastin dry weight to aorta wall dry weight ratio (CMO:0002002)283754907237610852Rat
1354622Kidm16Kidney mass QTL 163kidney mass (VT:0002707)left kidney wet weight (CMO:0000083)283819608239166203Rat
1354649Kidm17Kidney mass QTL 172.9kidney mass (VT:0002707)calculated kidney weight (CMO:0000160)283819608243901375Rat
1578772Stresp14Stress response QTL 1450.001blood renin amount (VT:0003349)plasma renin activity level (CMO:0000116)284424139132130578Rat
2300165Bmd49Bone mineral density QTL 494.80.0001lumbar vertebra mineral mass (VT:0010511)bone mineral density (CMO:0001226)291664872136664872Rat
2300170Bmd45Bone mineral density QTL 4512.10.0001lumbar vertebra mineral mass (VT:0010511)volumetric bone mineral density (CMO:0001553)291664872136664872Rat
2300185Bmd46Bone mineral density QTL 468.40.0001femur mineral mass (VT:0010011)volumetric bone mineral density (CMO:0001553)291664872136664872Rat
7207808Bmd89Bone mineral density QTL 894.1femur strength trait (VT:0010010)femoral neck ultimate force (CMO:0001703)291664872136664872Rat
1558653Prcr1Prostate cancer resistance QTL 15prostate integrity trait (VT:0010571)area of ventral prostate occupied by tumorous lesions to total ventral prostate area ratio (CMO:0000899)293995316169852800Rat
1598862Glom9Glomerulus QTL 93.5kidney glomerulus morphology trait (VT:0005325)index of glomerular damage (CMO:0001135)295946719140946719Rat
1598863Cm65Cardiac mass QTL 652.3heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)295946719140946719Rat
2317886Alcrsp23Alcohol response QTL 232.40.63response to alcohol trait (VT:0010489)duration of loss of righting reflex (CMO:0002289)296844330141844330Rat
9589093Slep10Serum leptin concentration QTL 103.840.001blood leptin amount (VT:0005667)plasma leptin level (CMO:0000781)2102356980147356980Rat
631566Bp90Blood pressure QTL 900.0001arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)2108880910153880910Rat
8662836Vetf8Vascular elastic tissue fragility QTL 80.66thoracic aorta molecular composition trait (VT:0010568)aorta wall extracellular elastin dry weight to aorta wall extracellular collagen weight ratio (CMO:0002003)2110965721155965721Rat
1581552Pur12Proteinuria QTL 125.190.0009total urine protein amount (VT:0000032)urine protein excretion rate (CMO:0000759)2115721880154182196Rat
631507Bp105Blood pressure QTL 1050.001arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)2116075644228737869Rat
634308Sach6Saccharin preference QTL 64.9taste sensitivity trait (VT:0001986)saccharin intake volume to total fluid intake volume ratio (CMO:0001601)2116075644228737869Rat
1359035Bp276Blood pressure QTL 276arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)2118446646149614623Rat
1359035Bp276Blood pressure QTL 276arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)2118446646149614623Rat
1359030Bp277Blood pressure QTL 277arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)2118446646200453484Rat
1359030Bp277Blood pressure QTL 277arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)2118446646200453484Rat
1578648Bss11Bone structure and strength QTL 114.7femur morphology trait (VT:0000559)femoral neck cortical cross-sectional area (CMO:0001702)2118446646227707979Rat
1554319Bmd2Bone mineral density QTL 213.40.0001lumbar vertebra area (VT:0010570)lumbar vertebra cross-sectional area (CMO:0001689)2118446793228582621Rat
1354594Despr10Despair related QTL 100.00000249locomotor behavior trait (VT:0001392)amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)2119789823164789823Rat
5135226Leukc2Leukocyte quantity QTL 2eosinophil quantity (VT:0002602)blood eosinophil count (CMO:0000033)2121750419155965721Rat
1582257Gluco21Glucose level QTL 213.10.0035blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)2121750419169852800Rat
738007Anxrr7Anxiety related response QTL 74.4exploratory behavior trait (VT:0010471)number of entries into a discrete space in an experimental apparatus (CMO:0000960)2123456539168456539Rat
1358360Sradr2Stress Responsive Adrenal Weight QTL 210.24adrenal gland mass (VT:0010420)both adrenal glands wet weight (CMO:0000164)2133399373173020198Rat
1300165Rf9Renal function QTL 93.28kidney glomerulus integrity trait (VT:0010546)index of glomerular damage (CMO:0001135)2138901276217498710Rat
70175BpQTLCluster3Blood pressure QTL cluster 34.128arterial blood pressure trait (VT:2000000)absolute change in systolic blood pressure (CMO:0000607)2140566078217498545Rat
70175BpQTLCluster3Blood pressure QTL cluster 34.128arterial blood pressure trait (VT:2000000)pulse pressure (CMO:0000292)2140566078217498545Rat
70175BpQTLCluster3Blood pressure QTL cluster 34.128arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)2140566078217498545Rat
70175BpQTLCluster3Blood pressure QTL cluster 34.128arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)2140566078217498545Rat
70175BpQTLCluster3Blood pressure QTL cluster 34.128arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)2140566078217498545Rat
1298076Bp166Blood pressure QTL 1660.0009arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)2141583337217498710Rat
1581502Esta3Estrogen-induced thymic atrophy QTL 3thymus mass (VT:0004954)thymus wet weight (CMO:0000855)2142053350204585731Rat
1359022Ppulsi1Prepulse inhibition QTL 13.63prepulse inhibition trait (VT:0003088)acoustic startle response measurement (CMO:0001519)2142053350228984665Rat
1549841Bp256Blood pressure QTL 2560.03arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)2142355464148295508Rat
12879830Bw178Body weight QTL 1780.001body mass (VT:0001259)body weight (CMO:0000012)2142355464148295508Rat
12879831Cm82Cardiac mass QTL 820.001heart mass (VT:0007028)heart wet weight to body weight ratio (CMO:0002408)2142355464148295508Rat
12879832Cm83Cardiac mass QTL 830.001heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)2142355464148295508Rat
12879833Cm84Cardiac mass QTL 840.001heart right ventricle mass (VT:0007033)heart weight to body weight ratio (CMO:0000074)2142355464148295508Rat
12879834Am1Aortic mass QTL 10.001aorta mass (VT:0002845)aorta weight to aorta length to body weight ratio (CMO:0002722)2142355464148295508Rat
12879835Kidm60Kidney mass QTL 600.001kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)2142355464148295508Rat
6907363Bp357Blood pressure QTL 3574.10.002arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)2143447078188447078Rat
7488931Bp367Blood pressure QTL 3670.001arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)2144631170148295508Rat
1331794Bp202Blood pressure QTL 2023.66819arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)2147122993240020001Rat
1331805Cm29Cardiac mass QTL 293.50746heart mass (VT:0007028)heart wet weight (CMO:0000069)2147122993240020001Rat
71113Cari2Carrageenan-induced inflammation QTL 22.70.009hypodermis integrity trait (VT:0010550)inflammatory exudate volume (CMO:0001429)2147522550217498710Rat
9685068Swd7Spike wave discharge measurement QTL 73.20.01brain electrophysiology trait (VT:0010557)brain spike-and-wave discharge rate (CMO:0001739)2147582596153667782Rat
7488933Bp368Blood pressure QTL 3680.004arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)2148295267153880910Rat
1549828Bp258Blood pressure QTL 2580.03arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)2148295267158268703Rat
724568Uae13Urinary albumin excretion QTL 134.4urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)2149114878225501939Rat
10043136Iddm54Insulin dependent diabetes mellitus QTL 543.40.0001blood glucose amount (VT:0000188)age at onset/diagnosis of type 1 diabetes mellitus (CMO:0001140)2149614466205573168Rat
10043136Iddm54Insulin dependent diabetes mellitus QTL 543.40.0001blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)2149614466205573168Rat
6903312Bw112Body weight QTL 1123.20.0013body mass (VT:0001259)body weight (CMO:0000012)2149614623198704357Rat
631520Bp73Blood pressure QTL 730.0001arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)2153799203181987474Rat
1641925Alcrsp2Alcohol response QTL 2response to alcohol trait (VT:0010489)duration of loss of righting reflex (CMO:0002289)2155965557237742948Rat
1641891Alcrsp17Alcohol response QTL 17response to alcohol trait (VT:0010489)duration of loss of righting reflex (CMO:0002289)2155965557254121739Rat
1598805Memor8Memory QTL 83exploratory behavior trait (VT:0010471)average horizontal distance in proximity to the target during voluntary locomotion in an experimental apparatus (CMO:0002674)2157914311204022555Rat
631501Bp101Blood pressure QTL 1012.4arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)2157914409217498545Rat
1354609Niddm62Non-insulin dependent diabetes mellitus QTL 624.720.000006insulin secretion trait (VT:0003564)plasma insulin level (CMO:0000342)2158159186217498710Rat
2301966Bp322Blood pressure QTL 3223.58arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)2158159186217498710Rat
61401Niddm2Non-insulin dependent diabetes mellitus QTL 24.54blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)2159585731204585731Rat
1598833Bp295Blood pressure QTL 2953.5arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)2161745602206745602Rat
1359032Hrtrt18Heart rate QTL 18heart pumping trait (VT:2000009)heart rate (CMO:0000002)2169852670207612467Rat
8662843Vetf9Vascular elastic tissue fragility QTL 92.05thoracic aorta molecular composition trait (VT:0010568)aorta wall extracellular elastin dry weight to aorta wall extracellular collagen weight ratio (CMO:0002003)2169852670243026643Rat
1302793Bw16Body weight QTL 1650.0001body mass (VT:0001259)body weight (CMO:0000012)2169852800217498545Rat
2301415Cm67Cardiac mass QTL 670.003heart mass (VT:0007028)heart wet weight to body weight ratio (CMO:0002408)2172795683189857032Rat
11565180Kidm56Kidney mass QTL 560.003kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)2172795683189857032Rat
11565181Bw176Body weight QTL 1760.002body mass (VT:0001259)body weight (CMO:0000012)2172795683189857032Rat
12879845Cm89Cardiac mass QTL 890.008heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)2172795683189857032Rat
12879846Cm90Cardiac mass QTL 900.011heart right ventricle mass (VT:0007033)heart right ventricle weight to body weight ratio (CMO:0000914)2172795683189857032Rat
12879847Am4Aortic mass QTL 40.001aorta mass (VT:0002845)aorta weight to aorta length to body weight ratio (CMO:0002722)2172795683189857032Rat
12879836Kidm61Kidney mass QTL 610.001kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)2172795683199696953Rat
12879837Am2Aortic mass QTL 20.001aorta mass (VT:0002845)aorta weight to aorta length to body weight ratio (CMO:0002722)2172795683199696953Rat
12879838Cm86Cardiac mass QTL 860.002heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)2172795683199696953Rat
12879839Cm85Cardiac mass QTL 850.001heart mass (VT:0007028)heart wet weight to body weight ratio (CMO:0002408)2172795683199696953Rat
12879840Bw179Body weight QTL 1790.005body mass (VT:0001259)body weight (CMO:0000012)2172795683199696953Rat
7488925Bp364Blood pressure QTL 3640.001arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)2174160958219160958Rat
1358356Srcrt1Stress Responsive Cort QTL13.66blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)2175403337239166203Rat
7488927Bp365Blood pressure QTL 3650.008arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)2177339806222339806Rat
2306901Bp337Blood pressure QTL 3370.01arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)2177680772243901375Rat
1598838Bp290Blood pressure QTL 2901.9arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)2181522444226522444Rat
1549833Bp257Blood pressure QTL 2570.003arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)2181987080199696953Rat
1331734Bp204Blood pressure QTL 2043.61192arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)2181990297240020001Rat
7771603Bp371Blood pressure QTL 3710.00001arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)2183864092187196901Rat
7771605Memor19Memory QTL 190.00001exploratory behavior trait (VT:0010471)measurement of voluntary locomotion into, out of or within a discrete space in an experimental apparatus (CMO:0000957)2183864092187196901Rat
2307174Activ3Activity QTL 34.830.000058locomotor behavior trait (VT:0001392)number of entries into a discrete space in an experimental apparatus (CMO:0000960)2183984665228984665Rat
61469Bp16Blood pressure QTL 165.64arterial blood pressure trait (VT:2000000)blood pressure measurement (CMO:0000003)2184730446229730446Rat
70162Bp63Blood pressure QTL 635.64arterial blood pressure trait (VT:2000000)blood pressure measurement (CMO:0000003)2184730446229730446Rat
61473Bp19Blood pressure QTL 196.3arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)2186611811189857032Rat
631522Bp74Blood pressure QTL 740.05arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)2186611811198704485Rat
7488904Bp363Blood pressure QTL 3630.001arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)2186889035189857032Rat
61457Niddm8Non-insulin dependent diabetes mellitus QTL 84.10.01blood insulin amount (VT:0001560)plasma insulin level (CMO:0000342)2188449158189857032Rat
2293084Iddm26Insulin dependent diabetes mellitus QTL 262.9blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)2188838511228984665Rat
2300189Bmd48Bone mineral density QTL 485.80.0001femur mineral mass (VT:0010011)volumetric bone mineral density (CMO:0001553)2194378622239378622Rat
61417Cia10Collagen induced arthritis QTL 103.4joint integrity trait (VT:0010548)experimental arthritis severity measurement (CMO:0001459)2194998627239998627Rat
9589044Scfw1Subcutaneous fat weight QTL 15.80.001subcutaneous adipose mass (VT:1000472)abdominal subcutaneous fat pad weight (CMO:0002069)2197253963242253963Rat
8694435Bw166Body weight QTL 16614.080.001retroperitoneal fat pad mass (VT:0010430)retroperitoneal fat pad weight to body weight ratio (CMO:0000635)2197253963242253963Rat
8694194Abfw1Abdominal fat weight QTL 111.70.001visceral adipose mass (VT:0010063)abdominal fat pad weight to body weight ratio (CMO:0000095)2197253963242253963Rat
8694383Bw158Body weight QTL 1587.690.001body lean mass (VT:0010483)lean tissue morphological measurement (CMO:0002184)2197253963242253963Rat
4889834Pur24Proteinuria QTL 245.80.014total urine protein amount (VT:0000032)urine total protein excretion rate (CMO:0000756)2198704357217498710Rat
738013Alc15Alcohol consumption QTL 154.10.00022consumption behavior trait (VT:0002069)ethanol drink intake rate to body weight ratio (CMO:0001616)2199380312244380312Rat
7488929Bp366Blood pressure QTL 3660.001arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)2199954569208081195Rat
1359031Bp275Blood pressure QTL 275arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)2200453324236318668Rat
1359031Bp275Blood pressure QTL 275arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)2200453324236318668Rat
1298083Bp158Blood pressure QTL 1582.62arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)2204003742231132207Rat
61458Bp10Blood pressure QTL 103.42arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)2204003742231132207Rat
1331745Bp203Blood pressure QTL 2034.377arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)2204585642235290110Rat
1581499Esta2Estrogen-induced thymic atrophy QTL 2thymus mass (VT:0004954)thymus wet weight (CMO:0000855)2204585642243689611Rat
61398Bp50Blood pressure QTL 504.4arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)2204585642249585642Rat
61366Iddm3Insulin dependent diabetes mellitus QTL 34.7blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)2204585642249585642Rat
10043139Iddm55Insulin dependent diabetes mellitus QTL 553.10.0001blood glucose amount (VT:0000188)age at onset/diagnosis of type 1 diabetes mellitus (CMO:0001140)2205572952207612467Rat
10043139Iddm55Insulin dependent diabetes mellitus QTL 553.10.0001blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)2205572952207612467Rat
2301408Kidm36Kidney mass QTL 360.002kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)2205583921243562243Rat
2317752Glom23Glomerulus QTL 233.6urine protein amount (VT:0005160)urine protein level (CMO:0000591)2208594330263179188Rat
1598813Memor9Memory QTL 92.7exploratory behavior trait (VT:0010471)average horizontal distance in proximity to the target during voluntary locomotion in an experimental apparatus (CMO:0002674)2214870793251212353Rat
2298479Eau5Experimental allergic uveoretinitis QTL 50.0021uvea integrity trait (VT:0010551)experimental autoimmune uveitis score (CMO:0001504)2217498545254132424Rat
1598835Anxrr18Anxiety related response QTL 182.98body movement coordination trait (VT:0005424)number of rearing movements in an experimental apparatus (CMO:0001752)2217743855262743855Rat
1302789Stl26Serum triglyceride level QTL 263.10.0035blood triglyceride amount (VT:0002644)plasma triglyceride level (CMO:0000548)2218957047240977220Rat
2299161Iddm33Insulin dependent diabetes mellitus QTL 332.98blood glucose amount (VT:0000188)age at onset/diagnosis of type 1 diabetes mellitus (CMO:0001140)2221488355254121739Rat
631203Gluco14Glucose level QTL 140.0001blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)2221880206235570970Rat
1298075Scl17Serum cholesterol level QTL 173.4blood cholesterol amount (VT:0000180)plasma total cholesterol level (CMO:0000585)2228712271266435125Rat
1549836Bss2Bone structure and strength QTL 27.5femur strength trait (VT:0010010)femur midshaft polar moment of inertia (CMO:0001669)2228712271266435125Rat
7207482Bss107Bone structure and strength QTL 1077femur strength trait (VT:0010010)femur ultimate force (CMO:0001675)2228712271266435125Rat
7207484Bss108Bone structure and strength QTL 1085.3femur strength trait (VT:0010010)femur total energy absorbed before break (CMO:0001677)2228712271266435125Rat
7207490Bss111Bone structure and strength QTL 1116.4femur morphology trait (VT:0000559)femur midshaft cortical cross-sectional area (CMO:0001663)2228712271266435125Rat
1300126Bp175Blood pressure QTL 1753.46arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)2229606682264899009Rat
2317885Alcrsp28Alcohol response QTL 282.10.63response to alcohol trait (VT:0010489)duration of loss of righting reflex (CMO:0002289)2229793522266435125Rat
2313073Bmd75Bone mineral density QTL 754.10.0001tibia mineral mass (VT:1000283)total volumetric bone mineral density (CMO:0001728)2231224020254132424Rat
631514Scl8Serum cholesterol level QTL84.4blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)2231621666266435125Rat
8693697Alc36Alcohol consumption QTL 3620.592drinking behavior trait (VT:0001422)calculated ethanol drink intake rate (CMO:0001615)2233013605253626471Rat


Additional Information

Database Acc Id Source(s)
UniSTS 217478 UniSTS