RH133047 Marker Search Result - Rat Genome Database

Send us a Message
Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Search RGD Grant Resources Citing RGD About Us Contact Us
Genes Variants Community Projects QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data
OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer)
Aging & Age-Related Disease Cancer & Neoplastic Disease Cardiovascular Disease Coronavirus Disease Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease
Find Models   new Genetic Models Autism Models Rat PhenoMiner (Quantitative Phenotypes) Chinchilla PhenoMiner Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive
Pathways
Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Presentations Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources

Marker: RH133047

Symbol: RH133047
Previously known as: AI548308; 
RGD ID: 5048686
Expected Size: 217 (bp)
Notes this SSLP was found to have more than 4 positions (total 5 positions) on the RGSC 5.0 genome assembly for UniSTS:216330; therefore these positions have been skipped during loading
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
Celera1524,766,542 - 24,766,758UniSTS
Celera1524,864,784 - 24,865,001UniSTS
Cytogenetic Map15p14UniSTS
Is Marker For: Genes:   Rnase3   Rnase17   Rnase2   Ear1  


Annotation


References - curated
# Reference Title Reference Citation
1. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer TGCAGACAGAGGAACTGGATCT
Reverse Primer CGGCAAGGATTTATACCCAATG
 

Region



Additional Information

Database Acc Id Source(s)
NCBI Gene 100361909 UniSTS
  192264 UniSTS
  474169 UniSTS
  497195 UniSTS
UniSTS 216330 UniSTS