RH131937 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: RH131937

Symbol: RH131937
Previously known as: AI113250; 
RGD ID: 5046756
Expected Size: 198 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.26137,885,505 - 137,885,703 (+)MAPPERmRatBN7.2
Rnor_6.06144,825,959 - 144,826,156NCBIRnor6.0
Rnor_5.06153,753,404 - 153,753,601UniSTSRnor5.0
RGSC_v3.46144,239,975 - 144,240,172UniSTSRGSC3.4
Celera6135,541,086 - 135,541,283UniSTS
RH 3.4 Map6923.9UniSTS
Cytogenetic Map6q33UniSTS
Is Marker For: Genes:   Ptprn2  


Annotation


References - curated
# Reference Title Reference Citation
1. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer CCATCATGAGAAAGACACCCAA
Reverse Primer ATAGGCGCCCTCATAATTGCT
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
61904Ptprn2protein tyrosine phosphatase, receptor type N26137439572138191575Rat
11464762LOC108351315uncharacterized LOC1083513156137871890137885796Rat

Nucleotide Sequences
GenBank Nucleotide CH474038 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM000236 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
731173Uae22Urinary albumin excretion QTL 2210.1urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)665531555140994061Rat
2290393Uae37Urinary albumin excretion QTL 370.0001urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)665531555140994061Rat
12801411Schws8Schwannoma susceptibility QTL 8nervous system integrity trait (VT:0010566)percentage of study population developing trigeminal nerve neurilemmomas during a period of time (CMO:0002017)694968928139968928Rat
8552796Vie3Viral induced encephalitis QTL 32.6brain integrity trait (VT:0010579)encephalitis incidence/prevalence measurement (CMO:0002361)696833997140994061Rat
1358355Srcrt4Stress Responsive Cort QTL 46.39blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)6100364669140994061Rat
71111Iddm8Insulin dependent diabetes mellitus QTL 81.90.002blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)6105156861140994061Rat
737976Pia24Pristane induced arthritis QTL 24joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)6112636280140994061Rat
2293085Iddm29Insulin dependent diabetes mellitus QTL 297.66blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)6122549046140286318Rat
61329Eae9Experimental allergic encephalomyelitis QTL 93.7body mass (VT:0001259)change in body weight (CMO:0002045)6122549046140994061Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 29714 UniSTS
UniSTS 215220 UniSTS