RH133490 Marker Search Result - Rat Genome Database

Send us a Message
Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Search RGD Grant Resources Citing RGD About Us Contact Us
Genes Variants Community Projects QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data
OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer)
Aging & Age-Related Disease Cancer & Neoplastic Disease Cardiovascular Disease Coronavirus Disease Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease
Find Models Genetic Models Autism Models Rat PhenoMiner (Quantitative Phenotypes) Chinchilla PhenoMiner Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive
Pathways
Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Presentations Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources
Advanced Search (OLGA)

Marker: RH133490

Symbol: RH133490
Previously known as: AI059743; 
RGD ID: 5049454
Expected Size: 209 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.2871,956,878 - 71,957,087 (+)MAPPERmRatBN7.2
Rnor_6.0877,719,260 - 77,719,468NCBIRnor6.0
Rnor_5.0875,363,305 - 75,363,513UniSTSRnor5.0
RGSC_v3.4875,770,931 - 75,771,139UniSTSRGSC3.4
Celera869,779,757 - 69,779,965UniSTS
Cytogenetic Map8q24UniSTS
Is Marker For: Genes:   Aldh1a2  


Annotation


References - curated
# Reference Title Reference Citation
1. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer TGCTTTATTGCTAGCACGAGGT
Reverse Primer TTACTGACAAATGAGGACAACGC
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
620250Aldh1a2aldehyde dehydrogenase 1 family, member A287187785071957107Rat



QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
1298065Scl16Serum cholesterol level QTL 163.8blood cholesterol amount (VT:0000180)plasma total cholesterol level (CMO:0000585)83085640475856404Rat
1554321Bmd3Bone mineral density QTL 37.90.0001femur mineral mass (VT:0010011)volumetric bone mineral density (CMO:0001553)840952565123900184Rat
9590292Uminl3Urine mineral level QTL 33.620.001urine mineral amount (VT:0015086)urine electrolyte level (CMO:0000593)871888757116888757Rat
1578769Uae31Urinary albumin excretion QTL 313.30.001urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)830848154101699754Rat
1298079Activ2Activity QTL 29.50.000001voluntary movement trait (VT:0003491)rearing measurement (CMO:0001515)84186687686866876Rat
70161Bp62Blood pressure QTL 622.90.001arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)84269268490165460Rat
1578765Klgr1Kidney lesion grade QTL 13.30.0001kidney morphology trait (VT:0002135)organ lesion measurement (CMO:0000677)830848154101699754Rat
1582222Epfw2Epididymal fat weight QTL 23.20.0005epididymal fat pad mass (VT:0010421)epididymal fat pad weight to body weight ratio (CMO:0000658)83173772976737729Rat
61464Niddm11Non-insulin dependent diabetes mellitus QTL 113.10.001blood insulin amount (VT:0001560)plasma insulin level (CMO:0000342)83558203280582032Rat
4889938Bss89Bone structure and strength QTL 893.8tibia size trait (VT:0100001)tibia cortical bone volume (CMO:0001725)85009524982460899Rat
1578755Pur5Proteinuria QTL 53.30.0001urine total protein amount (VT:0000032)urine total protein excretion rate (CMO:0000756)830848154101699754Rat
1300146Rf17Renal function QTL 172.9renal blood flow trait (VT:2000006)absolute change in renal blood flow rate (CMO:0001168)82824291273242912Rat
8662823Vetf5Vascular elastic tissue fragility QTL 51.9artery integrity trait (VT:0010639)patent ductus arteriosus score (CMO:0002566)82824291299525068Rat
2313088Bss75Bone structure and strength QTL 753.10.0001body length (VT:0001256)body length, nose to rump (CMO:0000079)83084815482460899Rat
631210Bw3Body weight QTL35.9mesenteric fat pad mass (VT:0010427)mesenteric fat pad weight to body weight ratio (CMO:0000654)869349194112783834Rat
1358896Bp262Blood pressure QTL 2622.89arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)82720571599103503Rat
731182Uae24Urinary albumin excretion QTL 246.4urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)81933115293965294Rat
8694446Bw170Body weight QTL 17012.070.001retroperitoneal fat pad mass (VT:0010430)retroperitoneal fat pad weight to body weight ratio (CMO:0000635)871888757116888757Rat
737824Hcar10Hepatocarcinoma resistance QTL 102.9liver integrity trait (VT:0010547)liver tumorous lesion number (CMO:0001068)84071306682925667Rat
1331769Rf39Renal function QTL 393.871urine output (VT:0003620)timed urine volume (CMO:0000260)84186687675097878Rat
61358Bp39Blood pressure QTL 392arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)83555193880551938Rat
1358906Bp253Blood pressure QTL 25340.0004arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)84071306693965294Rat
1358907Cm40Cardiac mass QTL 401.89heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)82720571599103503Rat
70197BpQTLcluster8Blood pressure QTL cluster 83.482arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)846531639119088626Rat
2316950Scl66Serum cholesterol level QTL 664.1blood cholesterol amount (VT:0000180)plasma total cholesterol level (CMO:0000585)830848259105647037Rat
1582254Kidm31Kidney mass QTL 313kidney mass (VT:0002707)both kidneys wet weight (CMO:0000085)85423764485365202Rat
10402857Bp380Blood pressure QTL 3800.95arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)85396876598968765Rat
1358892Kidm26Kidney mass QTL 263.69kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)82720571599103503Rat
5684973Bss100Bone structure and strength QTL 1004.7tibia area (VT:1000281)tibia area measurement (CMO:0001382)85009524982460899Rat
1582243Bw66Body weight QTL 663.40.0048body mass (VT:0001259)body weight (CMO:0000012)85423764485365202Rat
8694200Abfw4Abdominal fat weight QTL 49.070.001visceral adipose mass (VT:0010063)abdominal fat pad weight to body weight ratio (CMO:0000095)871888757116888757Rat
2313057Bss76Bone structure and strength QTL 7630.0001tibia size trait (VT:0100001)tibia midshaft cross-sectional area (CMO:0001717)83084815482460899Rat
12879878Bw183Body weight QTL 1830.001body mass (VT:0001259)body weight (CMO:0000012)84329616998968765Rat
1300177Cm2Cardiac mass QTL 23.65heart mass (VT:0007028)heart weight (CMO:0000017)854259986100382532Rat
1549908Neudeg1Neurodegradation QTL 15.50nervous system integrity trait (VT:0010566)logarithm of the ratio of the lesioned side motor neuron count to contralateral side motor neuron count (CMO:0001986)83018886794457446Rat
12879879Cm99Cardiac mass QTL 990.001heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)84329616998968765Rat
2313067Bss77Bone structure and strength QTL 773.10.0001tibia size trait (VT:0100001)tibia midshaft endosteal cross-sectional area (CMO:0001716)83084815482460899Rat
12879880Cm100Cardiac mass QTL 1000.001heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)84329616998968765Rat
12879881Cm101Cardiac mass QTL 1010.001heart right ventricle mass (VT:0007033)heart right ventricle weight to body weight ratio (CMO:0000914)84329616998968765Rat
12879882Am8Aortic mass QTL 80.001aorta mass (VT:0002845)aorta weight to aorta length to body weight ratio (CMO:0002722)84329616998968765Rat
12879883Kidm65Kidney mass QTL 650.001kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)84329616998968765Rat
1358912Bw51Body weight QTL 512.95body mass (VT:0001259)body weight (CMO:0000012)851351728107062046Rat
1300171Bp184Blood pressure QTL 1843.66arterial blood pressure trait (VT:2000000)blood pressure time series experimental set point of the baroreceptor response (CMO:0002593)870513503118219066Rat
2313086Bss60Bone structure and strength QTL 604.10.0001tibia length (VT:0004357)tibia length (CMO:0000450)85009524982460899Rat
2303171Bp331Blood pressure QTL 3315.570.005arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)861290298119084929Rat
2293697Bmd39Bone mineral density QTL 39femur strength trait (VT:0010010)femur total energy absorbed before break (CMO:0001677)85404374498968765Rat
1331837Bw23Body weight QTL 234.190.00007body mass (VT:0001259)body weight (CMO:0000012)84653172299083736Rat
1331838Niddm61Non-insulin dependent diabetes mellitus QTL 613.530.0004blood insulin amount (VT:0001560)plasma insulin level (CMO:0000342)83646953599083736Rat
631650Stl6Serum triglyceride level QTL 640.0019blood triglyceride amount (VT:0002644)plasma triglyceride level (CMO:0000548)810378157112202585Rat
631653Bp125Blood pressure QTL 1253.3arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)866142385111142385Rat
1581557Eae16Experimental allergic encephalomyelitis QTL 163.8nervous system integrity trait (VT:0010566)experimental autoimmune encephalomyelitis incidence/prevalence measurement (CMO:0001046)88462195110921472Rat
631271Lecl1Lens clarity QTL 10.001lens clarity trait (VT:0001304)age of onset/diagnosis of cataract (CMO:0001584)81898416884531599Rat
2303570Gluco48Glucose level QTL 482blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)84980583194805831Rat
2313046Bss78Bone structure and strength QTL 783.50.0001tibia strength trait (VT:1000284)tibia total energy absorbed before break (CMO:0001736)83084815482460899Rat
2301402Bp316Blood pressure QTL 3160.005arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)85396876598968765Rat
631664Hcar3Hepatocarcinoma resistance QTL 32.90.0005liver integrity trait (VT:0010547)volume of individual liver tumorous lesion (CMO:0001078)85423764499103503Rat
8694392Bw161Body weight QTL 1618.060.001body lean mass (VT:0010483)lean tissue morphological measurement (CMO:0002184)871888757116888757Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 116676 UniSTS