RH132445 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: RH132445

Symbol: RH132445
Previously known as: AI454259; 
RGD ID: 5047642
Expected Size: 212 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.21551,850,615 - 51,850,827 (+)MAPPERmRatBN7.2
mRatBN7.23122,796,314 - 122,796,526 (+)MAPPERmRatBN7.2
Rnor_6.03128,444,710 - 128,444,921NCBIRnor6.0
Rnor_6.01558,657,814 - 58,658,025NCBIRnor6.0
Rnor_5.01562,348,259 - 62,348,470UniSTSRnor5.0
Rnor_5.03134,933,486 - 134,933,697UniSTSRnor5.0
RGSC_v3.43123,548,723 - 123,548,934UniSTSRGSC3.4
RGSC_v3.41557,502,475 - 57,502,686UniSTSRGSC3.4
Celera1551,468,698 - 51,468,909UniSTS
Celera3121,538,315 - 121,538,526UniSTS
Cytogenetic Map15q11UniSTS
Is Marker For: Genes:   Tsc22d1  


Annotation


References - curated
# Reference Title Reference Citation
1. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer CCTCAGCAACTGACTGACGTTT
Reverse Primer AAAGGTGTGGATTGTCCTTCCT
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
3850Tsc22d1TSC22 domain family, member 1155175048951850958Rat
41020731LOC120101677igE-binding protein-like3122794643122796663Rat



QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
2298549Neuinf12Neuroinflammation QTL 123.5nervous system integrity trait (VT:0010566)spinal cord beta-2 microglobulin mRNA level (CMO:0002125)15155302115Rat
631273Lecl2Lens clarity QTL 20.001lens clarity trait (VT:0001304)age of onset/diagnosis of cataract (CMO:0001584)151059608955596089Rat
2300167Bmd63Bone mineral density QTL 635.90.0001femur mineral mass (VT:0010011)volumetric bone mineral density (CMO:0001553)151111114256111142Rat
2300173Bmd62Bone mineral density QTL 6212.80.0001lumbar vertebra mineral mass (VT:0010511)volumetric bone mineral density (CMO:0001553)151111114256111142Rat
2293688Bss29Bone structure and strength QTL 295.310.0001femur morphology trait (VT:0000559)femur midshaft cortical cross-sectional area (CMO:0001663)151111114256111142Rat
2317750Glom26Glomerulus QTL 264.3urine protein amount (VT:0005160)urine protein level (CMO:0000591)151249614165205939Rat
61424Scl1Serum cholesterol level QTL 17.70.001blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)151672552880672115Rat
1331729Rf42Renal function QTL 423.071kidney blood vessel physiology trait (VT:0100012)absolute change in renal blood flow rate (CMO:0001168)151736289773690657Rat
10054130Srcrt8Stress Responsive Cort QTL 82.180.0085blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)152211793367117933Rat
1578646Bmd18Bone mineral density QTL 185.2femur mineral mass (VT:0010011)trabecular volumetric bone mineral density (CMO:0001729)152280624098288169Rat
1578647Bmd17Bone mineral density QTL 174femur mineral mass (VT:0010011)total volumetric bone mineral density (CMO:0001728)152280624098288169Rat
1578660Bss19Bone structure and strength QTL 194.3femur morphology trait (VT:0000559)bone trabecular cross-sectional area (CMO:0002311)152280624098288169Rat
1582214Stl21Serum triglyceride level QTL 213.10.022blood triglyceride amount (VT:0002644)serum triglyceride level (CMO:0000360)152803066582262678Rat
1582227Gluco30Glucose level QTL 303.60.0003blood glucose amount (VT:0000188)absolute change in blood glucose level area under curve (CMO:0002034)152803066582262678Rat
1582228Epfw3Epididymal fat weight QTL 34.10.0002epididymal fat pad mass (VT:0010421)epididymal fat pad weight to body weight ratio (CMO:0000658)152803066582262678Rat
1582242Gluco28Glucose level QTL 283.30.0008blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)152803066582262678Rat
1582244Bw79Body weight QTL 7940.0002epididymal fat pad mass (VT:0010421)epididymal fat pad weight to body weight ratio (CMO:0000658)152803066582262678Rat
2293691Bmd37Bone mineral density QTL 376.60.0001femur strength trait (VT:0010010)femur total energy absorbed before break (CMO:0001677)153361105871477291Rat
2293686Bmd36Bone mineral density QTL 367.40.0001femur strength trait (VT:0010010)femoral neck ultimate force (CMO:0001703)153361105871477291Rat
1598828Glom14Glomerulus QTL 142.5kidney glomerulus morphology trait (VT:0005325)index of glomerular damage (CMO:0001135)153405413979054139Rat
1300144Rf23Renal function QTL 233.61renal blood flow trait (VT:2000006)absolute change in renal vascular resistance (CMO:0001900)154063126898288169Rat
724545Niddm54Non-insulin dependent diabetes mellitus QTL 540.02blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)155079449473699215Rat
70216Cm14Cardiac mass QTL 142.1heart mass (VT:0007028)heart wet weight (CMO:0000069)331172320163586636Rat
619618Rf3Renal disease susceptibility QTL 36.50.001urine albumin amount (VT:0002871)urine albumin excretion rate to body weight ratio (CMO:0001270)3107693393152693393Rat
724532Cm17Cardiac mass QTL 172heart mass (VT:0007028)calculated heart weight (CMO:0000073)395735366140735366Rat
631649Bp123Blood pressure QTL 1233.2arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)389772419134772419Rat
631841Niddm39Non-insulin dependent diabetes mellitus QTL 393.36blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)394856903159898684Rat
1300159Kidm4Kidney mass QTL 43.83kidney mass (VT:0002707)right kidney wet weight to body weight ratio (CMO:0001953)3121056165157309487Rat
1300173Rf11Renal function QTL 113.38renal blood flow trait (VT:2000006)absolute change in renal blood flow rate (CMO:0001168)3121056165145956249Rat
1358362Srcrt2Stress Responsive Cort QTL 22.78blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)338192233133483320Rat
1331758Bp207Blood pressure QTL 2072.848arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)3112287552135181505Rat
1354611Despr2Despair related QTL 23.030.0028locomotor behavior trait (VT:0001392)amount of time spent in voluntary immobility (CMO:0001043)397084464142084464Rat
1358204Insglur1Insulin/glucose ratio QTL 13.8blood glucose amount (VT:0000188)serum insulin level (CMO:0000358)3115638168135181505Rat
1358204Insglur1Insulin/glucose ratio QTL 13.8blood glucose amount (VT:0000188)serum glucose level (CMO:0000543)3115638168135181505Rat
1559282Emca5Estrogen-induced mammary cancer QTL 53.9mammary gland integrity trait (VT:0010552)percentage of study population developing mammary tumors during a period of time (CMO:0000948)343827364169034231Rat
1581546Pur13Proteinuria QTL 132.930.0335urine total protein amount (VT:0000032)urine protein excretion rate (CMO:0000759)378196190146592722Rat
1581568Rf53Renal function QTL 53urine total protein amount (VT:0000032)urine protein excretion rate to body weight ratio (CMO:0001099)356395968161299569Rat
1598877Bp285Blood pressure QTL 2851.50.03arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)3120538241165538241Rat
1576306Schws3Schwannoma susceptibility QTL 30.001nervous system integrity trait (VT:0010566)percentage of study population developing trigeminal nerve neurilemmomas during a period of time (CMO:0002017)3118839124163839124Rat
1578754Stresp16Stress response QTL 1640.001blood renin amount (VT:0003349)plasma renin activity level (CMO:0000116)3112681431157681431Rat
2292591Esta4Estrogen-induced thymic atrophy QTL 4thymus mass (VT:0004954)thymus wet weight (CMO:0000855)347233211147415807Rat
2293087Iddm27Insulin dependent diabetes mellitus QTL 272.68blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)397551417147415807Rat
2302373Gluco39Glucose level QTL 395.01blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)398535386161695835Rat
2301970Bw81Body weight QTL 815.19body mass (VT:0001259)body weight (CMO:0000012)341874578155617519Rat
2301971Cm71Cardiac mass QTL 714.63heart left ventricle mass (VT:0007031)heart left ventricle weight (CMO:0000776)341874578155617519Rat
2312659Slep7Serum leptin concentration QTL 70.001blood leptin amount (VT:0005667)serum leptin level (CMO:0000780)398535255168026850Rat
2312670Bw94Body weight QTL 940.01inguinal fat pad mass (VT:0010424)inguinal fat pad weight to body weight ratio (CMO:0001253)398535255168026850Rat
2312673Scl63Serum cholesterol level QTL 630.001blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)398535255168026850Rat
8694437Bw167Body weight QTL 16722.460.001retroperitoneal fat pad mass (VT:0010430)retroperitoneal fat pad weight to body weight ratio (CMO:0000635)391797474136797474Rat
8662816Vetf4Vascular elastic tissue fragility QTL 44renal artery integrity trait (VT:0010642)number of ruptures of the internal elastic lamina of the renal arteries (CMO:0002563)359242096157323038Rat
10755461Coatc16Coat color QTL 16coat/hair pigmentation trait (VT:0010463)pigmented ventral coat/hair area to total ventral coat/hair area ratio (CMO:0001812)3122438700167438700Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 498545 UniSTS
UniSTS 215728 UniSTS