RH131281 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: RH131281

Symbol: RH131281
Also known as: AI059894; 
RGD ID: 5045618
Expected Size: 212 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.2687,541,165 - 87,541,377 (+)MAPPER
mRatBN7.24120,320,186 - 120,320,396 (+)MAPPER
Rnor_6.04119,765,305 - 119,765,514NCBIRnor6.0
Rnor_6.0885,518,643 - 85,518,854NCBIRnor6.0
Cytogenetic Map8q31UniSTS
Is Marker For: Genes:   Gsta4   LOC100909835  


Annotation


References - curated
1. RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer TTGTGGACAGAGTGGTTTCGTT
Reverse Primer AGAAGTTCCTGCAACCTGGAAG
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
6501756LOC100909835glutathione S-transferase alpha-4-like88551797485518889Rat
2323735LOC100362958hypothetical LOC1003629584119764433119765427Rat



QTLs in Region (Rnor_6.0)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
1581557Eae16Experimental allergic encephalomyelitis QTL 163.8nervous system integrity trait (VT:0010566)experimental autoimmune encephalomyelitis incidence/prevalence measurement (CMO:0001046)89531047119211942Rat
631650Stl6Serum triglyceride level QTL 640.0019blood triglyceride amount (VT:0002644)plasma triglyceride level (CMO:0000548)810938911120496129Rat
631271Lecl1Lens clarity QTL 10.001lens clarity trait (VT:0001304)age of onset/diagnosis of cataract (CMO:0001584)82146491991140553Rat
731182Uae24Urinary albumin excretion QTL 246.4urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)821813070100873963Rat
1358892Kidm26Kidney mass QTL 263.69kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)829867983106526740Rat
1358896Bp262Blood pressure QTL 2622.89arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)829867983106526740Rat
1358907Cm40Cardiac mass QTL 401.89heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)829867983106526740Rat
8662823Vetf5Vascular elastic tissue fragility QTL 51.9artery integrity trait (VT:0010639)patent ductus arteriosus score (CMO:0002566)830918112107206309Rat
1549908Neudeg1Neurodegradation QTL 15.50nervous system integrity trait (VT:0010566)logarithm of the ratio of the lesioned side motor neuron count to contralateral side motor neuron count (CMO:0001986)832888352101374135Rat
2313046Bss78Bone structure and strength QTL 783.50.0001tibia strength trait (VT:1000284)tibia total energy absorbed before break (CMO:0001736)83355866089058369Rat
2313057Bss76Bone structure and strength QTL 7630.0001tibia size trait (VT:0100001)tibia midshaft cross-sectional area (CMO:0001717)83355866089058369Rat
2313067Bss77Bone structure and strength QTL 773.10.0001tibia size trait (VT:0100001)tibia midshaft endosteal cross-sectional area (CMO:0001716)83355866089058369Rat
2313088Bss75Bone structure and strength QTL 753.10.0001body length (VT:0001256)body length, nose to rump (CMO:0000079)83355866089058369Rat
1578765Klgr1Kidney lesion grade QTL 13.30.0001kidney morphology trait (VT:0002135)organ lesion measurement (CMO:0000677)833558660109028082Rat
1578769Uae31Urinary albumin excretion QTL 313.30.001urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)833558660109028082Rat
1578755Pur5Proteinuria QTL 53.30.0001total urine protein amount (VT:0000032)urine total protein excretion rate (CMO:0000756)833558660109028082Rat
2316950Scl66Serum cholesterol level QTL 664.1blood cholesterol amount (VT:0000180)plasma total cholesterol level (CMO:0000585)833558764113580387Rat
1331838Niddm61Non-insulin dependent diabetes mellitus QTL 613.530.0004blood insulin amount (VT:0001560)plasma insulin level (CMO:0000342)839230130106506973Rat
737824Hcar10Hepatocarcinoma resistance QTL 102.9liver integrity trait (VT:0010547)liver tumorous lesion number (CMO:0001068)84421919789542960Rat
1358906Bp253Blood pressure QTL 25340.0004arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)844219197100873963Rat
1554321Bmd3Bone mineral density QTL 37.90.0001femur mineral mass (VT:0010011)volumetric bone mineral density (CMO:0001553)844458129118087517Rat
1298079Activ2Activity QTL 29.50.000001voluntary movement trait (VT:0003491)rearing measurement (CMO:0001515)84571234490712344Rat
70161Bp62Blood pressure QTL 622.90.001arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)84658843796998640Rat
12879882Am8Aortic mass QTL 80.001aorta mass (VT:0002845)aorta weight to aorta length to body weight ratio (CMO:0002722)847200750106394378Rat
12879878Bw183Body weight QTL 1830.001body mass (VT:0001259)body weight (CMO:0000012)847200750106394378Rat
12879879Cm99Cardiac mass QTL 990.001heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)847200750106394378Rat
12879880Cm100Cardiac mass QTL 1000.001heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)847200750106394378Rat
12879881Cm101Cardiac mass QTL 1010.001heart right ventricle mass (VT:0007033)heart right ventricle weight to body weight ratio (CMO:0000914)847200750106394378Rat
12879883Kidm65Kidney mass QTL 650.001kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)847200750106394378Rat
70197BpQTLcluster8Blood pressure QTL cluster 83.482arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)850529480128036471Rat
70197BpQTLcluster8Blood pressure QTL cluster 83.482arterial blood pressure trait (VT:2000000)pulse pressure (CMO:0000292)850529480128036471Rat
70197BpQTLcluster8Blood pressure QTL cluster 83.482arterial blood pressure trait (VT:2000000)absolute change in systolic blood pressure (CMO:0000607)850529480128036471Rat
70197BpQTLcluster8Blood pressure QTL cluster 83.482arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)850529480128036471Rat
1331837Bw23Body weight QTL 234.190.00007body mass (VT:0001259)body weight (CMO:0000012)850529563106506973Rat
2313086Bss60Bone structure and strength QTL 604.10.0001tibia length (VT:0004357)tibia length (CMO:0000450)85406504489058369Rat
4889938Bss89Bone structure and strength QTL 893.8tibia size trait (VT:0100001)tibia cortical bone volume (CMO:0001725)85406504489058369Rat
5684973Bss100Bone structure and strength QTL 1004.7tibia area (VT:1000281)tibia area measurement (CMO:0001382)85406504489058369Rat
1358912Bw51Body weight QTL 512.95body mass (VT:0001259)body weight (CMO:0000012)855435004115812386Rat
2303570Gluco48Glucose level QTL 482blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)855659105100659105Rat
2293697Bmd39Bone mineral density QTL 39femur strength trait (VT:0010010)femur total energy absorbed before break (CMO:0001677)858230766106394378Rat
1582243Bw66Body weight QTL 663.40.0048body mass (VT:0001259)body weight (CMO:0000012)85842551091990535Rat
1582254Kidm31Kidney mass QTL 313kidney mass (VT:0002707)both kidneys wet weight (CMO:0000085)85842551091990535Rat
631664Hcar3Hepatocarcinoma resistance QTL 32.90.0005liver integrity trait (VT:0010547)volume of individual liver tumorous lesion (CMO:0001078)858425510106526740Rat
1300177Cm2Cardiac mass QTL 23.65heart mass (VT:0007028)heart weight (CMO:0000017)859234112108068306Rat
2301402Bp316Blood pressure QTL 3160.005arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)861394378106394378Rat
10402857Bp380Blood pressure QTL 3800.95arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)861394378106394378Rat
2303171Bp331Blood pressure QTL 3315.570.005arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)865717449128033050Rat
631653Bp125Blood pressure QTL 1253.3arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)872849686117849686Rat
631210Bw3Body weight QTL35.9mesenteric fat pad mass (VT:0010427)mesenteric fat pad weight as a percentage of body weight (CMO:0000654)874917593121080545Rat
1300171Bp184Blood pressure QTL 1843.66arterial blood pressure trait (VT:2000000)blood pressure time series experimental set point of the baroreceptor response (CMO:0002593)876103982127182642Rat
9590292Uminl3Urine mineral level QTL 33.620.001urine mineral amount (VT:0015086)urine electrolyte level (CMO:0000593)878805083123805083Rat
8694446Bw170Body weight QTL 17012.070.001retroperitoneal fat pad mass (VT:0010430)retroperitoneal fat pad weight to body weight ratio (CMO:0000635)878805083123805083Rat
8694200Abfw4Abdominal fat weight QTL 49.070.001visceral adipose mass (VT:0010063)abdominal fat pad weight to body weight ratio (CMO:0000095)878805083123805083Rat
8694392Bw161Body weight QTL 1618.060.001body lean mass (VT:0010483)lean tissue morphological measurement (CMO:0002184)878805083123805083Rat
1549909Stresp11Stress response QTL 116.830.0019stress-related behavior trait (VT:0010451)number of approaches toward negative stimulus before onset of defensive burying response (CMO:0001960)880697934125697934Rat
10450865Bw175Body weight QTL 1754.1total fat pad mass (VT:0015008)adipose tissue molecular composition measurement (CMO:0000484)88141389891140553Rat
634332Pia18Pristane induced arthritis QTL 184joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)88141405889542815Rat
2300181Bmd55Bone mineral density QTL 555.70.0001femur mineral mass (VT:0010011)volumetric bone mineral density (CMO:0001553)883894304128894304Rat
2303168Bp330Blood pressure QTL 3304.250.017arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)43043231145254791Rat
2316958Gluco58Glucose level QTL 5810blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)47850904182171018Rat
10755501Bp390Blood pressure QTL 3902.5arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)423850384169318094Rat
1358352Srcrt3Stress Responsive Cort QTL 32.29blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)436615599145611886Rat
1576305Emca6Estrogen-induced mammary cancer QTL 65.8mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)443414605155469929Rat
1354660Salc1Saline consumption QTL 111.26drinking behavior trait (VT:0001422)saline drink intake rate (CMO:0001627)443414792146942075Rat
1354612Foco1Food consumption QTL 18.87eating behavior trait (VT:0001431)food intake rate (CMO:0000427)443414792146942075Rat
1298082Stresp4Stress response QTL 4blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)446898276145611886Rat
2312567Glom19Glomerulus QTL 191.90.006kidney glomerulus morphology trait (VT:0005325)index of glomerular damage (CMO:0001135)449906054145611886Rat
70200Alc18Alcohol consumption QTL 189.2drinking behavior trait (VT:0001422)ethanol intake volume to total fluid intake volume ratio (CMO:0001591)455324953148360954Rat
1641833Alc21Alcohol consumption QTL 218.60.0001drinking behavior trait (VT:0001422)ethanol drink intake rate (CMO:0001407)455375865125671711Rat
738009Sach4Saccharine consumption QTL 44.90.000016consumption behavior trait (VT:0002069)saccharin intake volume to total fluid intake volume ratio (CMO:0001601)458640017154427984Rat
738016Alc16Alcohol consumption QTL 163.60.00015consumption behavior trait (VT:0002069)ethanol drink intake rate to body weight ratio (CMO:0001616)458640017154427984Rat
738031Alc14Alcohol consumption QTL 147.60.00003consumption behavior trait (VT:0002069)ethanol drink intake rate to body weight ratio (CMO:0001616)458640017154427984Rat
61418Pia5Pristane induced arthritis QTL 54.5joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)461038901127777403Rat
1641919Alc22Alcohol consumption QTL 220.0005drinking behavior trait (VT:0001422)ethanol drink intake rate (CMO:0001407)462947687125671711Rat
631674Iddm14Insulin dependent diabetes mellitus QTL 14blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)463537179157286626Rat
61330Eau1Experimental allergic uveoretinitis QTL 10.0003uvea integrity trait (VT:0010551)experimental autoimmune uveitis score (CMO:0001504)470773471132455556Rat
631646Stl4Serum triglyceride level QTL 46.50.0001blood triglyceride amount (VT:0002644)plasma triglyceride level (CMO:0000548)473786419132455556Rat
724522Bp146Blood pressure QTL 1462.20.0021arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)475258970120258970Rat
2302051Pia28Pristane induced arthritis QTL 285.30.001blood autoantibody amount (VT:0003725)serum immunoglobulin G-type rheumatoid factor level relative to an arbitrary reference serum (CMO:0002112)475258970120258970Rat
738015Pia9Pristane induced arthritis QTL 94.50.048joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)476567036121567036Rat
631662Hcar2Hepatocarcinoma resistance QTL 23.10.0003liver integrity trait (VT:0010547)volume of individual liver tumorous lesion (CMO:0001078)479555067124555067Rat
70177Xhs1X-ray hypersensitivity QTL 125.1intestine integrity trait (VT:0010554)post-insult time to onset of moribundity (CMO:0001896)481959983152055009Rat
1576316Ept5Estrogen-induced pituitary tumorigenesis QTL 53.8pituitary gland mass (VT:0010496)pituitary gland wet weight (CMO:0000853)484475257178931073Rat
634334Xhs3X-ray hypersensitivity QTL 310intestine integrity trait (VT:0010554)post-insult time to onset of moribundity (CMO:0001896)485794049129615056Rat
1582232Gluco25Glucose level QTL 253.60.0023blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)486312589146942261Rat
12798523Anxrr56Anxiety related response QTL 562.830.05locomotor behavior trait (VT:0001392)amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)486312589147702403Rat
1358202Gluco11Glucose level QTL 112.40.02adipocyte glucose uptake trait (VT:0004185)absolute change in adipocyte glucose uptake (CMO:0000873)486438317168047091Rat
61476Aia3Adjuvant induced arthritis QTL 33.9joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)486532519131532519Rat
1578662Bss15Bone structure and strength QTL 1519.6femur width (VT:1000666)femoral neck width (CMO:0001695)487136446132136446Rat
1578670Bss14Bone structure and strength QTL 1416.4femur morphology trait (VT:0000559)bone trabecular cross-sectional area (CMO:0002311)487136446132136446Rat
631689Scl4Serum cholesterol level QTL 41.90.008blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)494414208139414208Rat
634335Anxrr16Anxiety related response QTL 167.22locomotor behavior trait (VT:0001392)number of entries into a discrete space in an experimental apparatus (CMO:0000960)494893247168046938Rat
61434Cia3Collagen induced arthritis QTL 34.8joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)499066823144066823Rat
2302049Pia32Pristane induced arthritis QTL 325.10.001blood autoantibody amount (VT:0003725)serum immunoglobulin G-type rheumatoid factor level relative to an arbitrary reference serum (CMO:0002112)4105277348150277348Rat
61406Scwia1Streptococcal cell wall induced arthritis QTL 12.3joint integrity trait (VT:0010548)experimental arthritis severity measurement (CMO:0001459)4105682594150682594Rat
737821Hcar9Hepatocarcinoma resistance QTL 93.7liver integrity trait (VT:0010547)volume of individual liver tumorous lesion (CMO:0001078)4105971071168047091Rat
731165Uae21Urinary albumin excretion QTL 212.40.0001urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)4106347236151347236Rat
1331759Hrtrt13Heart rate QTL 133.54628heart pumping trait (VT:2000009)heart rate (CMO:0000002)4108876717169215811Rat
1549832Bss3Bone structure and strength QTL 311femur morphology trait (VT:0000559)femur midshaft cortical cross-sectional area (CMO:0001663)4109636356154636356Rat
7207480Bss105Bone structure and strength QTL 1058.1femur strength trait (VT:0010010)femur midshaft polar moment of inertia (CMO:0001669)4109636356154636356Rat
6478760Anxrr45Anxiety related response QTL 450.06717locomotor behavior trait (VT:0001392)amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)4110702761155702761Rat
6478763Anxrr46Anxiety related response QTL 460.07428locomotor behavior trait (VT:0001392)amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)4110702761155702761Rat
12798519Anxrr54Anxiety related response QTL 542.540.05locomotor behavior trait (VT:0001392)distance moved per unit of time into, out of or within a discrete space in an experimental apparatus (CMO:0001493)4112807675157807675Rat
1300116Hrtrt5Heart rate QTL 53.76heart pumping trait (VT:2000009)heart rate (CMO:0000002)4115372758150038284Rat
1331802Srn5Serum renin concentration QTL 53.045renin activity (VT:0005581)plasma renin activity level (CMO:0000116)4116726724157291438Rat
724535Cm18Cardiac mass QTL 182.6heart mass (VT:0007028)calculated heart weight (CMO:0000073)4117926139162926139Rat
70201Gcr1Gastric cancer resistance QTL 12.7stomach morphology trait (VT:0000470)stomach tumor susceptibility score (CMO:0002043)4119705414146087100Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 100909835 UniSTS
  300850 UniSTS
UniSTS 214564 UniSTS