RH132721 Marker Search Result - Rat Genome Database
Submit Data |  Help |  Video Tutorials |  News |  Publications |  FTP Download |  REST API |  Citing RGD |  Contact   

Marker: RH132721

Symbol: RH132721
Also known as: AI501120; 
RGD ID: 5048122
Expected Size: 220 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
Rnor_6.01045,073,748 - 45,073,967NCBIRnor6.0
Rnor_6.01047,166,726 - 47,166,945NCBIRnor6.0
Rnor_5.01046,940,202 - 46,940,421UniSTSRnor5.0
Rnor_5.01044,831,437 - 44,831,656UniSTSRnor5.0
RGSC_v3.41047,059,563 - 47,059,782UniSTSRGSC3.4
Celera1044,847,219 - 44,847,438UniSTS
RH 3.4 Map10498.2UniSTS


Annotation


References - curated
1. RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer AGCCTTAGGAAGGTTGAGACCC
Reverse Primer GGACTTTGTGGATTTGGTTTGG
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
69423Srebf1sterol regulatory element binding transcription factor 1104657099646593021Rat
3297Pemtphosphatidylethanolamine N-methyltransferase104633982146404640Rat
619947Mpripmyosin phosphatase Rho interacting protein104601839746133580Rat
631335Obscnobscurin, cytoskeletal calmodulin and titin-interacting RhoGEF104535318545483570Rat
69290Trim17tripartite motif-containing 17104530700745314823Rat
3012Llgl1LLGL scribble cell polarity complex component 1104694087346955524Rat
621270Arf1ADP-ribosylation factor 1104556270045579214Rat
619727Rasd1ras related dexamethasone induced 1104633036146339326Rat
1304611Zfp496zinc finger protein 496104583325945852130Rat
621437Hist3h2ahistone cluster 3, H2a104529760345299155Rat
735088Flcnfolliculin104615318546172331Rat
1304587RGD1304587similar to RIKEN cDNA 2310033P09104555849145562004Rat
1307520Hist3h2bahistone cluster 3, H2ba104528974145290370Rat
1305018Wnt9aWnt family member 9A104565904545686103Rat
1307590FliiFLII, actin remodeling protein104695546046969468Rat
1306728Tom1l2target of myb1 like 2 membrane trafficking protein104659939246720921Rat
1307740Natd1N-acetyltransferase domain containing 1104715444347164622Rat
1305161Atpaf2ATP synthase mitochondrial F1 complex assembly factor 2104676853946783889Rat
1306000Iba57iron-sulfur cluster assembly factor IBA57104550612445514909Rat
1307186Jmjd4jumonji domain containing 4104579896445804188Rat
1308636Rnf187ring finger protein 187104527340045279299Rat
1311987Pld6phospholipase D family, member 6104614231346145774Rat
1309150Drc3dynein regulatory complex subunit 3104671202146762276Rat
1333085Olr1461olfactory receptor 1461104515934245160268Rat
1308314Nlrp3NLR family, pyrin domain containing 3104588432445918290Rat
1312011Shmt1serine hydroxymethyltransferase 1104703081347059216Rat
1305448Trim11tripartite motif-containing 11104532219945335030Rat
1333969Olr1463olfactory receptor 1463104593917845940137Rat
1309496Alkbh5alkB homolog 5, RNA demethylase104690631446927759Rat
1308161Mrpl55mitochondrial ribosomal protein L55104555279445555943Rat
1306620Map2k3mitogen activated protein kinase kinase 3104508945545110802Rat
1309622Nt5m5',3'-nucleotidase, mitochondrial104621649446244478Rat
1309638Guk1guanylate kinase 1104553561745552455Rat
1306633Zfp39zinc finger protein 39104522035245243653Rat
1309320Top3aDNA topoisomerase III alpha104698064647018728Rat
1308057Wnt3aWnt family member 3A104559889845643151Rat
1308500Rai1retinoic acid induced 1104651127146571591Rat
1309817Tmem11transmembrane protein 11104711713347131842Rat
1560444RGD1560444similar to glyceraldehyde-3-phosphate dehydrogenase (phosphorylating) (EC 1.2.1.12)104515519945156311Rat
1559732Btnl10butyrophilin like 10104525794645266233Rat
1562712Gjc2gap junction protein, gamma 2104552674045535520Rat
1311243Dhrs7bdehydrogenase/reductase 7B104706575547111089Rat
1565729Prss38serine protease 38104572366345731756Rat
1561277RGD1561277RGD1561277104516938145185463Rat
1561873Myo15amyosin XVA104684009846897362Rat
1333777Olr1462olfactory receptor 1462104592171545924257Rat
1333308Olr1464-psolfactory receptor pseudogene 1464104596692645967993Rat
1560728Mief2mitochondrial elongation factor 2104696953146975572Rat
1562380Drg2developmentally regulated GTP binding protein 2104681841246831308Rat
735194Snap47synaptosome associated protein 47104575719645798734Rat
1559667RGD1559667similar to basic transcription factor 3104706333547063965Rat
1582743LOC691571similar to Shwachman-Bodian-Diamond syndrome104595264745961253Rat
1583877H3f4H3.4 histone104530469645305106Rat
1583885H2bu1H2B.U histone 1104529663845297385Rat
1585025LOC691392similar to 60S ribosomal protein L17 (L23) (Amino acid starvation-induced protein) (ASI)104692341046924341Rat
1583913LOC691460similar to Cofilin-2 (Cofilin, muscle isoform)104515457145155096Rat
1564621Smcr8SMCR8-C9orf72 complex subunit104701932647026465Rat
1563669Med9mediator complex subunit 9104631463946329374Rat
1303002Cops3COP9 signalosome subunit 3104618268046206083Rat
1588894Gid4GID complex subunit 4104678412446810517Rat
1597232Rps4x-ps6ribosomal protein S4, X-linked, pseudogene 6104681464946815803Rat
1642427Zfp867zinc finger protein 867104580912145819530Rat
2318500LOC100362285ribosomal protein L15-like104598238345983018Rat
2323819LOC100359474dCTP pyrophosphatase 1-like104617334446175029Rat
6488615LOC10091212060S ribosomal protein L18-like104582734745828566Rat
6495127LOC100911111uncharacterized LOC100911111104534600545350021Rat
7518371LOC102555997uncharacterized LOC102555997104531500745321502Rat
7522365LOC102556059uncharacterized LOC102556059104535318545356395Rat
7501583LOC102546946uncharacterized LOC102546946104507242745075462Rat
7511312LOC102555635zinc finger protein 39-like104519377145211045Rat
7593322LOC102549418uncharacterized LOC102549418104645768946473572Rat
7739209LOC102546363uncharacterized LOC102546363104573205145750872Rat
7718036LOC102550484uncharacterized LOC102550484104716540647168440Rat
7720886LOC102547016uncharacterized LOC102547016104613350546136923Rat
9184441LOC103693339uncharacterized LOC103693339104573801645743953Rat
9372195LOC103693365ferritin light chain 1 pseudogene104582203445822580Rat
9219958LOC103689956dual specificity mitogen-activated protein kinase kinase 3104508940145110803Rat
9460238LOC103693338uncharacterized LOC103693338104507870645089392Rat
11445698LOC108352088ferritin light chain 1 pseudogene104582181045822738Rat
11489702LOC108352089glyceraldehyde-3-phosphate dehydrogenase pseudogene104671075546713183Rat
11493377LOC108352087obscurin-like104533800545351661Rat

Nucleotide Sequences
GenBank Nucleotide JH617018 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (Rnor_6.0)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
631554Bp133Blood pressure QTL 1330.005arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1076442166221621Rat
2298544Neuinf9Neuroinflammation QTL 94.6nervous system integrity trait (VT:0010566)spinal cord complement component 1, q subcomponent, B chain mRNA level (CMO:0002126)10587753664401490Rat
8662860Vetf10Vascular elastic tissue fragility QTL 10artery integrity trait (VT:0010639)number of ruptures of the internal elastic lamina of the abdominal aorta and iliac arteries (CMO:0002562)10622909575983805Rat
61427Cia16Collagen induced arthritis QTL 163.2joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)10642907599492409Rat
1578761Stresp21Stress response QTL 213.3thymus mass (VT:0004954)thymus wet weight (CMO:0000855)10752145052521450Rat
2303118Mamtr7Mammary tumor resistance QTL 70.003mammary gland integrity trait (VT:0010552)mammary tumor growth rate (CMO:0000344)109841807108540162Rat
9590310Scort19Serum corticosterone level QTL 196.30.001blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)101263951357639513Rat
9590268Scort13Serum corticosterone level QTL 133.260.001blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)101263951357639513Rat
9589136Insul27Insulin level QTL 2710.460.001blood insulin amount (VT:0001560)plasma insulin level (CMO:0000342)101263951357639513Rat
2301967Cm73Cardiac mass QTL 734.55heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)101482789492423564Rat
631268Cia21Collagen induced arthritis QTL 213.1joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1014827894107857673Rat
2316949Gluco60Glucose level QTL 603.7blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)1014827894110992275Rat
1354587Kidm21Kidney mass QTL 213.3kidney mass (VT:0002707)right kidney wet weight (CMO:0000082)101537547462469074Rat
631564Apr3Acute phase response QTL 33.9blood interleukin-6 amount (VT:0008595)plasma interleukin-6 level (CMO:0001927)101646873661468736Rat
6893350Bw99Body weight QTL 990.870.16body mass (VT:0001259)body weight (CMO:0000012)11712154262121542Rat
6893352Bw100Body weight QTL 1000.330.6body mass (VT:0001259)body weight (CMO:0000012)11712154262121542Rat
631532Cm50Cardiac mass QTL 506.6heart mass (VT:0007028)calculated heart weight (CMO:0000073)101824639453637634Rat
1598852Anxrr19Anxiety related response QTL 195.07body movement coordination trait (VT:0005424)number of rearing movements in an experimental apparatus (CMO:0001752)101940281464402814Rat
1554317Bmd4Bone mineral density QTL 49.40.0001lumbar vertebra mineral mass (VT:0010511)volumetric bone mineral density (CMO:0001553)1020170031102897474Rat
70223Bp57Blood pressure QTL 575arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)102152390683549467Rat
70188BpQTLcluster1Blood pressure QTL cluster 14.864arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)12152390690312401Rat
70188BpQTLcluster1Blood pressure QTL cluster 14.864arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)12152390690312401Rat
70188BpQTLcluster1Blood pressure QTL cluster 14.864arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)12152390690312401Rat
70188BpQTLcluster1Blood pressure QTL cluster 14.864arterial blood pressure trait (VT:2000000)pulse pressure (CMO:0000292)12152390690312401Rat
70198BpQTLcluster9Blood pressure QTL cluster 92.94arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)102152390690312401Rat
1581497Esta1Estrogen-induced thymic atrophy QTL 1thymus mass (VT:0004954)thymus wet weight (CMO:0000855)102170776664648311Rat
724556Pur2Proteinuria QTL 25.5urine protein amount (VT:0005160)urine protein level (CMO:0000591)102290149793886300Rat
1331762Rf40Renal function QTL 403.873kidney blood vessel physiology trait (VT:0100012)absolute change in renal vascular resistance (CMO:0001900)102386101566539843Rat
1331791Cm31Cardiac mass QTL 313.84606heart mass (VT:0007028)heart wet weight (CMO:0000069)1023861015112626471Rat
631267Cia20Collagen induced arthritis QTL 203.2joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1024483076107857673Rat
61325Aia5Adjuvant induced arthritis QTL 50.01joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1024483076107857673Rat
61354Pia10Pristane induced arthritis QTL 100.01joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1024483076107857673Rat
634329Pia15Pristane induced arthritis QTL 153.1joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)102488408447487910Rat
70224Eae3Experimental allergic encephalomyelitis QTL 34.1nervous system integrity trait (VT:0010566)experimental autoimmune encephalomyelitis incidence/prevalence measurement (CMO:0001046)102723753064648311Rat
1298069Bp168Blood pressure QTL 1685.5blood pressure trait (VT:0000183)systolic blood pressure (CMO:0000004)1027237530101482600Rat
631542Bp82Blood pressure QTL 826.8arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1027237530102427718Rat
2300171Bmd58Bone mineral density QTL 584.90.0001lumbar vertebra mineral mass (VT:0010511)volumetric bone mineral density (CMO:0001553)102878928073789280Rat
1600371Mcs21Mammary carcinoma susceptibility QTL 213mammary gland integrity trait (VT:0010552)mammary tumor growth rate (CMO:0000344)103002135454057745Rat
2292441Bp308Blood pressure QTL 308arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)103009990975099909Rat
10402859Bp381Blood pressure QTL 3810.002arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)103009990975099909Rat
724527Bp148Blood pressure QTL 1480.0001arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)103098380575983805Rat
1576311Pia26Pristane induced arthritis QTL 26joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)103191939778343192Rat
1578779Tcas10Tongue tumor susceptibility QTL 103.12tongue integrity trait (VT:0010553)number of squamous cell tumors of the tongue with diameter greater than 3 mm (CMO:0001950)103317903078179030Rat
631557Bp136Blood pressure QTL 1360.003arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)103334319278343192Rat
1576319Cia29Collagen induced arthritis QTL 29joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)103513942480139424Rat
61332Eau3Experimental allergic uveoretinitis QTL 30.004uvea integrity trait (VT:0010551)experimental autoimmune uveitis score (CMO:0001504)103566946546851407Rat
6893342Cm78Cardiac mass QTL 780.10.88heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)103618592982675365Rat
631552Vetf2Vascular elastic tissue fragility QTL 24.50.0002aorta elastic tissue integrity trait (VT:0010556)artery internal elastic lamina non-tumorous lesion count (CMO:0001913)103618592995845311Rat
1354614Hpcl1Hepatic cholesterol level QTL 13.3liver cholesterol amount (VT:0010498)liver cholesterol level (CMO:0001597)103658437353645194Rat
1358897Stresp6Stress response QTL 64.170.022blood norepinephrine amount (VT:0005663)plasma norepinephrine level (CMO:0001010)103658437366539843Rat
61441Btemp1Thermal response to stress QTL 14body temperature trait (VT:0005535)core body temperature (CMO:0001036)103658456066015527Rat
2317042Aia20Adjuvant induced arthritis QTL 203.38joint integrity trait (VT:0010548)right rear ankle joint diameter (CMO:0002150)104051404485514044Rat
2317043Aia7Adjuvant induced arthritis QTL 73.82joint integrity trait (VT:0010548)left rear ankle joint diameter (CMO:0002149)104051404485514044Rat
1576308Schws1Schwannoma susceptibility QTL 10.0041nervous system integrity trait (VT:0010566)percentage of study population developing trigeminal nerve neurilemmomas during a period of time (CMO:0002017)1041260363106105607Rat
631269Cia22Collagen induced arthritis QTL 228.9joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1041260363107857673Rat
631270Cia23Collagen induced arthritis QTL 233.9joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1041260363107857673Rat
8552805Bw145Body weight QTL 1452.2body mass (VT:0001259)change in body weight to body weight ratio (CMO:0002216)104318865981042642Rat
1298078Stresp5Stress response QTL 52.990.00025blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)1043289657108540162Rat
61463Bp12Blood pressure QTL 126.30.0001arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)104370495588704955Rat
11528628Bss116Bone structure and strength QTL 1166.460.00000038femur morphology trait (VT:0000559)femur length (CMO:0000442)104511428345744081Rat
11528631Bss117Bone structure and strength QTL 1176.410.000000389femur strength trait (VT:0010010)femoral neck ultimate force (CMO:0001703)104651052546995276Rat
2300218Hpcl2Hepatic cholesterol level QTL 2liver cholesterol amount (VT:0010498)liver cholesterol level (CMO:0001597)104659302198939209Rat
9589030Epfw9Epididymal fat weight QTL 919.240.001epididymal fat pad mass (VT:0010421)epididymal fat pad weight to body weight ratio (CMO:0000658)104684834691848346Rat
7411614Foco18Food consumption QTL 180.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)104684834691848346Rat
8694173Bw149Body weight QTL 1494.380.001body mass (VT:0001259)body weight gain (CMO:0000420)104684834691848346Rat


Additional Information

Database Acc Id Source(s)
UniGene Rn.148178 UniSTS
UniSTS 216004 UniSTS