RH130151 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: RH130151

Symbol: RH130151
Previously known as: AA998146; 
RGD ID: 5043656
Expected Size: 193 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.2X60,525,902 - 60,526,095 (+)MAPPERmRatBN7.2
Rnor_6.0X64,888,165 - 64,888,357NCBIRnor6.0
Rnor_5.0X68,163,129 - 68,163,321UniSTSRnor5.0
RGSC_v3.4X83,218,773 - 83,218,965UniSTSRGSC3.4
CeleraX60,944,291 - 60,944,483UniSTS
Cytogenetic MapXq31UniSTS
Is Marker For: Genes:   Zc4h2  


Annotation


References - curated
# Reference Title Reference Citation
1. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer TTCATCAGTCAGCCCTAGATTT
Reverse Primer TTCTGTGAGGTAGCTTCAGGTT
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
1561708Zc4h2zinc finger C4H2-type containingX6052570660546519Rat

Nucleotide Sequences
RefSeq Transcripts NM_001126374 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
GenBank Nucleotide BC162002 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
61430Cia18Collagen induced arthritis QTL 183.1joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)X14843113120568734Rat
1598837Memor13Memory QTL 133.2exploratory behavior trait (VT:0010471)difference between time of physical contact/close proximity of test subject and social stimulus during sample phase and test phase (CMO:0002678)X41052407146860749Rat
738035Stresp1Stress response QTL 14.960.000011stress-related behavior trait (VT:0010451)defensive burying - copingX41304447112935181Rat
70221Bp56Blood pressure QTL 564.9arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)X5704214165612192Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 367838 UniSTS
UniSTS 213438 UniSTS