RH129386 Marker Search Result - Rat Genome Database
Submit Data |  Help |  Video Tutorials |  News |  Publications |  FTP Download |  REST API |  Citing RGD |  Contact   

Marker: RH129386

Symbol: RH129386
Also known as: AA963988; 
RGD ID: 5042354
Expected Size: 197 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
Rnor_6.0952,819,793 - 52,819,989NCBIRnor6.0
Rnor_6.0952,894,707 - 52,894,903NCBIRnor6.0
Rnor_5.0952,560,523 - 52,560,719UniSTSRnor5.0
Rnor_5.0952,485,609 - 52,485,805UniSTSRnor5.0
RGSC_v3.4944,977,772 - 44,977,968UniSTSRGSC3.4
Celera945,701,217 - 45,701,413UniSTS
Cytogenetic Map9q22UniSTS
Is Marker For: Genes:   Slc40a1   LOC100911874  


Annotation


References - curated
1. RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer TGCTCTGTACAAGCTCATCATT
Reverse Primer TTAAAGCATGTTATTGGTGTGG
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
620180Slc40a1solute carrier family 40 member 195281945152830461Rat
2323350LOC100363291aspartate aminotransferase-like95285614652861184Rat
6490105LOC100911874solute carrier family 40 member 1-like95281938652831441Rat
11441106NEWGENE_620180solute carrier family 40 member 195289430052913267Rat



QTLs in Region (Rnor_6.0)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
10054125Srcrt7Stress Responsive Cort QTL 73.330.0011blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)9105522293442944Rat
11353947Bp392Blood pressure QTL 392arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)91221677157216771Rat
9589133Insul26Insulin level QTL 2617.960.001blood insulin amount (VT:0001560)plasma insulin level (CMO:0000342)91242546357425463Rat
7411609Foco16Food consumption QTL 1625.60.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)91242546357425463Rat
631680Cm11Cardiac mass QTL 113.10.00089heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)92488509969885099Rat
70186Niddm26Non-insulin dependent diabetes mellitus QTL 263.87blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)92569234292741406Rat
631643Bp120Blood pressure QTL 12030.004arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)92569237370692373Rat
1598823Memor16Memory QTL 161.9exploratory behavior trait (VT:0010471)difference between time of physical contact/close proximity of test subject and social stimulus during sample phase and test phase (CMO:0002678)92575432054885226Rat
7207805Bmd88Bone mineral density QTL 884femur mineral mass (VT:0010011)total volumetric bone mineral density (CMO:0001728)92748603663264281Rat
1300180Bw14Body weight QTL 143.776body mass (VT:0001259)body weight (CMO:0000012)92748603666757620Rat
7207814Bmd91Bone mineral density QTL 913.5femur size trait (VT:1000369)femoral neck cross-sectional area (CMO:0001697)92748615588333183Rat
70218Cm28Cardiac mass QTL 288.30.0001heart mass (VT:0007028)heart wet weight (CMO:0000069)92907507983686404Rat
724544Uae9Urinary albumin excretion QTL 94.5urine albumin amount (VT:0002871)urine albumin level (CMO:0000130)929075079122095297Rat
731164Uae25Urinary albumin excretion QTL 253.50.0001urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)929466970107878528Rat
1641894Alcrsp12Alcohol response QTL 12response to alcohol trait (VT:0010489)brain neurotensin receptor 1 density (CMO:0002068)93238513377385133Rat
7411571Bw138Body weight QTL 13814.30.001body mass (VT:0001259)body weight gain (CMO:0000420)93764235182642351Rat
7411656Foco26Food consumption QTL 269.80.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)93764235182642351Rat
1598834Memor11Memory QTL 112.5exploratory behavior trait (VT:0010471)average horizontal distance in proximity to the target during voluntary locomotion in an experimental apparatus (CMO:0002674)94126103490024806Rat
8662828Vetf6Vascular elastic tissue fragility QTL 63.9artery integrity trait (VT:0010639)patent ductus arteriosus score (CMO:0002566)94126103498606834Rat
2290450Scl57Serum cholesterol level QTL 574.15blood cholesterol amount (VT:0000180)plasma total cholesterol level (CMO:0000585)941261034102531865Rat
6903941Pur31Proteinuria QTL 310.036total urine protein amount (VT:0000032)urine protein excretion rate (CMO:0000759)94657976991579769Rat
11353949Bp393Blood pressure QTL 393arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)94657976991579769Rat
61352Bp34Blood pressure QTL 345arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)94695242783686153Rat
10058949Gmadr5Adrenal mass QTL 520.014adrenal gland mass (VT:0010420)both adrenal glands wet weight to body weight ratio (CMO:0002411)94724896594124663Rat
6903937Bp356Blood pressure QTL 3560.001arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)95268687457216771Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 100911874 UniSTS
  170840 UniSTS
UniGene Rn.15324 UniSTS
UniSTS 212693 UniSTS