RH132977 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: RH132977

Symbol: RH132977
Previously known as: AI547691; 
RGD ID: 5048566
Expected Size: 188 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.2991,553,531 - 91,553,719 (+)MAPPERmRatBN7.2
Rnor_6.0998,118,976 - 98,119,163NCBIRnor6.0
Rnor_5.0997,800,133 - 97,800,320UniSTSRnor5.0
RGSC_v3.4990,159,661 - 90,159,848UniSTSRGSC3.4
Celera989,097,843 - 89,098,030UniSTS
Cytogenetic Map9q36UniSTS
Is Marker For: Genes:   Rab17  


Annotation


References - curated
# Reference Title Reference Citation
1. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer TTTCAGAGTCCTCGAATCACGA
Reverse Primer GGAAGAGAAGGGACATCAATGC
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
1562478Rab17RAB17, member RAS oncogene family99155292491566759Rat



QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
724544Uae9Urinary albumin excretion QTL 94.5urine albumin amount (VT:0002871)urine albumin level (CMO:0000130)925268044114175309Rat
731164Uae25Urinary albumin excretion QTL 253.50.0001urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)925661188100929786Rat
8662828Vetf6Vascular elastic tissue fragility QTL 63.9artery integrity trait (VT:0010639)patent ductus arteriosus score (CMO:0002566)93696235992058970Rat
2290450Scl57Serum cholesterol level QTL 574.15blood cholesterol amount (VT:0000180)plasma total cholesterol level (CMO:0000585)93696235995410867Rat
631656Bp108Blood pressure QTL 1085.970.0001arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)94859825193598251Rat
1578760Cm53Cardiac mass QTL 533.30.0001heart mass (VT:0007028)heart wet weight (CMO:0000069)956771635101771635Rat
724515Uae16Urinary albumin excretion QTL 168urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)958163035100929646Rat
1300134Bp185Blood pressure QTL 1853.73arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)961381434104821652Rat
1581580Uae34Urinary albumin excretion QTL 34urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)96207227596470995Rat
1578757Pur6Proteinuria QTL 63.30.005urine total protein amount (VT:0000032)urine total protein excretion rate (CMO:0000756)96207227596470995Rat
61385Edpm9Estrogen-dependent pituitary mass QTL 93.430.05pituitary gland mass (VT:0010496)pituitary gland wet weight (CMO:0000853)963869687108869687Rat
731171Glom6Glomerulus QTL 62.80.0003kidney glomerulus morphology trait (VT:0005325)count of superficial glomeruli not directly contacting the kidney surface (CMO:0001002)964573531109573531Rat
1354626Bvd1Brain ventricular dilatation QTL 13.730.001brain ventricle morphology trait (VT:0000822)hydrocephalus severity score (CMO:0001881)975712843111552878Rat
4889852Pur26Proteinuria QTL 26150.001urine total protein amount (VT:0000032)urine total protein excretion rate (CMO:0000756)977813894101597663Rat
7794784Mcs31Mammary carcinoma susceptibility QTL 312.98mammary gland integrity trait (VT:0010552)mammary tumor incidence/prevalence measurement (CMO:0000946)977813894111552878Rat
2303178Bp334Blood pressure QTL 3343.70.01arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)97927151191616855Rat
2303178Bp334Blood pressure QTL 3343.70.01arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)97927151191616855Rat
2303178Bp334Blood pressure QTL 3343.70.01arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)97927151191616855Rat
724547Cm21Cardiac mass QTL 212.7heart mass (VT:0007028)calculated heart weight (CMO:0000073)979271511102910209Rat
4889943Bss90Bone structure and strength QTL 904.1tibia area (VT:1000281)tibia-fibula cortical bone endosteal cross-sectional area (CMO:0001722)98636963192058970Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 503269 UniSTS
UniSTS 216260 UniSTS