RH134165 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: RH134165

Symbol: RH134165
Previously known as: AI715307; 
RGD ID: 5050626
Expected Size: 188 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.23168,051,897 - 168,052,549 (+)MAPPERmRatBN7.2
Rnor_6.03176,443,149 - 176,443,800NCBIRnor6.0
Rnor_5.03180,152,963 - 180,153,614UniSTSRnor5.0
RGSC_v3.43170,042,569 - 170,043,220UniSTSRGSC3.4
Celera3164,532,417 - 164,533,068UniSTS
RH 3.4 Map31532.2UniSTS
Cytogenetic Map3q43UniSTS
Is Marker For: Genes:   Birc7  


Annotation


References - curated
# Reference Title Reference Citation
1. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer CCACTCTCTCACACAAACCAGG
Reverse Primer TCTGCAGGGTGCCTATCTGTAA
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
1562883Birc7baculoviral IAP repeat-containing 73168047824168052606Rat

Nucleotide Sequences
RefSeq Transcripts XM_001058257 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  XM_238302 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
1559282Emca5Estrogen-induced mammary cancer QTL 53.9mammary gland integrity trait (VT:0010552)percentage of study population developing mammary tumors during a period of time (CMO:0000948)343827364169034231Rat
631541Bp81Blood pressure QTL 814arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)3124122556169034231Rat
1578656Vnigr2Vascular neointimal growth QTL 24.2artery morphology trait (VT:0002191)lesioned artery residual lumen area (CMO:0001417)3130656562169034231Rat
1578653Vnigr3Vascular neointimal growth QTL 33.1artery morphology trait (VT:0002191)artery neointimal hyperplastic lesion area (CMO:0001414)3130656562169034231Rat
9589106Insul23Insulin level QTL 2313.860.001blood insulin amount (VT:0001560)plasma insulin level (CMO:0000342)3131635904169034231Rat
2298477Eau4Experimental allergic uveoretinitis QTL 40.0011uvea integrity trait (VT:0010551)experimental autoimmune uveitis score (CMO:0001504)3137398739169034231Rat
8552952Pigfal13Plasma insulin-like growth factor 1 level QTL 13blood insulin-like growth factor amount (VT:0010479)plasma insulin-like growth factor 1 level (CMO:0001299)3138799500169034231Rat
1298068Bp167Blood pressure QTL 1670.004arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)3141074471169034231Rat
2317883Alcrsp26Alcohol response QTL 261.80.63response to alcohol trait (VT:0010489)duration of loss of righting reflex (CMO:0002289)3145526770169034231Rat
8552791Vie2Viral induced encephalitis QTL 24.1brain integrity trait (VT:0010579)encephalitis incidence/prevalence measurement (CMO:0002361)3145956084169034231Rat
1300161Rf10Renal function QTL 103.57renal blood flow trait (VT:2000006)absolute change in renal vascular resistance (CMO:0001900)3161192952169034231Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 296468 UniSTS
UniSTS 217447 UniSTS