RH129293 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: RH129293

Symbol: RH129293
Also known as: AA963457; 
RGD ID: 5042192
Expected Size: 210 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.2365,584,376 - 65,584,586 (+)MAPPER
mRatBN7.2873,495,102 - 73,495,313 (+)MAPPER
Rnor_6.0367,896,073 - 67,896,282NCBIRnor6.0
Rnor_6.0879,434,689 - 79,434,899NCBIRnor6.0
Rnor_5.0374,452,418 - 74,452,627UniSTSRnor5.0
RGSC_v3.4363,519,302 - 63,519,511UniSTSRGSC3.4
RGSC_v3.4877,363,860 - 77,364,070UniSTSRGSC3.4
Celera365,030,159 - 65,030,368UniSTS
Cytogenetic Map8q24UniSTS
Cytogenetic Map3q24UniSTS
Is Marker For: Genes:   Nup35   LOC367107  


Annotation


References - curated
1. RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer CTCTGTGGAATTCATCCATCTT
Reverse Primer CCTTTGTTTAAGGAGACAGCTC
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
1303069Nup35nucleoporin 3536786678467896828Rat
1592006LOC367107similar to mitotic phosphoprotein 4487943431679436213Rat



QTLs in Region (Rnor_6.0)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
2303593Gluco46Glucose level QTL 463blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)32990825574908255Rat
737818Hcar12Hepatocarcinoma resistance QTL 122.6liver integrity trait (VT:0010547)volume of individual liver tumorous lesion (CMO:0001078)330114912123700444Rat
631647Bp122Blood pressure QTL 1226.2arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)33213099777130997Rat
631685Bp118Blood pressure QTL 1183.2arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)32465522569655225Rat
738019Anxrr10Anxiety related response QTL 103.9exploratory behavior trait (VT:0010471)number of entries into a discrete space in an experimental apparatus (CMO:0000960)34042292185422921Rat
9590286Uminl1Urine mineral level QTL 13.50.001urine mineral amount (VT:0015086)urine electrolyte level (CMO:0000593)32968273274682732Rat
8694196Abfw2Abdominal fat weight QTL 216.580.001visceral adipose mass (VT:0010063)abdominal fat pad weight to body weight ratio (CMO:0000095)32968273274682732Rat
8694386Bw159Body weight QTL 1594.520.001body lean mass (VT:0010483)lean tissue morphological measurement (CMO:0002184)32968273274682732Rat
8552950Pigfal12Plasma insulin-like growth factor 1 level QTL 127.3blood insulin-like growth factor amount (VT:0010479)plasma insulin-like growth factor 1 level (CMO:0001299)32968273274682732Rat
8662816Vetf4Vascular elastic tissue fragility QTL 44renal artery integrity trait (VT:0010642)number of ruptures of the internal elastic lamina of the renal arteries (CMO:0002563)361241033165369047Rat
1300111Rf12Renal function QTL 123.78renal blood flow trait (VT:2000006)absolute change in renal blood flow rate (CMO:0001168)362922868127023997Rat
1358362Srcrt2Stress Responsive Cort QTL 22.78blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)339248391140271184Rat
1331795Rf30Renal function QTL 303.708urine potassium amount (VT:0010539)urine potassium level (CMO:0000128)34052359392654473Rat
1300178Hrtrt4Heart rate QTL 43.74heart pumping trait (VT:2000009)heart rate (CMO:0000002)34540605894467785Rat
1354590Despr11Despair related QTL 110.000031locomotor behavior trait (VT:0001392)amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)32990825574908255Rat
1354597Kidm13Kidney mass QTL 132.9kidney mass (VT:0002707)right kidney wet weight (CMO:0000082)343295930108914061Rat
1358186Ept2Estrogen-induced pituitary tumorigenesis QTL 28.3pituitary gland mass (VT:0010496)pituitary gland wet weight (CMO:0000853)348562146115249962Rat
1358885Bp251Blood pressure QTL 2513.8arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)310639528127023997Rat
1358888Bp264Blood pressure QTL 2644.43arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)310639528127023997Rat
1358905Hrtrt17Heart rate QTL 175.90.000014heart pumping trait (VT:2000009)heart rate (CMO:0000002)31009408193415837Rat
1358293Bw38Body weight QTL 3860.0000031body mass (VT:0001259)body weight (CMO:0000012)356735995101735995Rat
1559282Emca5Estrogen-induced mammary cancer QTL 53.9mammary gland integrity trait (VT:0010552)percentage of study population developing mammary tumors during a period of time (CMO:0000948)345406058177699992Rat
1581503Cm58Cardiac mass QTL 582.70.05heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)345406058127023997Rat
1581568Rf53Renal function QTL 53total urine protein amount (VT:0000032)urine protein excretion rate to body weight ratio (CMO:0001099)358204463170534769Rat
61356Bp37Blood pressure QTL 373blood pressure trait (VT:0000183)systolic blood pressure (CMO:0000004)33213099777130997Rat
61377Edpm3Estrogen-dependent pituitary mass QTL 37.050.038pituitary gland mass (VT:0010496)pituitary gland wet weight (CMO:0000853)35463104693415673Rat
61419Cia11Collagen induced arthritis QTL 115.6joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)334394121103141944Rat
70216Cm14Cardiac mass QTL 142.1heart mass (VT:0007028)heart wet weight (CMO:0000069)330846101172879276Rat
2290452Scl56Serum cholesterol level QTL 562.26blood cholesterol amount (VT:0000180)plasma total cholesterol level (CMO:0000585)3195176874Rat
2292591Esta4Estrogen-induced thymic atrophy QTL 4thymus mass (VT:0004954)thymus wet weight (CMO:0000855)348561928155263151Rat
2292613Ept16Estrogen-induced pituitary tumorigenesis QTL 168.3pituitary gland mass (VT:0010496)pituitary gland wet weight (CMO:0000853)348562146115249962Rat
631200Cm25Cardiac mass QTL 254.80.0001heart left ventricle mass (VT:0007031)heart left ventricle wet weight (CMO:0000071)36304905092654302Rat
724523Tsu1Thymus enlargement suppressive QTL 13.84thymus mass (VT:0004954)thymus weight to body weight ratio (CMO:0000612)351822008120917851Rat
2298542Neuinf11Neuroinflammation QTL 113.9nervous system integrity trait (VT:0010566)spinal cord complement component 1, q subcomponent, B chain mRNA level (CMO:0002126)31011931879772001Rat
2302055Pia30Pristane induced arthritis QTL 303.50.001blood autoantibody amount (VT:0003725)serum immunoglobulin M-type rheumatoid factor level relative to an arbitrary reference serum (CMO:0002111)32932171474321714Rat
2301400Cm68Cardiac mass QTL 680.001heart mass (VT:0007028)heart wet weight to body weight ratio (CMO:0002408)33110358972989078Rat
2301971Cm71Cardiac mass QTL 714.63heart left ventricle mass (VT:0007031)heart left ventricle weight (CMO:0000776)343295930163640485Rat
12879867Cm95Cardiac mass QTL 950.047heart right ventricle mass (VT:0007033)heart right ventricle weight to body weight ratio (CMO:0000914)33110358972989078Rat
1582221Kidm30Kidney mass QTL 303.50.0008kidney mass (VT:0002707)both kidneys wet weight (CMO:0000085)366711607119830094Rat
1331777Bw24Body weight QTL 243.503body mass (VT:0001259)body weight (CMO:0000012)34052359392654473Rat
12879868Am6Aortic mass QTL 60.001aorta mass (VT:0002845)aorta weight to aorta length to body weight ratio (CMO:0002722)33110358972989078Rat
1582238Bw68Body weight QTL 683.20.0064body mass (VT:0001259)body weight (CMO:0000012)354630948119830094Rat
1354589Bw31Body weight QTL 313.3body mass (VT:0001259)body weight (CMO:0000012)33347735481136227Rat
9590136Scort3Serum corticosterone level QTL 323.370.001blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)32968273274682732Rat
1354604Bw36Body weight QTL 362.9body mass (VT:0001259)body weight (CMO:0000012)333477354108914061Rat
1582210Bw71Body weight QTL 713.30.0012body mass (VT:0001259)body weight (CMO:0000012)366711607119830094Rat
12879866Cm94Cardiac mass QTL 940.001heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)33110358972989078Rat
11565452Kidm57Kidney mass QTL 570.001kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)33110358972989078Rat
1582218Bw74Body weight QTL 743.90.0021body mass (VT:0001259)body weight (CMO:0000012)354630948119830094Rat
2301970Bw81Body weight QTL 815.19body mass (VT:0001259)body weight (CMO:0000012)343295930163640485Rat
1582239Epfw1Epididymal fat weight QTL 14.50.0006epididymal fat pad mass (VT:0010421)epididymal fat pad weight to body weight ratio (CMO:0000658)354630948119830094Rat
731180Bp152Blood pressure QTL 1520.03arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)35524527695176874Rat
731180Bp152Blood pressure QTL 1520.03arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)35524527695176874Rat
731180Bp152Blood pressure QTL 1520.03arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)35524527695176874Rat
11565451Bw177Body weight QTL 1770.002body mass (VT:0001259)body weight (CMO:0000012)33110358972989078Rat
631665Bw8Body weight QTL 85.5body mass (VT:0001259)body weight (CMO:0000012)351821836124513579Rat
2316950Scl66Serum cholesterol level QTL 664.1blood cholesterol amount (VT:0000180)plasma total cholesterol level (CMO:0000585)833558764113580387Rat
737824Hcar10Hepatocarcinoma resistance QTL 102.9liver integrity trait (VT:0010547)liver tumorous lesion number (CMO:0001068)84421919789542960Rat
1298065Scl16Serum cholesterol level QTL 163.8blood cholesterol amount (VT:0000180)plasma total cholesterol level (CMO:0000585)83504141480041414Rat
1298079Activ2Activity QTL 29.50.000001voluntary movement trait (VT:0003491)rearing measurement (CMO:0001515)84571234490712344Rat
631650Stl6Serum triglyceride level QTL 640.0019blood triglyceride amount (VT:0002644)plasma triglyceride level (CMO:0000548)810938911120496129Rat
631653Bp125Blood pressure QTL 1253.3arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)872849686117849686Rat
631664Hcar3Hepatocarcinoma resistance QTL 32.90.0005liver integrity trait (VT:0010547)volume of individual liver tumorous lesion (CMO:0001078)858425510106526740Rat
4889938Bss89Bone structure and strength QTL 893.8tibia size trait (VT:0100001)tibia cortical bone volume (CMO:0001725)85406504489058369Rat
5684973Bss100Bone structure and strength QTL 1004.7tibia area (VT:1000281)tibia area measurement (CMO:0001382)85406504489058369Rat
731182Uae24Urinary albumin excretion QTL 246.4urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)821813070100873963Rat
8694446Bw170Body weight QTL 17012.070.001retroperitoneal fat pad mass (VT:0010430)retroperitoneal fat pad weight to body weight ratio (CMO:0000635)878805083123805083Rat
9590292Uminl3Urine mineral level QTL 33.620.001urine mineral amount (VT:0015086)urine electrolyte level (CMO:0000593)878805083123805083Rat
8694200Abfw4Abdominal fat weight QTL 49.070.001visceral adipose mass (VT:0010063)abdominal fat pad weight to body weight ratio (CMO:0000095)878805083123805083Rat
631271Lecl1Lens clarity QTL 10.001lens clarity trait (VT:0001304)age of onset/diagnosis of cataract (CMO:0001584)82146491991140553Rat
8694392Bw161Body weight QTL 1618.060.001body lean mass (VT:0010483)lean tissue morphological measurement (CMO:0002184)878805083123805083Rat
8662823Vetf5Vascular elastic tissue fragility QTL 51.9artery integrity trait (VT:0010639)patent ductus arteriosus score (CMO:0002566)830918112107206309Rat
10402857Bp380Blood pressure QTL 3800.95arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)861394378106394378Rat
1331769Rf39Renal function QTL 393.871urine output (VT:0003620)timed urine volume (CMO:0000260)84571234480003418Rat
1331838Niddm61Non-insulin dependent diabetes mellitus QTL 613.530.0004blood insulin amount (VT:0001560)plasma insulin level (CMO:0000342)839230130106506973Rat
1300171Bp184Blood pressure QTL 1843.66arterial blood pressure trait (VT:2000000)blood pressure time series experimental set point of the baroreceptor response (CMO:0002593)876103982127182642Rat
1300177Cm2Cardiac mass QTL 23.65heart mass (VT:0007028)heart weight (CMO:0000017)859234112108068306Rat
1549908Neudeg1Neurodegradation QTL 15.50nervous system integrity trait (VT:0010566)logarithm of the ratio of the lesioned side motor neuron count to contralateral side motor neuron count (CMO:0001986)832888352101374135Rat
1554321Bmd3Bone mineral density QTL 37.90.0001femur mineral mass (VT:0010011)volumetric bone mineral density (CMO:0001553)844458129118087517Rat
1358896Bp262Blood pressure QTL 2622.89arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)829867983106526740Rat
1358906Bp253Blood pressure QTL 25340.0004arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)844219197100873963Rat
1582254Kidm31Kidney mass QTL 313kidney mass (VT:0002707)both kidneys wet weight (CMO:0000085)85842551091990535Rat
1581557Eae16Experimental allergic encephalomyelitis QTL 163.8nervous system integrity trait (VT:0010566)experimental autoimmune encephalomyelitis incidence/prevalence measurement (CMO:0001046)89531047119211942Rat
1578755Pur5Proteinuria QTL 53.30.0001total urine protein amount (VT:0000032)urine total protein excretion rate (CMO:0000756)833558660109028082Rat
1578765Klgr1Kidney lesion grade QTL 13.30.0001kidney morphology trait (VT:0002135)organ lesion measurement (CMO:0000677)833558660109028082Rat
1578769Uae31Urinary albumin excretion QTL 313.30.001urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)833558660109028082Rat
70197BpQTLcluster8Blood pressure QTL cluster 83.482arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)850529480128036471Rat
70197BpQTLcluster8Blood pressure QTL cluster 83.482arterial blood pressure trait (VT:2000000)pulse pressure (CMO:0000292)850529480128036471Rat
70197BpQTLcluster8Blood pressure QTL cluster 83.482arterial blood pressure trait (VT:2000000)absolute change in systolic blood pressure (CMO:0000607)850529480128036471Rat
70197BpQTLcluster8Blood pressure QTL cluster 83.482arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)850529480128036471Rat
631210Bw3Body weight QTL35.9mesenteric fat pad mass (VT:0010427)mesenteric fat pad weight as a percentage of body weight (CMO:0000654)874917593121080545Rat
70161Bp62Blood pressure QTL 622.90.001arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)84658843796998640Rat
2303171Bp331Blood pressure QTL 3315.570.005arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)865717449128033050Rat
2303570Gluco48Glucose level QTL 482blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)855659105100659105Rat
2301402Bp316Blood pressure QTL 3160.005arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)861394378106394378Rat
12879882Am8Aortic mass QTL 80.001aorta mass (VT:0002845)aorta weight to aorta length to body weight ratio (CMO:0002722)847200750106394378Rat
12879879Cm99Cardiac mass QTL 990.001heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)847200750106394378Rat
1358912Bw51Body weight QTL 512.95body mass (VT:0001259)body weight (CMO:0000012)855435004115812386Rat
1582222Epfw2Epididymal fat weight QTL 23.20.0005epididymal fat pad mass (VT:0010421)epididymal fat pad weight to body weight ratio (CMO:0000658)83592559480925594Rat
61464Niddm11Non-insulin dependent diabetes mellitus QTL 113.10.001blood insulin amount (VT:0001560)plasma insulin level (CMO:0000342)83995802284958022Rat
12879881Cm101Cardiac mass QTL 1010.001heart right ventricle mass (VT:0007033)heart right ventricle weight to body weight ratio (CMO:0000914)847200750106394378Rat
1582243Bw66Body weight QTL 663.40.0048body mass (VT:0001259)body weight (CMO:0000012)85842551091990535Rat
2293697Bmd39Bone mineral density QTL 39femur strength trait (VT:0010010)femur total energy absorbed before break (CMO:0001677)858230766106394378Rat
61358Bp39Blood pressure QTL 392arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)83992790184927901Rat
1358907Cm40Cardiac mass QTL 401.89heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)829867983106526740Rat
2313067Bss77Bone structure and strength QTL 773.10.0001tibia size trait (VT:0100001)tibia midshaft endosteal cross-sectional area (CMO:0001716)83355866089058369Rat
12879883Kidm65Kidney mass QTL 650.001kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)847200750106394378Rat
2313086Bss60Bone structure and strength QTL 604.10.0001tibia length (VT:0004357)tibia length (CMO:0000450)85406504489058369Rat
2313088Bss75Bone structure and strength QTL 753.10.0001body length (VT:0001256)body length, nose to rump (CMO:0000079)83355866089058369Rat
2313057Bss76Bone structure and strength QTL 7630.0001tibia size trait (VT:0100001)tibia midshaft cross-sectional area (CMO:0001717)83355866089058369Rat
1358892Kidm26Kidney mass QTL 263.69kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)829867983106526740Rat
12879880Cm100Cardiac mass QTL 1000.001heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)847200750106394378Rat
12879878Bw183Body weight QTL 1830.001body mass (VT:0001259)body weight (CMO:0000012)847200750106394378Rat
1331837Bw23Body weight QTL 234.190.00007body mass (VT:0001259)body weight (CMO:0000012)850529563106506973Rat
2313046Bss78Bone structure and strength QTL 783.50.0001tibia strength trait (VT:1000284)tibia total energy absorbed before break (CMO:0001736)83355866089058369Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 295692 UniSTS
  367107 UniSTS
UniSTS 212600 UniSTS