RH127725 Marker Search Result - Rat Genome Database
Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: RH127725

Symbol: RH127725
Also known as: AA819280; 
RGD ID: 5039472
Expected Size: 194 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
Rnor_6.06138,190,294 - 138,190,487NCBIRnor6.0
Rnor_6.0650,598,166 - 50,598,359NCBIRnor6.0
Rnor_5.0659,273,393 - 59,273,586UniSTSRnor5.0
Rnor_5.06147,182,750 - 147,182,943UniSTSRnor5.0
RGSC_v3.4649,185,154 - 49,185,347UniSTSRGSC3.4
RGSC_v3.46138,387,490 - 138,387,683UniSTSRGSC3.4
Celera647,106,650 - 47,106,843UniSTS
RH 3.4 Map6284.7UniSTS
Cytogenetic Map6q32UniSTS
Cytogenetic Map6q16UniSTS
Is Marker For: Genes:   Dld   IgG-2a   LOC366772   LOC366738  


Annotation


References - curated
1. RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer TGTAAACTGCCAGGAATTTGGA
Reverse Primer TCTGTTGACAAGGAAGGAGCTG
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
735073Dlddihydrolipoamide dehydrogenase65059767750618694Rat
620623Slc26a3solute carrier family 26 member 365072508550766306Rat
1310703Cbll1Cbl proto-oncogene like 165077271850786861Rat
7499548LOC102555378uncharacterized LOC10255537865078699350811371Rat
3293Slc26a4solute carrier family 26 member 465080910350848443Rat
11449637LOC108351219uncharacterized LOC10835121965086432650869489Rat
11492151LOC108351220uncharacterized LOC10835122065087336050875303Rat
1359431Bcap29B-cell receptor-associated protein 2965088375850923743Rat
1311445Dus4ldihydrouridine synthase 4-like65092598750943546Rat
1563296Cog5component of oligomeric golgi complex 565095386851230860Rat
1310848Gpr22G protein-coupled receptor 2265101242151021253Rat
620444Hbp1HMG-box transcription factor 165123147951257699Rat
7663848LOC10255564560S ribosomal protein L18a-like65124572551246824Rat
3394Prkar2bprotein kinase cAMP-dependent type II regulatory subunit beta65126550951356383Rat
1306468Pik3cgphosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit gamma65146569651501234Rat
2320310LOC100361355hypothetical LOC10036135565157757451580670Rat
1560812Ccdc71lcoiled-coil domain containing 71-like65165949851666145Rat
11468726LOC108351221uncharacterized LOC10835122165171501351738361Rat
2321896LOC100360561Nxt2 protein-like65171594751716704Rat
11404619LOC108351222uncharacterized LOC10835122265198749751994096Rat
1598099LOC679971similar to carbonic anhydrase 1365209256452093817Rat
631365Namptnicotinamide phosphoribosyltransferase65212208552156473Rat
7745718LOC102547378meteorin-like protein-like65224161652244902Rat
7542438LOC102547473uncharacterized LOC10254747365225275852265855Rat
1359569Sypl1synaptophysin-like 165226592052286037Rat
1591286Cdhr3cadherin-related family member 365234463552402144Rat
7719070LOC102547703uncharacterized LOC10254770365244437752459882Rat
1305730Atxn7l1ataxin 7-like 165245993052680552Rat
7563724LOC102549100uncharacterized LOC10254910065260144352602613Rat
1307943Efcab10EF-hand calcium binding domain 1065270230452709223Rat
11378331LOC108351223uncharacterized LOC10835122365271288352715369Rat
2319872LOC100361597hypothetical LOC10036159765272915052729584Rat
1307824Polr1fRNA polymerase I subunit F65275110652768574Rat
1595482LOC680142similar to translocase of outer mitochondrial membrane 70 homolog A65282226652824509Rat
6486238LOC10091255640S ribosomal protein SA-like65284478952846565Rat
11406804LOC10835133160S ribosomal protein L24 pseudogene65297266652978414Rat
11468431LOC108351224uncharacterized LOC10835122465316157753183865Rat
7578807LOC102552384histone deacetylase 9-like65326971753292537Rat
1595449LOC680175similar to 40S ribosomal protein S2065336254153362956Rat
1311812Ferd3lFer3-like bHLH transcription factor65337170653372596Rat
621455Twist1twist family bHLH transcription factor 165340124153403235Rat
1594139LOC680293similar to developmental pluripotency associated 4 isoform 165346964753470889Rat
1310748Hdac9histone deacetylase 965348736754358694Rat
11367774LOC108351350uncharacterized LOC10835135065433690854341237Rat
11502303LOC108351225uncharacterized LOC10835122565436366554394640Rat
1306328Prps1l1phosphoribosyl pyrophosphate synthetase 1-like 165441790354419593Rat
1309778Snx13sorting nexin 1365448762654591716Rat
1592964LOC680365similar to tumor rejection antigen gp9665474530154750022Rat
2074Ahraryl hydrocarbon receptor65496399055001806Rat
7734313LOC102554773uncharacterized LOC10255477365500192655104972Rat
1598279LOC366601similar to Glyceraldehyde-3-phosphate dehydrogenase (GAPDH)65508415355085871Rat
1565406Agr3anterior gradient 3, protein disulphide isomerase family member65537173855424233Rat
2319740LOC100361632hypothetical LOC10036163265538828655389250Rat
1583857LOC298960similar to Glyceraldehyde-3-phosphate dehydrogenase (GAPDH)65543998955441053Rat
1304606Agr2anterior gradient 2, protein disulphide isomerase family member65546578255487087Rat
1311788Tspan13tetraspanin 1365549765955524415Rat
621507Bzw2basic leucine zipper and W2 domains 265558675455647650Rat
7741315LOC102546420uncharacterized LOC10254642065560596755606620Rat
1306017Ankmy2ankyrin repeat and MYND domain containing 265564690555689223Rat
7502513LOC102556505non-POU domain-containing octamer-binding protein-like65566074955662526Rat
7645608LOC102547138non-POU domain-containing octamer-binding protein-like65566155855662806Rat
1560395Lrrc72leucine rich repeat containing 7265569426955757234Rat
7517562LOC102546494protein max-like65570681455708395Rat
11382383LOC10835133240S ribosomal protein S26-like65575792355758270Rat
628877Sostdc1sclerostin domain containing 165581282055816994Rat
1359368CrppaCDP-L-ribitol pyrophosphorylase A65588013656159466Rat
9299213LOC103692610coiled-coil-helix-coiled-coil-helix domain-containing protein 2, mitochondrial pseudogene65606878456071595Rat
7693349LOC102546794uncharacterized LOC10254679465621627656219734Rat
11479069LOC108351226uncharacterized LOC10835122665640039556411242Rat
2324155LOC100362703heterogeneous nuclear ribonucleoprotein A1-like65646981356504273Rat
3079Meox2mesenchyme homeobox 265662576856689195Rat
1589986Vom2r49vomeronasal 2 receptor, 4965673289156775529Rat
1312038Agmoalkylglycerol monooxygenase65684685957193918Rat
11398630LOC108351227uncharacterized LOC10835122765721938057257946Rat
11518989LOC108351363uncharacterized LOC10835136365725896757263048Rat
1563613RGD1563613similar to 40S ribosomal protein S2565739617857396594Rat
2488Dgkbdiacylglycerol kinase, beta65751635158277385Rat
7669283LOC102549779actin, cytoplasmic 2-like65759695257598103Rat
9263034LOC103692620thyroid hormone receptor-associated protein 3 pseudogene65770752757711961Rat
1589430LOC680646similar to 40S ribosomal protein S265838770358389016Rat
2323883LOC100362896prostatic binding protein-like65841915658419713Rat
1312007Etv1ETS variant transcription factor 165846721558558640Rat
2323695LOC100362999hsc70-interacting protein-like65929989659301508Rat
1305611Smarce1lSWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily e, member 1-like65936683259368178Rat
7629082LOC102548656igE-binding protein-like65950501359506572Rat
1560073RGD1560073similar to ribosomal protein S1065953104259531582Rat
1588231LOC680735similar to 60S ribosomal protein L17 (L23) (Amino acid starvation-induced protein) (ASI)65966234959662893Rat
1588211LOC680755similar to B-cell receptor-associated protein 3765985009959852546Rat
2152Arl4aADP-ribosylation factor like GTPase 4A65994592659950586Rat
7630539LOC102551566uncharacterized LOC10255156665995078759958981Rat
735034Scinscinderin65997537560055075Rat
9259024LOC103692615uncharacterized LOC10369261566005446960065855Rat
1587073Lsmem1leucine-rich single-pass membrane protein 166011407760124297Rat
2867Ifrd1interferon-related developmental regulator 166013202560151354Rat
7633421LOC102551830uncharacterized LOC10255183066017887060180424Rat
1583856Zfp277zinc finger protein 27766024620960374388Rat
1561724Dock4dedicator of cytokinesis 466037483960782648Rat
9385702LOC103692616uncharacterized LOC10369261666042650560438016Rat
9392136LOC103692617transcription elongation factor B polypeptide 1 pseudogene66081840660818701Rat
2323665Immp2linner mitochondrial membrane peptidase subunit 266095835161859457Rat
2323872LOC100359421histone H3.3B-like66098867860989919Rat
7500279LOC102552766uncharacterized LOC10255276666103638861072441Rat
9346795LOC103692618uncharacterized LOC10369261866122470861227667Rat
71066Lrrn3leucine rich repeat neuronal 366137432861405195Rat
1589745Ndufa10l1NADH dehydrogenase (ubiquinone) 1 alpha subcomplex 10-like 166279695162798384Rat
11364132LOC108351333endogenous retrovirus group K member 8 Pol protein-like66331871763321091Rat
9072809LOC103692621oligosaccharyltransferase complex subunit OSTC pseudogene66333861163360873Rat
11403672LOC108351228uncharacterized LOC10835122866342982963439081Rat
7544796LOC102553990uncharacterized LOC10255399066412039964152399Rat
3070Dnajb9DnaJ heat shock protein family (Hsp40) member B966416591364170122Rat
9352471LOC103692619uncharacterized LOC10369261966417581464224796Rat
9440656LOC103692622uncharacterized LOC10369262266417582164178828Rat
1583553LOC681138similar to DnaJ (Hsp40) homolog, subfamily B, member 666419297264194110Rat
1311444Pnpla8patatin-like phospholipase domain containing 866422487064288465Rat
3209Nrcamneuronal cell adhesion molecule66429784364867408Rat
6490794LOC100911744ninein-like66458706664625636Rat
11460919LOC108348084dnaJ homolog subfamily C member 17-like66464616964648793Rat
9281538LOC103692623M-phase phosphoprotein 6 pseudogene66464879164650188Rat
6490132LOC100911871coiled-coil domain-containing protein 85C-like66472906164738925Rat
6489645LOC100911922alpha-enolase-like66477097764772670Rat
1598017LOC681255similar to G patch domain containing 4 protein isoform 266496894864969982Rat
11407073LOC108351229transformer-2 protein homolog alpha pseudogene66500672065008654Rat
1598278LOC366611similar to Alpha-enolase (2-phospho-D-glycerate hydro-lyase) (Non-neural enolase) (NNE) (Enolase 1)66501265965014352Rat
1583855LOC298990hypothetical LOC29899066503123665032931Rat
1306117Stxbp6syntaxin binding protein 666508648365319527Rat
9397046LOC103692624uncharacterized LOC10369262466526989165273188Rat
9256166LOC103692625uncharacterized LOC10369262566560277365606082Rat
7593102LOC102555380uncharacterized LOC10255538066570522065722682Rat
7652149LOC102555435uncharacterized LOC10255543566574496665751008Rat
9294132LOC103692626uncharacterized LOC10369262666576651565770191Rat
9317184LOC103692627uncharacterized LOC10369262766577145765778037Rat
11450428LOC108351230uncharacterized LOC10835123066577935265787252Rat
621345Nova1NOVA alternative splicing regulator 166696012667085836Rat
7725900LOC102556158uncharacterized LOC10255615866824934368268080Rat
1598277LOC366613similar to Importin alpha-2 subunit (Karyopherin alpha-2 subunit) (SRP1-alpha) (RAG cohort protein 1) (Pendulin) (Pore targeting complex 58 kDa subunit) (PTAC58) (Importin alpha P1)66867292768674901Rat
7693265LOC102556377uncharacterized LOC10255637766871687368725462Rat
1334065Olr873-psolfactory receptor pseudogene 87366949762969498282Rat
2320031LOC100364934Leydig cell tumor 10 kDa protein-like66961929569619628Rat
2323500LOC100359740D-3-phosphoglycerate dehydrogenase-like66993708369938327Rat
7543646LOC102546336uncharacterized LOC10254633666993976269945424Rat
1559629RGD1559629similar to H+ ATP synthase66995012969951013Rat
2619Foxg1forkhead box G166997122769974037Rat
7619249LOC102546421uncharacterized LOC10254642166997556069994251Rat
7627887LOC102546496uncharacterized LOC10254649667021653970220854Rat
9219694LOC103692628uncharacterized LOC10369262867025830470343196Rat
6486816LOC100912520leydig cell tumor 10 kDa protein homolog67027622770276560Rat
1583294LOC685003similar to Leydig cell tumor 10 kDa protein67028946470289797Rat
9146736LOC103692629uncharacterized LOC10369262967096200770964521Rat
620964Prkd1protein kinase D167103501771349531Rat
11491233LOC108351231uncharacterized LOC10835123167167529871703445Rat
9182264LOC103692630uncharacterized LOC10369263067171201571733152Rat
7728058LOC102557478uncharacterized LOC10255747867173394471853649Rat
1310263G2e3G2/M-phase specific E3 ubiquitin protein ligase67209214872123878Rat
9079291LOC103692631uncharacterized LOC10369263167211317672114855Rat
619828Scfd1sec1 family domain containing 167212440872202703Rat
1587060LOC680823similar to Ubiquitin-conjugating enzyme E2 I (Ubiquitin-protein ligase I) (Ubiquitin carrier protein I) (SUMO-1-protein ligase) (SUMO-1-conjugating enzyme) (Ubiquitin-conjugating enzyme UbcE2A)67213301972133964Rat
7607530LOC102551044uncharacterized LOC10255104467218794872230834Rat
2323296LOC100359846hypothetical LOC10035984667226530672266267Rat
11497096LOC108351233uncharacterized LOC10835123367227091172359999Rat
9174726LOC103692632ADP-ribosylation factor-like protein 1 pseudogene67228870072290899Rat
11405764LOC108351234uncharacterized LOC10835123467231334072313928Rat
1308536Cochcochlin67235970272373710Rat
621827Strn3striatin 367237636072462676Rat
9229379LOC103692633uncharacterized LOC10369263367240361072409447Rat
1311990Ap4s1adaptor related protein complex 4 subunit sigma 167246197772502717Rat
1561653Hectd1HECT domain E3 ubiquitin protein ligase 167250965872596285Rat
1561116Heatr5aHEAT repeat containing 5A67264865472750202Rat
11421308LOC108351334vegetative cell wall protein gp1-like67274962172750307Rat
1309138Dtd2D-aminoacyl-tRNA deacylase 267278122972786835Rat
1306830Gpr33G protein-coupled receptor 3367280484372805848Rat
1307232Nubplnucleotide binding protein-like67289175873147837Rat
11440663LOC108351235tensin-2 pseudogene67293103972935120Rat
7536596LOC102552216tensin-like C1 domain-containing phosphatase-like67293141472932801Rat
1595110LOC685338similar to longevity assurance homolog 567319538973196416Rat
9358597LOC103692634uncharacterized LOC10369263467322460573225974Rat
9095294LOC103692641dynein assembly factor 3, axonemal homolog67334484273358025Rat
1308507Arhgap5Rho GTPase activating protein 567334512973408304Rat
7670615LOC102547541uncharacterized LOC10254754167344418873445547Rat
69412Akap6A-kinase anchoring protein 667355311173991992Rat
7709127LOC102547662uncharacterized LOC10254766267404979474058457Rat
9155261LOC103692635neuronal PAS domain-containing protein 3-like67408199574326992Rat
1307181Npas3neuronal PAS domain protein 367408199574913025Rat
7629096LOC102547735uncharacterized LOC10254773567424076474278309Rat
71019Egln3egl-9 family hypoxia-inducible factor 367505032975075795Rat
7578757LOC102547890uncharacterized LOC10254789067522423975228553Rat
1559672Timm23btranslocase of inner mitochondrial membrane 23 homolog B67524390375245018Rat
2322683LOC100360166expressed sequence AU019823-like67527260275296139Rat
9129693LOC103692636uncharacterized LOC10369263667530411075313715Rat
2323006Rps10l1ribosomal protein S10-like 167542971575430282Rat
1559724RGD1559724similar to 40S ribosomal protein S1967546985675470385Rat
1565821Sptssaserine palmitoyltransferase, small subunit A67554013275551545Rat
1309624EappE2F-associated phosphoprotein67556189875589274Rat
9142254LOC103692637uncharacterized LOC10369263767556614375566572Rat
7646071LOC102548253centrin-4-like67557259475576632Rat
7561334LOC102548522uncharacterized LOC10254852267562133775626216Rat
1304647Snx6sorting nexin 667562692775670172Rat
7646365LOC102548461uncharacterized LOC10254846167567016775698555Rat
9167354LOC103695296glyceraldehyde-3-phosphate dehydrogenase pseudogene67573253575733572Rat
1306982Cfl2cofilin 267575914075763185Rat
1306199Baz1abromodomain adjacent to zinc finger domain, 1A67579322375873854Rat
11491526LOC108351236uncharacterized LOC10835123667589827775925689Rat
1304624RGD1304624similar to RIKEN cDNA 2700097O0967594588975996483Rat
9462711LOC103692638uncharacterized LOC10369263867597925975983680Rat
621390Srp54asignal recognition particle 54A67599662976035768Rat
2323636Fam177a1family with sequence similarity 177, member A167604108076055912Rat
1309207Ppp2r3cprotein phosphatase 2, regulatory subunit B'', gamma67605658576079755Rat
1305089Prorpprotein only RNase P catalytic subunit67607988076171298Rat
61849Psma6proteasome 20S subunit alpha 667617446076205429Rat
11466682LOC108351237uncharacterized LOC10835123767625877476267492Rat
3171NfkbiaNFKB inhibitor alpha67626722776270457Rat
7665513LOC102548803uncharacterized LOC10254880367631698676324744Rat
1359133Aldoart2aldolase 1 A retrogene 267634936276351052Rat
1306949Insm2INSM transcriptional repressor 267638068176386240Rat
620642Ralgapa1Ral GTPase activating protein catalytic subunit alpha 167638697176661530Rat
2325062LOC100359668ferritin light chain 267665203376652975Rat
4888535Mir3593microRNA 359367666179976661889Rat
7744426LOC102546497uncharacterized LOC10254649767666942176675289Rat
6495833LOC100910898breast cancer metastasis-suppressor 1-like protein-like67667539976708260Rat
1306006Brms1lBRMS1 like transcriptional repressor67667539976708261Rat
1306006Brms1lBRMS1 like transcriptional repressor67674324376753950Rat
1586694LOC686002similar to 60S ribosomal protein L767689732576898062Rat
1598274LOC366626similar to glyceraldehyde-3-phosphate dehydrogenase67692690076927883Rat
1598273LOC366627similar to L-lactate dehydrogenase A chain (LDH-A) (LDH muscle subunit) (LDH-M)67695726277022322Rat
11480668LOC108351335L-lactate dehydrogenase A chain pseudogene67702530277028368Rat
7624949LOC102551143uncharacterized LOC10255114367713247477192691Rat
11370304LOC108351238uncharacterized LOC10835123867713945977152814Rat
1306310MbipMAP3K12 binding inhibitory protein 167722643977243696Rat
11475273LOC108351239uncharacterized LOC10835123967729787677319305Rat
7751922LOC102551688uncharacterized LOC10255168867730541677330219Rat
6489654LOC100911923uncharacterized LOC10091192367737577677416950Rat
3866Nkx2-1NK2 homeobox 167741809677423383Rat
7748644LOC102552092uncharacterized LOC10255209267742153177432756Rat
7545272LOC102554545transcription factor BTF3-like67745450777457164Rat
1598272LOC366628similar to peptidase (mitochondrial processing) beta67745720877464425Rat
1310629Nkx2-8NK2 homeobox 867750688277508585Rat
2321461LOC100360797ribosomal protein L15-like67753846077539090Rat
1560838Pax9paired box 967760770577624453Rat
621444Slc25a21solute carrier family 25 member 2167762438478121339Rat
7624969LOC102554460GDP-Man:Man(3)GlcNAc(2)-PP-Dol alpha-1,2-mannosyltransferase-like67768011677682012Rat
11452082LOC108351240uncharacterized LOC10835124067773526377751536Rat
9107639LOC103692639uncharacterized LOC10369263967787622577907779Rat
7647113LOC102552151uncharacterized LOC10255215167811300078116143Rat
1359636LOC314140ribose-phosphate pyrophosphokinase I -like67817276278181608Rat
6504372Mipol1mirror-image polydactyly 167817284278506232Rat
2807Foxa1forkhead box A167851657978549669Rat
7572136LOC102553136uncharacterized LOC10255313667851756678519493Rat
1560556Ttc6tetratricopeptide repeat domain 667856745378779151Rat
9258221LOC103692640transcription elongation factor B polypeptide 1 pseudogene67858601778586918Rat
1598271LOC366632similar to 40S ribosomal protein S667870702578707814Rat
1587663LOC688516similar to L-lactate dehydrogenase A chain (LDH-A) (LDH muscle subunit) (LDH-M)67914904279150323Rat
3762Sstr1somatostatin receptor 167925291479258611Rat
1306232Clec14aC-type lectin domain containing 14A67930330179306443Rat
7532141LOC102553397uncharacterized LOC10255339767932805079332268Rat
1586499LOC688601similar to Ras-GTPase-activating protein binding protein 1 (ATP-dependent DNA helicase VIII) (GAP SH3-domain binding protein 1) (G3BP-1) (HDH-VIII)67972029079722231Rat
1586488LOC688612similar to DEAD (Asp-Glu-Ala-Asp) box polypeptide 21a67983039279831841Rat
1586460LOC688640similar to muscle protein68468000863780009453Rat
1586428LOC688672similar to eukaryotic translation initiation factor 4A, isoform 168002260480023901Rat
1309103Sec23aSec23 homolog A, COPII coat complex component68005974280107340Rat
7621655LOC102553646uncharacterized LOC10255364668006763680069401Rat
620842Gemin2gem (nuclear organelle) associated protein 268010875180122382Rat
1588546Cyp51a1-ps1cytochrome P450, family 51, subfamily a, polypeptide 1, pseudogene 168012664980128800Rat
1309325Trappc6btrafficking protein particle complex subunit 6B68014212680153216Rat
1597086Pnnpinin, desmosome associated protein68015936480167677Rat
6488546Mia2MIA SH3 domain ER export factor 268018872180286918Rat
1307543Fbxo33F-box protein 3368030229180334536Rat
9159722LOC103695309glyceraldehyde-3-phosphate dehydrogenase pseudogene68045706780458094Rat
1563850RGD1563850similar to Aldo-keto reductase family 1, member B868105234681065479Rat
1598269LOC366640similar to Multifunctional protein ADE268116496081166383Rat
1598344LOC299084similar to proliferating cell nuclear antigen68126889881270707Rat
1598268LOC366641similar to 5-nucleotidase, cytosolic II68135114581356699Rat
11455066LOC108351364uncharacterized LOC10835136468161593381624492Rat
9176028LOC103692646peptidyl-prolyl cis-trans isomerase A-like68188991681920637Rat
1582962LOC688945hypothetical protein LOC68894568238885682389558Rat
1582948LOC688959similar to SEC13-like 168243217182433129Rat
1582931LOC688976similar to poly(rC) binding protein 268271939182720338Rat
6501490LOC100909786serologically defined colon cancer antigen 3 homolog68290840082910283Rat
2322884LOC100360061mCG18732-like68298230282984185Rat
1309357Lrfn5leucine rich repeat and fibronectin type III domain containing 568308259383438601Rat
1560665Timm17al1translocase of inner mitochondrial membrane 17a-like 168325200783253099Rat
1597397Cct6a-ps11chaperonin containing Tcp1, subunit 6A (zeta 1), pseudogene 1168407319884118640Rat
2319091LOC100361989mCG49489-like68419268284193402Rat
2322517LOC100360233hypothetical LOC10036023368425527484255719Rat
11425406LOC108351365uncharacterized LOC10835136568429336584293924Rat
2322466LOC100360285hypothetical LOC10036028568431978084321073Rat
1598266LOC366647similar to Glyceraldehyde-3-phosphate dehydrogenase (GAPDH)68439812384479275Rat
7664078LOC102546645uncharacterized LOC10254664568556131485575238Rat
9442963LOC103692642uncharacterized LOC10369264268561354485620699Rat
9242302LOC103692643uncharacterized LOC10369264368601990786023276Rat
1597505LOC687780similar to Finkel-Biskis-Reilly murine sarcoma virusubiquitously expressed68613118986131699Rat
1561721Fscbfibrous sheath CABYR binding protein68622026086223052Rat
11387951LOC108351366peptidyl-prolyl cis-trans isomerase A-like68650409286504626Rat
1596109LOC689195similar to TAF5-like RNA polymerase II p300/CBP-associated factor-associated factor 65 kDa subunit 5L (PCAF-associated factor 65 beta) (PAF65-beta)68655533786557218Rat
11485839LOC108351241uncharacterized LOC10835124168662464286650805Rat
1307621RGD1307621hypothetical LOC31416868665119686659371Rat
1311326Klhl28kelch-like family member 2868668082686713370Rat
1310474Togaram1TOG array regulator of axonemal microtubules 168671358886780134Rat
1308702Prpf39pre-mRNA processing factor 3968678579386810806Rat
1304992Fkbp3FKBP prolyl isomerase 368681086586822115Rat
1307897FancmFA complementation group M68682319586877067Rat
1594757Mis18bp1MIS18 binding protein 168687910686925209Rat
2321710LOC100360647ubiquitin-like protein fubi and ribosomal protein S30-like68692166886922178Rat
1593470LOC689394similar to family with sequence similarity 51, member A1 homolog68796567187966477Rat
1592352LOC689408similar to H2A histone family, member V isoform 168801385788014500Rat
11509237LOC108351242uncharacterized LOC10835124268802006788141656Rat
9438747LOC103695298uncharacterized LOC10369529868808763788090171Rat
11488287LOC108351243uncharacterized LOC10835124368814190388158823Rat
1305913Rpl10lribosomal protein L10-like68823127388232549Rat
11461866LOC108351244uncharacterized LOC10835124468831177888315120Rat
735131Mdga2MAM domain containing glycosylphosphatidylinositol anchor 268844262089292454Rat
9389933LOC103692644uncharacterized LOC10369264468855465488559326Rat
11461820LOC108351351glyceraldehyde-3-phosphate dehydrogenase-like68857489488575856Rat
9378291LOC103692647transcription termination factor, mitochondrial-like68876898788783801Rat
9333302LOC103692645glyceraldehyde-3-phosphate dehydrogenase pseudogene68911646189122117Rat
11357177LOC108351352uncharacterized LOC10835135268917473489176054Rat
11519508LOC108351245uncharacterized LOC10835124568933729389338613Rat
6495886LOC100910913non-histone chromosomal protein HMG-14-like68944285589524519Rat
11460921LOC108351246uncharacterized LOC10835124668956846789691393Rat
1592266LOC689496similar to 60S ribosomal protein L1168993265989940211Rat
6495308LOC100911036pumilio domain-containing protein KIAA0020-like69068841190689054Rat
2318430LOC100365755hypothetical LOC10036575569069399690695099Rat
11423685LOC108351247uncharacterized LOC10835124769072606790754652Rat
2318168LOC100362420DNA segment, Chr 19, Brigham & Womens Genetics 1357 expressed-like69096011490960757Rat
1591088LOC689539similar to Delta-aminolevulinic acid dehydratase (Porphobilinogen synthase) (ALADH)69096569990966802Rat
2324062LOC100362796cDNA sequence BC048679-like69107164191095627Rat
1559639RGD1559639similar to ribosomal protein L10a69111369591123932Rat
6494851LOC100911182UPF0767 protein C1orf212 homolog69111786091118922Rat
11516559LOC108351367uncharacterized LOC10835136769114976191151618Rat
6493757LOC100911256ninein-like69120775091273661Rat
1308005RGD1308005similar to RIKEN cDNA 9630033F20 gene69132848291332403Rat
1598265LOC366655similar to hypothetical protein69138480591385457Rat
6487673LOC10091230340S ribosomal protein S8-like69143845191439056Rat
3596Rps29ribosomal protein S2969145533391456709Rat
8157638Rn7sl1RNA component of signal recognition particle 7SL169145691291457210Rat
1589026Lrr1leucine rich repeat protein 169146320591472308Rat
620098Mgat2alpha-1,6-mannosyl-glycoprotein 2-beta-N-acetylglucosaminyltransferase69147669891479187Rat
1310311Dnaaf2dynein, axonemal, assembly factor 269148143991490189Rat
1311962Pole2DNA polymerase epsilon 2, accessory subunit69149434891532355Rat
1308211Klhdc1kelch domain containing 169153238091584112Rat
7644584LOC102547663transcription factor BTF3-like69158053991581434Rat
1306504Klhdc2kelch domain containing 269159544391630479Rat
2315525Nemfnuclear export mediator factor69161102191676394Rat
7625906LOC102550586uncharacterized LOC10255058669163096991637245Rat
621279Arf6ADP-ribosylation factor 669169710991698257Rat
11392605LOC108351248uncharacterized LOC10835124869177951191781821Rat
7564407LOC102548030uncharacterized LOC10254803069178241791791069Rat
7658903LOC102548223uncharacterized LOC10254822369179333791795375Rat
9297912LOC103692648uncharacterized LOC10369264869180317291804083Rat
9347219LOC103692649uncharacterized LOC10369264969186749691874297Rat
7565188Vcpkmtvalosin containing protein lysine methyltransferase69188034291884336Rat
620435Sos2SOS Ras/Rho guanine nucleotide exchange factor 269188529292008059Rat
2320876Acp1-ps1acid phosphatase 1, soluble, pseudogene 169190725091908626Rat
9299214LOC103692654chloride intracellular channel protein 4 pseudogene69198645891990747Rat
9272272LOC103692650uncharacterized LOC10369265069200839092011255Rat
1306250L2hgdhL-2-hydroxyglutarate dehydrogenase69201656092057643Rat
1359208Dmac2ldistal membrane arm assembly component 2 like69205778292076022Rat
1305080Cdkl1cyclin dependent kinase like 169207624792123108Rat
7625633LOC102548655uncharacterized LOC10254865569209585992098231Rat
1562028Map4k5mitogen-activated protein kinase kinase kinase kinase 569213624292229578Rat
1359232Atl1atlastin GTPase 169222976492370428Rat
1307253Sav1salvador family WW domain containing protein 169237647092398678Rat
7740966LOC102548804heterogeneous nuclear ribonucleoprotein R-like69238033592382478Rat
1597025LOC500665similar to SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily e, member 169242051192422678Rat
1306492Ninninein69242341292527776Rat
1303145Abhd12babhydrolase domain containing 12B69256897592596327Rat
620687Pyglglycogen phosphorylase L69259775992643734Rat
621540Trim9tripartite motif-containing 969266002692760036Rat
7653006LOC102549102uncharacterized LOC10254910269276010392791896Rat
7637319LOC102548972uncharacterized LOC10254897269279190192795817Rat
1586354LOC689946similar to sorting nexin 769283456292838989Rat
7513588LOC102551922uncharacterized LOC10255192269285958592864054Rat
1308455Tmx1thioredoxin-related transmembrane protein 169286412392875141Rat
7741692LOC102552060uncharacterized LOC10255206069306933693070592Rat
727810Frmd6FERM domain containing 669328138293358888Rat
1306515Actr10actin related protein 1069338545793411605Rat
6576126Trnak-cuutransfer RNA lysine (anticodon CUU)69341755093417622Rat
11391162Trnak-cuu9transfer RNA lysine (anticodon CUU) 969341755093417622Rat
7574462LOC102552313uncharacterized LOC10255231369341755093422827Rat
61844Psma3proteasome 20S subunit alpha 369342302993444223Rat
7648446LOC102552179uncharacterized LOC10255217969344584793461551Rat
1307442Arid4aAT-rich interaction domain 4A69346171393532901Rat
7504311LOC102552632uncharacterized LOC10255263269353456693537955Rat
1586305Tomm20ltranslocase of outer mitochondrial membrane 20 like69353837793549533Rat
621656Timm9translocase of inner mitochondrial membrane 969354948493562314Rat
1585176LOC690035similar to Protein KIAA058669356277593667857Rat
1564008Dact1dishevelled-binding antagonist of beta-catenin 169374044093751003Rat
1559545RGD1559545similar to ATPase inhibitory factor 169378933993790725Rat
11499331LOC10835124960S ribosomal protein L15-like69385254493853169Rat
11500716LOC108351250uncharacterized LOC10835125069387619293877690Rat
9345042LOC103692651uncharacterized LOC10369265169413661994142653Rat
9238151LOC103692652uncharacterized LOC10369265269417235794176561Rat
7499250LOC102553691spermatogenesis-associated protein 31C2-like69419565194202501Rat
7709349LOC102553798uncharacterized LOC10255379869426292294277266Rat
7512636LOC102553860uncharacterized LOC10255386069432205794336405Rat
9084011LOC10369265340S ribosomal protein SA pseudogene69432763194329820Rat
3373Ppm1aprotein phosphatase, Mg2+/Mn2+ dependent, 1A69443365894484979Rat
11454361LOC108351251uncharacterized LOC10835125169448432694509675Rat
1305119Daam1dishevelled associated activator of morphogenesis 169460667594739026Rat
11434949LOC108351252uncharacterized LOC10835125269473726794748557Rat
727844Gpr135G protein-coupled receptor 13569481697694818349Rat
1305721L3hypdhtrans-L-3-hydroxyproline dehydratase69482411294834908Rat
11457500LOC10835125360S ribosomal protein L9 pseudogene69483506394835666Rat
1308917JkampJNK1/MAPK8-associated membrane protein69483584594849784Rat
1560894Ccdc175coiled-coil domain containing 17569484991094933175Rat
620986Rtn1reticulon 169495101695177477Rat
9270261LOC103692655peptidyl-prolyl cis-trans isomerase D pseudogene69500488695006571Rat
11472163LOC10835125460S ribosomal protein L36a-like69519854295198987Rat
1565716Lrrc9leucine rich repeat containing 969520513195290848Rat
7695433LOC102549502uncharacterized LOC10254950269529194395356700Rat
1582892Pcnx4pecanex 469531486795452631Rat
9423282LOC103690069pecanex-like protein 469531491195452632Rat
1582892Pcnx4pecanex 469535333495360686Rat
2321168LOC100364391dehydrogenase/reductase (SDR family) member 7-like69538770995393069Rat
1308036Dhrs7l1dehydrogenase/reductase (SDR family) member 7-like 169538770995502845Rat
1565002Dhrs7dehydrogenase/reductase 769552257795541393Rat
1598264LOC366666similar to Ubiquitin-conjugating enzyme E2 E3 (Ubiquitin-protein ligase E3) (Ubiquitin carrier protein E3) (Ubiquitin-conjugating enzyme E2-23 kDa) (UbcM2)69554588095546499Rat
2319136LOC100361944hypothetical protein LOC10036194469555874195559037Rat
7521150LOC102549812serum response factor homolog A-like69556954895602610Rat
1559456Six6os1Six6 opposite strand transcript 169576171895797314Rat
11493498LOC108351256uncharacterized LOC10835125669581148195816638Rat
1310497Six6SIX homeobox 669581674995821729Rat
11360540LOC10835125560S ribosomal protein L35a pseudogene69582646795826929Rat
1597353LOC690335similar to 60S ribosomal protein L23a69588979895890332Rat
11515855LOC108351257uncharacterized LOC10835125769591280095922365Rat
620906Six1SIX homeobox 169592906095934296Rat
1597303LOC690390similar to ribosomal protein L3169597298195973470Rat
1306726Six4SIX homeobox 469598486895999709Rat
628874Mnat1MNAT1 component of CDK activating kinase69599534196153331Rat
7641929LOC102550141geranylgeranyl transferase type-2 subunit beta-like69609118996094512Rat
1306567Trmt5tRNA methyltransferase 569616457996171680Rat
1310330Slc38a6solute carrier family 38, member 669617175696241512Rat
1582926LOC688981similar to 60S ribosomal protein L26 (Silica-induced gene 20 protein) (SIG-20)69620203996204610Rat
7583083LOC10255704360S ribosomal protein L26-like69625836696261008Rat
7563444LOC102550345uncharacterized LOC10255034569633997696343944Rat
11356259LOC108351368uncharacterized LOC10835136869635231996359864Rat
1308732Tmem30btransmembrane protein 30B69643960796442682Rat
621888Prkchprotein kinase C, eta69647924396677368Rat
11460843LOC10835132060S ribosomal protein L7a pseudogene69663489496649260Rat
11421494LOC108351258uncharacterized LOC10835125869678175796786086Rat
61928Hif1ahypoxia inducible factor 1 subunit alpha69681086896856303Rat
7587838LOC102550558uncharacterized LOC10255055869683044896858807Rat
1304671Snapc1small nuclear RNA activating complex, polypeptide 169687167596893422Rat
7643655LOC102550623transmembrane protein 183-like69687487996876602Rat
1564654Syt16synaptotagmin 1669707630497199856Rat
7735797LOC102550910uncharacterized LOC10255091069710801897132746Rat
11407250LOC108351259uncharacterized LOC10835125969720893597215591Rat
7582340LOC102551114uncharacterized LOC10255111469721562297227226Rat
11506221LOC108351369uncharacterized LOC10835136969742743497429296Rat
7625884LOC102551447nesprin-2-like69745496797458285Rat
621417Kcnh5potassium voltage-gated channel subfamily H member 569787283198157087Rat
11404871LOC10835126060S ribosomal protein L7a-like69790767897908471Rat
1310528Rhojras homolog family member J69828436198367122Rat
1359264Gphb5glycoprotein hormone subunit beta 569838050098383049Rat
1305657Ppp2r5eprotein phosphatase 2 regulatory subunit B', epsilon69841797498567016Rat
11440282LOC10835126160S ribosomal protein L31 pseudogene69844963498452433Rat
1307393Wdr89WD repeat domain 8969859945698631512Rat
7577344LOC102555381cytochrome c oxidase subunit 7B, mitochondrial-like69866798698668809Rat
727829Sgpp1sphingosine-1-phosphate phosphatase 169867532498696492Rat
1305248Syne2spectrin repeat containing nuclear envelope protein 269888426999153551Rat
2582Esr2estrogen receptor 269916395399214711Rat
1560347Tex21testis expressed 2169923665399274350Rat
7712380LOC10255580360S ribosomal protein L11-like69924955299250063Rat
708531Mthfd1methylenetetrahydrofolate dehydrogenase, cyclohydrolase and formyltetrahydrofolate synthetase 169928285099350367Rat
7517255LOC102555894uncharacterized LOC10255589469929998899302287Rat
620829Akap5A-kinase anchoring protein 569935650999361909Rat
735076Zbtb25zinc finger and BTB domain containing 2569937641599400834Rat
1303095Zbtb1zinc finger and BTB domain containing 169940177599425739Rat
11491035LOC108351262uncharacterized LOC10835126269942180699428501Rat
9089876LOC103692661uncharacterized LOC10369266169942770499428335Rat
620664Hspa2heat shock protein family A (Hsp70) member 269943357599436288Rat
1309051Ppp1r36protein phosphatase 1, regulatory subunit 3669944375399464143Rat
7661508LOC102556012uncharacterized LOC10255601269946839099475218Rat
7715470LOC102556069uncharacterized LOC10255606969952684999530370Rat
1562381RGD1562381similar to ribosomal protein S1769957573399576213Rat
1308089Plekhg3pleckstrin homology and RhoGEF domain containing G369961299399655753Rat
1303243Sptbspectrin, beta, erythrocytic69965714499783189Rat
7750347LOC102546457uncharacterized LOC10254645769980591299811363Rat
1305116Churc1churchill domain containing 169981743999831574Rat
727780Gpx2glutathione peroxidase 269983996099843245Rat
735172Rab15RAB15, member RAS oncogene family69984595299870320Rat
9137814LOC103692663uncharacterized LOC10369266369984989799850780Rat
7663745LOC102546646uncharacterized LOC10254664669987398099877413Rat
11476601LOC108348171uncharacterized LOC10834817169988116399883937Rat
620119Fntbfarnesyltransferase, CAAX box, beta69988395999966988Rat
7624374LOC102546566uncharacterized LOC10254656669994703199947839Rat
621101MaxMYC associated factor X699984260100011460Rat
7503616LOC10254683340S ribosomal protein S7-like6100073755100075787Rat
1303096Fut8fucosyltransferase 86100305957100537208Rat
7565722LOC102557550uncharacterized LOC1025575506100307439100337319Rat
9463915LOC103692664ankyrin repeat domain-containing protein 49 pseudogene6100342846100349475Rat
7646440LOC102549283uncharacterized LOC1025492836100696597100697853Rat
9344005LOC103692665uncharacterized LOC1036926656100698000100744896Rat
1562540Ccdc196coiled-coil domain containing 1966101288951101304220Rat
9345051LOC103692666uncharacterized LOC1036926666101308054101312026Rat
69194Gphngephyrin6101327874101859169Rat
9157402LOC103692706eukaryotic translation initiation factor 5 pseudogene6101369773101372355Rat
1587342LOC314258hypothetical LOC3142586101387489101388793Rat
11493979LOC108351264protein S100-A11 pseudogene6101393817101395903Rat
9270262LOC103692668protein S100-A11 pseudogene6101395278101395867Rat
7509444LOC102547341E3 ubiquitin-protein ligase RNF138-like6101408354101411421Rat
11483960LOC108351263ephrin type-A receptor 7 pseudogene6101485255101487740Rat
9238158LOC103692667ephrin type-A receptor 7 pseudogene6101486626101487905Rat
1564393Fam71dfamily with sequence similarity 71, member D6101864567101910312Rat
6502380LOC100909680uncharacterized LOC1009096806101864990101873464Rat
7521919LOC102547630uncharacterized LOC1025476306101903168101923426Rat
11375288LOC108351336U6 snRNA-associated Sm-like protein LSm8 pseudogene6101920353101921999Rat
1308071Mpp5membrane palmitoylated protein 56101923675102029705Rat
735119Atp6v1dATPase H+ transporting V1 subunit D6102032271102047754Rat
620963Eif2s1eukaryotic translation initiation factor 2 subunit alpha6102048372102073041Rat
1305786Plek2pleckstrin 26102076736102095002Rat
7503266LOC102547797uncharacterized LOC1025477976102105284102144444Rat
1562622Tmem229btransmembrane protein 229B6102152146102196372Rat
9150660LOC103692708uncharacterized LOC1036927086102176445102202768Rat
11371597LOC108351265uncharacterized LOC1083512656102211094102217749Rat
1308362Plekhh1pleckstrin homology, MyTH4 and FERM domain containing H16102215424102264345Rat
7650041LOC102547892uncharacterized LOC1025478926102244518102247198Rat
1311438Pighphosphatidylinositol glycan anchor biosynthesis, class H6102258621102272826Rat
1593648LOC688014similar to branched chain keto acid dehydrogenase kinase6102301703102303209Rat
2151Arg2arginase 26102311097102338406Rat
7658385LOC10254825560S ribosomal protein L35-like6102316547102316938Rat
2323682Vti1bvesicle transport through interaction with t-SNAREs 1B6102340261102353612Rat
1312001Rdh11retinol dehydrogenase 116102356498102372618Rat
1594186LOC680245similar to CG6149-PA6102372738102374055Rat
1310462Rdh12retinol dehydrogenase 126102392828102405750Rat
1307820Zfyve26zinc finger FYVE-type containing 266102409235102472962Rat
1560681Rad51bRAD51 paralog B6102473978103018185Rat
9158342LOC10369267060S ribosomal protein L7a pseudogene6102508428102509962Rat
9323203LOC103692669centrin-2 pseudogene6102666228102667034Rat
7730543LOC102546422uncharacterized LOC1025464226102703028102708546Rat
7571132LOC102546647uncharacterized LOC1025466476103061872103068786Rat
1593640LOC688022similar to ATP synthase D chain, mitochondrial6103075123103075603Rat
11390493LOC108351266uncharacterized LOC1083512666103088210103093433Rat
7719546LOC102546873galectin-1-like6103182887103183592Rat
2325111LOC100359616ribosomal protein L36-like6103186930103187328Rat
7709103LOC102547094uncharacterized LOC1025470946103193282103194648Rat
9303738LOC103692671uncharacterized LOC1036926716103215509103218804Rat
7563537LOC102547173uncharacterized LOC1025471736103218654103283433Rat
62009Zfp36l1zinc finger protein 36, C3H type-like 16103308032103313074Rat
70907Actn1actinin, alpha 16103376557103470497Rat
2325061LOC100359669NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, assembly factor 26103452048103452560Rat
1306535Dcaf5DDB1 and CUL4 associated factor 56103516586103605288Rat
7489043Scarna3small Cajal body-specific RNA 36103567572103567661Rat
7602990LOC102553171uncharacterized LOC1025531716103605331103623268Rat
1559921RGD1559921similar to Macrophage migration inhibitory factor (MIF) (Delayed early response protein 6)6103615821103616771Rat
9331285LOC103695305histone H3.3-like6103626398103627575Rat
1562299RGD1562299similar to taube nuss6103639787103640949Rat
1561024RGD1561024similar to M phase phosphoprotein 66103642666103644066Rat
1598259LOC366683ornithine decarboxylase pseudogene6103658106103659313Rat
6501115LOC100909961dnaJ homolog subfamily C member 17-like6103674499103679587Rat
7747023LOC102553533DDB1- and CUL4-associated factor 5-like6103679223103684632Rat
1584752LOC679790similar to Ornithine decarboxylase (ODC)6103710031103714811Rat
1560857RGD1560857similar to RIKEN cDNA 2900016D056103717268103718720Rat
1595136LOC685312similar to Ornithine decarboxylase (ODC)6103735276103766973Rat
11504254LOC108351321ornithine decarboxylase-like6103762237103763986Rat
1562614RGD1562614similar to M phase phosphoprotein 66103769305103771734Rat
1588180LOC680786similar to DnaJ (Hsp40) homolog, subfamily C, member 176103771732103772905Rat
6494263LOC100911208dnaJ homolog subfamily C member 17-like6103775734103798831Rat
1588168LOC680798similar to Ornithine decarboxylase (ODC)6103803141103807354Rat
1566331RGD1566331similar to M phase phosphoprotein 66103805088103808180Rat
1587064LOC680819similar to DnaJ (Hsp40) homolog, subfamily C, member 176103808301103809328Rat
6494016LOC100911289dnaJ homolog subfamily C member 17-like6103813855103816280Rat
1565752RGD1565752similar to RIKEN cDNA 1700025B166103819697103820608Rat
1310476Mphosph6-ps1M phase phosphoprotein 6, pseudogene6103823550103824593Rat
9427736LOC103692709ornithine decarboxylase-like6103827868103828604Rat
1597740LOC685142similar to Ornithine decarboxylase (ODC)6103828631103829738Rat
2319262LOC100365316hypothetical LOC1003653166103884802103886414Rat
9115387LOC103690688M-phase phosphoprotein 6 pseudogene6103893491103894888Rat
1598260LOC366677similar to DnaJ (Hsp40) homolog, subfamily C, member 176103894885103895950Rat
6492251LOC100911503dnaJ homolog subfamily C member 17-like6103896458103902983Rat
7517141LOC102546498M-phase phosphoprotein 6-like6103913687103915331Rat
1596430LOC685267similar to DnaJ (Hsp40) homolog, subfamily C, member 176103915364103916861Rat
1598258LOC366686similar to DnaJ (Hsp40) homolog, subfamily C, member 176103921510103924531Rat
2319930LOC100361537peptidylprolyl isomerase (cyclophilin)-like 2-like6103927117103928781Rat
1562981LOC500684hypothetical protein LOC5006846103932428103935122Rat
1597693LOC685190similar to DnaJ (Hsp40) homolog, subfamily C, member 176103938349103939730Rat
6492129LOC100911611ornithine decarboxylase-like6103944340103948794Rat
6495888LOC100910914M-phase phosphoprotein 6-like6103948842103949312Rat
6496159LOC100910832dnaJ homolog subfamily C member 17-like6103949687103950875Rat
1596899LOC678786similar to M phase phosphoprotein 66103958426103958896Rat
1560227RGD1560227similar to RIKEN cDNA 1700025B166103959271103960459Rat
11357850LOC108351267endogenous retrovirus group K member 8 Pol protein-like6103963798103966247Rat
1311087Exd2exonuclease 3'-5' domain containing 26104017620104051442Rat
1310202Galnt16polypeptide N-acetylgalactosaminyltransferase 166104069853104250177Rat
1595409ErhERH, mRNA splicing and mitosis factor6104280390104290905Rat
1311236Slc39a9solute carrier family 39, member 96104291001104326553Rat
1566112Plekhd1pleckstrin homology and coiled-coil domain containing D16104340114104371162Rat
7644070LOC102549612uncharacterized LOC1025496126104397969104432670Rat
1561115Ccdc177coiled-coil domain containing 1776104403617104410991Rat
1595528Susd6sushi domain containing 66104437104104532522Rat
3664Srsf5serine and arginine rich splicing factor 56104611026104640033Rat
3681Slc10a1solute carrier family 10 member 16104617730104631355Rat
9173210LOC103692673uncharacterized LOC1036926736104619941104621516Rat
1560824RGD1560824similar to Phospholipase A2 precursor (Phosphatidylcholine 2-acylhydrolase)6104697192104698879Rat
1303126Smoc1SPARC related modular calcium binding 16104718403104879611Rat
620197Slc8a3solute carrier family 8 member A36104889500105099408Rat
1597022Adam4l1a disintegrin and metallopeptidase domain 4-like 16105007053105009516Rat
7740988LOC102550788uncharacterized LOC1025507886105023301105025728Rat
1597696LOC685187similar to ADAM 21 precursor (A disintegrin and metalloproteinase domain 21) (ADAM 31)6105035446105039905Rat
621470Adam4a disintegrin and metalloprotease domain 46105158024105160470Rat
2311610Cox16cytochrome c oxidase assembly factor COX166105195387105214366Rat
69400Synj2bpsynaptojanin 2 binding protein6105224166105261549Rat
9071317LOC103692674uncharacterized LOC1036926746105242119105244308Rat
9093992LOC103690066uncharacterized LOC1036900666105261687105279220Rat
9083574LOC103690152disintegrin and metalloproteinase domain-containing protein 21-like6105288938105298157Rat
1310296Med6mediator complex subunit 66105302558105316024Rat
1565985Ttc9tetratricopeptide repeat domain 96105364668105399500Rat
7617617LOC102552530uncharacterized LOC1025525306105419443105434188Rat
1562149Map3k9mitogen-activated protein kinase kinase kinase 96105455461105518974Rat
7622910LOC102552601uncharacterized LOC1025526016105532420105583414Rat
7536015LOC102552673uncharacterized LOC1025526736105592416105613373Rat
1306115Pcnx1pecanex 16105611425105747178Rat
11457245LOC108351268uncharacterized LOC1083512686105747401105749315Rat
708497Sipa1l1signal-induced proliferation-associated 1 like 16106052212106163249Rat
7709993LOC102552965uncharacterized LOC1025529656106173443106176398Rat
7532331LOC102553034uncharacterized LOC1025530346106255510106277954Rat
3569Rgs6regulator of G-protein signaling 66106310442106598668Rat
11403421LOC108351270uncharacterized LOC1083512706106349679106354652Rat
6487545LOC100912402polyadenylate-binding protein 1-like6106462804106464079Rat
11432016LOC108351269uncharacterized LOC1083512696106464952106471201Rat
9450955LOC103692676uncharacterized LOC1036926766106584964106597876Rat
9283248LOC103692675uncharacterized LOC1036926756106599567106605220Rat
7662928LOC102553761uncharacterized LOC1025537616106651846106660208Rat
1309052Dpf3double PHD fingers 36106660569106971310Rat
11454098LOC108351271uncharacterized LOC1083512716106734632106740965Rat
1306241Dcaf4DDB1 and CUL4 associated factor 46107001763107027466Rat
1307795Zfyve1zinc finger FYVE-type containing 16107031411107080590Rat
7681866LOC102547293uncharacterized LOC1025472936107116331107118059Rat
1308755Rbm25RNA binding motif protein 256107117888107165538Rat
3425Psen1presenilin 16107169514107221000Rat
1311176Paplnpapilin, proteoglycan-like sulfated glycoprotein6107245573107282256Rat
620107NumbNUMB, endocytic adaptor protein6107279917107325345Rat
1566220Heatr4HEAT repeat containing 46107423214107460450Rat
1307704Riox1ribosomal oxygenase 16107428508107431126Rat
621055Acot2acyl-CoA thioesterase 26107460596107468324Rat
70894Acot1acyl-CoA thioesterase 16107485088107493082Rat
1597174LOC299190similar to 60S ribosomal protein L23a6107500155107501547Rat
1596753Acot4acyl-CoA thioesterase 46107517668107522952Rat
1564089Acot3acyl-CoA thioesterase 36107531508107537446Rat
1565917Acot5acyl-CoA thioesterase 56107550904107557688Rat
1597173LOC299192similar to Cytosolic acyl coenzyme A thioester hydrolase, inducible (Long chain acyl-CoA thioester hydrolase) (Long chain acyl-CoA hydrolase) (CTE-I) (LACH2) (ACH2)6107571457107578482Rat
1309669Acot6acyl-CoA thioesterase 66107581357107590431Rat
11432023LOC108351272uncharacterized LOC1083512726107589541107596648Rat
1591349Dnal1dynein, axonemal, light chain 16107596785107623869Rat
621230Pnma1PNMA family member 16107631227107633012Rat
1306119Mideasmitotic deacetylase associated SANT domain protein6107633762107703462Rat
1310518Ptgr2prostaglandin reductase 26107999832108031645Rat
11397797LOC108351337glyceraldehyde-3-phosphate dehydrogenase pseudogene6108006003108009054Rat
1305636Zfp410zinc finger protein 4106108031747108058836Rat
1309058Fam161bFAM161 centrosomal protein B6108060019108076303Rat
1311149Coq6coenzyme Q6 monooxygenase6108076393108087782Rat
9214906LOC103692677uncharacterized LOC1036926776108080898108081467Rat
735219Entpd5ectonucleoside triphosphate diphosphohydrolase 56108087677108123811Rat
1560978Bbof1basal body orientation factor 16108123855108149613Rat
1303128Rnf113a2ring finger protein 113A26108132254108133535Rat
621556Aldh6a1aldehyde dehydrogenase 6 family, member A16108146552108167185Rat
1306798Lin52lin-52 DREAM MuvB core complex component6108167412108264459Rat
621215Vsx2visual system homeobox 26108285031108308588Rat
1307273Abcd4ATP binding cassette subfamily D member 46108315026108329550Rat
1587174Vrtnvertebrae development associated6108363454108366119Rat
11475347LOC108351273uncharacterized LOC1083512736108387163108407002Rat
1589004Syndig1lsynapse differentiation inducing 1-like6108392837108415187Rat
628756Npc2NPC intracellular cholesterol transporter 26108467410108488330Rat
1563216Isca2iron-sulfur cluster assembly 26108488678108490188Rat
68380Ltbp2latent transforming growth factor beta binding protein 26108500114108596653Rat
1307597Arel1apoptosis resistant E3 ubiquitin protein ligase 16108630790108796096Rat
11498408LOC108348062eukaryotic translation initiation factor 3 subunit H6108698680108756289Rat
1310899Fcf1FCF1 rRNA-processing protein6108796182108808051Rat
1564946Ylpm1YLP motif containing 16108820774108897209Rat
2321460LOC100360798eukaryotic translation initiation factor 2, subunit 2 (beta)6108830933108832346Rat
9176652LOC103692678U6 snRNA-associated Sm-like protein LSm5 pseudogene6108832464108832796Rat
1310315Prox2prospero homeobox 26108911705108920767Rat
1359615Dlstdihydrolipoamide S-succinyltransferase6108936534108961322Rat
1309493Rps6kl1ribosomal protein S6 kinase-like 16108961253108977970Rat
619850Pgfplacental growth factor6108994016109004598Rat
7501348LOC102548524metallothionein-1-like6109044027109044746Rat
620820Eif2b2eukaryotic translation initiation factor 2B subunit beta6109044830109051254Rat
1309227Mlh3mutL homolog 36109059386109095876Rat
1311327Acyp1acylphosphatase 16109097065109110266Rat
1307122Zc2hc1czinc finger, C2HC-type containing 1C6109110534109119458Rat
1307187Nek9NIMA-related kinase 96109121524109162433Rat
7728577LOC102549675uncharacterized LOC1025496756109162529109169862Rat
620970Tmed10transmembrane p24 trafficking protein 106109169739109205004Rat
11433025LOC10835127440S ribosomal protein S28 pseudogene6109266884109267192Rat
2626FosFos proto-oncogene, AP-1 transcription factor subunit6109300433109303299Rat
7752270LOC102548751uncharacterized LOC1025487516109309357109315212Rat
621611Jdp2Jun dimerization protein 26109464910109505591Rat
1304923Batfbasic leucine zipper ATF-like transcription factor6109562415109584541Rat
11359984LOC108351275uncharacterized LOC1083512756109577444109587856Rat
735098Flvcr2FLVCR heme transporter 26109617348109681495Rat
1310769Erg28ergosterol biosynthesis 28 homolog6109683252109692218Rat
1563583Ttll5tubulin tyrosine ligase like 56109693915109910479Rat
9113788LOC103692679uncharacterized LOC1036926796109711083109712019Rat
3851Tgfb3transforming growth factor, beta 36109913757109936217Rat
1307392Ift43intraflagellar transport 436109939323110016646Rat
1308907Gpatch2lG patch domain containing 2-like6110093767110228943Rat
1562960RGD1562960similar to WW domain binding protein 116110161032110165843Rat
9454670LOC103692707nucleoporin GLE1 pseudogene6110172524110175497Rat
11372983LOC108351276uncharacterized LOC1083512766110176728110192309Rat
6486917LOC100912423nucleoporin GLE1-like6110178020110183279Rat
6486301LOC100912568probable ATP-dependent RNA helicase DDX41-like6110209839110211779Rat
11505401LOC108351277uncharacterized LOC1083512776110219666110224362Rat
11410186LOC108351279uncharacterized LOC1083512796110300925110353209Rat
11486539LOC108351278uncharacterized LOC1083512786110314091110316132Rat
1359557Esrrbestrogen-related receptor beta6110360940110458406Rat
2324554LOC100362500poly(rC) binding protein 26110596466110597133Rat
1564082Vash1vasohibin 16110624377110640942Rat
1306238Angel1angel homolog 16110644327110681397Rat
1564488Lrrc74aleucine rich repeat containing 74A6110681551110776904Rat
9274273LOC103692680uncharacterized LOC1036926806110696526110697865Rat
11425096LOC108351370uncharacterized LOC1083513706110840313110843083Rat
11385023LOC108351280uncharacterized LOC1083512806110889152110893314Rat
7748735LOC102555496uncharacterized LOC1025554966110892524110894743Rat
1310994Irf2bplinterferon regulatory factor 2 binding protein-like6110901940110904288Rat
11423931LOC108351281uncharacterized LOC1083512816110906783110915387Rat
7662623LOC102555554uncharacterized LOC1025555546110909338110921840Rat
11513758LOC108351371non-histone chromosomal protein HMG-17 pseudogene6110964158110965329Rat
1309492CipcCLOCK-interacting pacemaker6110968014110990912Rat
1308446Zdhhc22zinc finger DHHC-type palmitoyltransferase 226111008440111015695Rat
1310207Tmem63ctransmembrane protein 63c6111044099111120659Rat
621461Ngbneuroglobin6111126259111131699Rat
1586427Pomt2protein-O-mannosyltransferase 26111137329111176991Rat
1589363Gstz1glutathione S-transferase zeta 16111176798111187246Rat
1589336Tmed8transmembrane p24 trafficking protein family member 86111188938111222866Rat
1589368Samd15sterile alpha motif domain containing 156111223026111241326Rat
1589353Noxred1NADP-dependent oxidoreductase domain containing 16111243232111271107Rat
1589291Vipas39VPS33B interacting protein, apical-basolateral polarity regulator, spe-39 homolog6111271283111296013Rat
1589285Ahsa1activator of Hsp90 ATPase activity 16111296168111304224Rat
1589343Ism2isthmin 26111309054111329967Rat
1305447Sptlc2serine palmitoyltransferase, long chain base subunit 26111334408111417960Rat
11519512LOC108351282uncharacterized LOC1083512826111441699111446797Rat
1308327Alkbh1alkB homolog 1, histone H2A dioxygenase6111456096111476829Rat
7489013Snora58small nucleolar RNA, H/ACA box 586111468732111468807Rat
1585290SlirpSRA stem-loop interacting RNA binding protein6111476768111486039Rat
1561926Snw1SNW domain containing 16111483698111507782Rat
1310843Gle1-ps1GLE1 RNA export mediator homolog (yeast), pseudogene 16111513052111515175Rat
1563496RGD1563496similar to WW domain binding protein 116111530282111540042Rat
1561148RGD1561148similar to GLE1-like, RNA export mediator isoform 16111533956111538981Rat
6497809LOC100910634nucleoporin GLE1-like6111540068111542491Rat
1583694LOC503053similar to GLE1 RNA export mediator-like (yeast)6111546379111551181Rat
1565693RGD1565693similar to GLE1-like, RNA export mediator isoform 16111570751111573368Rat
1308263Adck1aarF domain containing kinase 16111640652111741418Rat
2323769LOC100362924hypothetical LOC1003629246112010594112013011Rat
9409928LOC103692681uncharacterized LOC1036926816112070159112075048Rat
620212Nrxn3neurexin 36112133204114069589Rat
9162357LOC103692682uncharacterized LOC1036926826112508186112521696Rat
11453906LOC108351353uncharacterized LOC1083513536112800628112801667Rat
1597103LOC366703similar to JTV16113533141113534206Rat
2323161LOC100363383hypothetical LOC1003633836113618173113625818Rat
11519988LOC108351283uncharacterized LOC1083512836114080122114098106Rat
6495473LOC100910948glyceraldehyde-3-phosphate dehydrogenase-like6114241214114242209Rat
2323565LOC100363030hypothetical LOC1003630306114342681114344106Rat
68418Dio2iodothyronine deiodinase 26114475156114489443Rat
9154799LOC10369268340S ribosomal protein S10 pseudogene6114509849114511075Rat
7592980LOC102549780uncharacterized LOC1025497806114633277114744732Rat
1595693Cep128centrosomal protein 1286114759474115158004Rat
11412945LOC108351284uncharacterized LOC1083512846114921004114930445Rat
11400925LOC108351285uncharacterized LOC1083512856114940952114946271Rat
3911Tshrthyroid stimulating hormone receptor6115170290115306871Rat
69246Gtf2a1general transcription factor 2A subunit 16115321110115352659Rat
1311502Ston2stonin 26115398586115547552Rat
7593746LOC102551017uncharacterized LOC1025510176115432218115439684Rat
7648366LOC102550912low molecular weight phosphotyrosine protein phosphatase-like6115495209115497544Rat
620147Sel1lSEL1L adaptor subunit of ERAD E3 ubiquitin ligase6115572683115616904Rat
7584678LOC102551314glyceraldehyde-3-phosphate dehydrogenase-like6115769359115821734Rat
6492283LOC100911513prohibitin-like6115943101115944389Rat
1563312LOC500702LRRGT000516116172818116235692Rat
11488958LOC108351286uncharacterized LOC1083512866116654055116656064Rat
2322957LOC100363488hypothetical LOC1003634886116770798116772439Rat
6487637LOC100912304non-histone chromosomal protein HMG-17-like6116961818116962111Rat
1593493LOC689371similar to karyopherin (importin) alpha 26117237475117240496Rat
7532379LOC102556510uncharacterized LOC1025565106117370839117444902Rat
7581830LOC102546459uncharacterized LOC1025464596117482260117518536Rat
1597102LOC366705similar to proliferation-associated 2G4, 38kDa6117971711117972898Rat
9078820LOC103692684small ubiquitin-related modifier 2 pseudogene6118045259118045712Rat
1597101LOC366706hypothetical LOC3667066118114186118114596Rat
2323515LOC100359725histone H3.3B-like6118233643118234069Rat
1592286LOC689476hypothetical protein LOC6894766118440944118445650Rat
1597100LOC366709similar to prohibitin6118507547118509052Rat
9303245LOC103692685uncharacterized LOC1036926856118511635118527982Rat
11372657LOC108351287uncharacterized LOC1083512876118579760118605084Rat
7532737LOC102549466uncharacterized LOC1025494666119132163119149700Rat
7551483LOC102549614uncharacterized LOC1025496146119146934119185956Rat
9077425LOC103692686uncharacterized LOC1036926866119163018119222423Rat
7726403LOC102549677uncharacterized LOC1025496776119358934119360762Rat
11486546LOC108351288uncharacterized LOC1083512886119506044119518327Rat
1308574Flrt2fibronectin leucine rich transmembrane protein 26119518459119613534Rat
2323258LOC100359885hypothetical LOC1003598856120284200120284826Rat
11392001LOC108351289uncharacterized LOC1083512896120648283120735152Rat
7696501LOC102549969uncharacterized LOC1025499696121389149121478742Rat
7658560LOC102550062uncharacterized LOC1025500626121478861121537656Rat
1566048RGD1566048similar to polyglutamine tract binding protein-16121592399121595792Rat
6501076LOC100909953cofilin-1-like6121611816121612531Rat
1359384Galcgalactosylceramidase6122177195122239411Rat
1311832Gpr65G-protein coupled receptor 656122248528122256115Rat
619732Kcnk10potassium two pore domain channel subfamily K member 106122417079122549532Rat
621010Spata7spermatogenesis associated 76122603248122648718Rat
7691252LOC102550278ferritin light chain 1-like6122652768122654370Rat
620216Ptpn21protein tyrosine phosphatase, non-receptor type 216122656500122721496Rat
621850Zc3h14zinc finger CCCH type containing 146122729834122767462Rat
1303275Eml5EMAP like 56122768939122898046Rat
1307769Ttc8tetratricopeptide repeat domain 86122920308122974525Rat
9231535LOC103692687uncharacterized LOC1036926876122974836122982941Rat
7688606LOC102550434uncharacterized LOC1025504346123016732123113258Rat
631343Cpg1candidate plasticity gene 16123034304123046297Rat
7600821LOC102550380uncharacterized LOC1025503806123083689123089140Rat
1305711Foxn3forkhead box N36123183720123577719Rat
9331236LOC103692689uncharacterized LOC1036926896123322105123334679Rat
7690509LOC102550790uncharacterized LOC1025507906123355379123358543Rat
9164466LOC103692688uncharacterized LOC1036926886123483113123486564Rat
7744018LOC102550560uncharacterized LOC1025505606123577850123605500Rat
11463868LOC108351290uncharacterized LOC1083512906123713566123729521Rat
1565006Efcab11EF-hand calcium binding domain 116123742971123894714Rat
1309618Tdp1tyrosyl-DNA phosphodiesterase 16123895860123963688Rat
68941Kcnk13potassium two pore domain channel subfamily K member 136123971030124077249Rat
2323066LOC100359979malate dehydrogenase, cytoplasmic-like6124092985124102401Rat
621097Psmc1proteasome 26S subunit, ATPase 16124123283124135644Rat
1565082Nrde2NRDE-2, necessary for RNA interference, domain containing6124136949124177426Rat
9403100LOC103692690protein app1-like6124164501124167334Rat
11404343LOC108351372uncharacterized LOC1083513726124199059124202417Rat
2257Calm1calmodulin 16124217241124225292Rat
1305920Ttc7btetratricopeptide repeat domain 7B6124316444124528058Rat
1308336Rps6ka5ribosomal protein S6 kinase A56124557892124735787Rat
1585283LOC688724similar to transmembrane protein 116124648398124690988Rat
1311756DglucyD-glutamate cyclase6124786164124870244Rat
1309559Gpr68G protein-coupled receptor 686124874151124903949Rat
1307429Ccdc88ccoiled-coil domain containing 88C6124905811125028011Rat
1309059Ppp4r3aprotein phosphatase 4, regulatory subunit 3A6125040803125083496Rat
1585189LOC690022similar to 40S ribosomal protein S36125107563125117014Rat
1595902LOC299254similar to laminin receptor 1 (ribosomal protein SA)6125117355125118351Rat
1564044Kif4bkinesin family member 4B6125134351125138909Rat
6500065Catsperbcation channel sperm associated auxiliary subunit beta6125153124125391303Rat
7742786LOC102547705glucose-6-phosphate 1-dehydrogenase-like6125210659125213700Rat
2322650LOC100360199neugrin-like6125256045125256798Rat
6499799LOC100910182galactocerebrosidase-like6125277970125307470Rat
7533718LOC102553138ovarian cancer G-protein coupled receptor 1-like6125316218125319634Rat
7577463LOC102552180uncharacterized LOC1025521806125383301125391297Rat
1563876Tc2ntandem C2 domains, nuclear6125437767125601408Rat
2594Fbln5fibulin 56125644797125723957Rat
1586166Trip11thyroid hormone receptor interactor 116125741520125812926Rat
621567Atxn3ataxin 36125817420125853461Rat
7555383LOC102547799putative 60S ribosomal protein L37a-like6125829890125831137Rat
6487218Ndufb1NADH:ubiquinone oxidoreductase subunit B16125861219125870231Rat
9416112LOC103692691uncharacterized LOC1036926916125861989125862824Rat
6489824LOC100911956protein LLP homolog6125863966125865098Rat
1309687Cpsf2cleavage and polyadenylation specific factor 26125870372125898039Rat
1305926Slc24a4solute carrier family 24 member 46126015799126158727Rat
1305849Rin3Ras and Rab interactor 36126170672126279682Rat
9453945LOC103692693uncharacterized LOC1036926936126172883126173909Rat
9371122LOC103692692uncharacterized LOC1036926926126271776126278731Rat
619832Lgmnlegumain6126282246126308207Rat
7543021LOC102548124uncharacterized LOC1025481246126330696126342359Rat
1308163Golga5golgin A56126350572126378735Rat
9191681LOC103692694uncharacterized LOC1036926946126398504126399810Rat
2338Chgachromogranin A6126434226126445569Rat
1595691Itpk1inositol-tetrakisphosphate 1-kinase6126448920126582188Rat
7693843LOC102548189uncharacterized LOC1025481896126531347126540163Rat
9278194LOC103692695uncharacterized LOC1036926956126553472126563700Rat
7636337LOC102548370uncharacterized LOC1025483706126594055126602532Rat
1307230Moap1modulator of apoptosis 16126620597126622532Rat
2302582Gon7GON7 subunit of KEOPS complex6126620597126636484Rat
1566396Tmem251transmembrane protein 2516126622692126630642Rat
1359144Ubr7ubiquitin protein ligase E3 component n-recognin 76126636596126656513Rat
1306262Btbd7BTB domain containing 76126658398126748497Rat
6489562LOC100912037nuclear nucleic acid-binding protein C1D-like6126671110126674755Rat
9429733LOC103692710homeobox protein Hox-A13-like6126710812126750646Rat
727840Cox8ccytochrome c oxidase subunit 8C6126766967126768290Rat
1311117Unc79unc-79 homolog, NALCN channel complex subunit6126818580127069026Rat
11362626LOC108351291alpha-enolase pseudogene6126909584126911070Rat
11413859LOC108351292uncharacterized LOC1083512926127067318127075169Rat
1583978Prima1proline rich membrane anchor 16127075954127127985Rat
1309028RGD1309028similar to RIKEN cDNA A830059I206127202428127208968Rat
1306414Asb2ankyrin repeat and SOCS box-containing 26127212325127248451Rat
7501932LOC102549032uncharacterized LOC1025490326127255033127265262Rat
1306688Otub2OTU deubiquitinase, ubiquitin aldehyde binding 26127282445127301086Rat
727929Ddx24DEAD-box helicase 246127302201127319382Rat
69404Ifi27interferon, alpha-inducible protein 276127327959127334430Rat
1559721Ifi27l2binterferon, alpha-inducible protein 27 like 2B6127336305127337791Rat
11359726LOC108351293uncharacterized LOC1083512936127378468127390214Rat
7690812LOC102549139uncharacterized LOC1025491396127390062127400170Rat
1560932Ppp4r4protein phosphatase 4, regulatory subunit 46127400585127497280Rat
621220Serpina10serpin family A member 106127500014127508470Rat
1595901Serpina6serpin family A member 66127523948127534178Rat
727888Serpina16serine (or cysteine) peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 166127544773127552151Rat
1307899Serpina1fserpin family A member 1F6127564811127571016Rat
1597377LOC690311similar to Alpha-1-antitrypsin-related protein precursor6127569502127582204Rat
1597369LOC690319similar to Alpha-1-antitrypsin-related protein precursor6127590734127608412Rat
3326Serpina1serpin family A member 16127610241127632265Rat
9343717LOC103692696uncharacterized LOC1036926966127637943127646559Rat
1359239Serpina11serpin family A member 116127647180127656603Rat
1304789Serpina9serpin family A member 96127662348127680232Rat
11395481LOC108351294uncharacterized LOC1083512946127696265127698604Rat
708485Serpina12serpin family A member 126127696501127711238Rat
708581Serpina4serpin family A member 46127743883127753047Rat
619817Serpina5serpin family A member 56127753152127772403Rat
735068Serpina3mserpin family A member 3M6127808785127816067Rat
1584965LOC314407similar to importin 116127839368127842386Rat
1595900LOC299277similar to serine (or cysteine) peptidase inhibitor, clade A, member 3B6127871895127888287Rat
1597296LOC690397similar to serine (or cysteine) peptidase inhibitor, clade A, member 3B6127899234127904746Rat
1565462RGD1565462similar to BC049975 protein6127927709127935068Rat
1562479LOC500712Ab1-2336127941526127964589Rat
2972Serpina3cserine (or cysteine) proteinase inhibitor, clade A, member 3C6127996162128003433Rat
3745LOC299282Serine protease inhibitor6128046780128062241Rat
3747Serpina3nserine (or cysteine) peptidase inhibitor, clade A, member 3N6128073344128080878Rat
1596073LOC690435hypothetical protein LOC6904356128093472128117579Rat
9083627LOC103692711homeobox protein goosecoid-like6128138757128140192Rat
631425Gscgoosecoid homeobox6128147181128149220Rat
9324188LOC103692697uncharacterized LOC1036926976128149336128151459Rat
1309381Dicer1dicer 1 ribonuclease III6128388084128453234Rat
9246618LOC103692712uncharacterized LOC1036927126128433986128463211Rat
1306741Clmncalmin6128473592128567267Rat
7670252LOC102555497uncharacterized LOC1025554976128569376128586364Rat
11414160LOC108351295uncharacterized LOC1083512956128600388128603651Rat
1304563Syne3spectrin repeat containing, nuclear envelope family member 36128639036128716061Rat
1563476Rpl6-ps1ribosomal protein L6, pseudogene 16128738363128739339Rat
6487638LOC100912305uncharacterized LOC1009123056128748739128750428Rat
1308383Glrx5glutaredoxin 56128750503128760880Rat
6487778LOC100912332uncharacterized LOC1009123326128758426128761286Rat
9440657LOC103692698MLV-related proviral Env polyprotein-like6128841113128845369Rat
1594686Tcl1aTcl1 family Akt coactivator A6128888768128894761Rat
11429252LOC108351373uncharacterized LOC1083513736128902527128903719Rat
11372449LOC108351374uncharacterized LOC1083513746128906591128910278Rat
11500573LOC108351375uncharacterized LOC1083513756128927330128928649Rat
11389885LOC108351339endogenous retrovirus group K member 19 Pol protein-like6128952392128957064Rat
9413635LOC103690121uncharacterized LOC1036901216128960199128964242Rat
6504274Fam181afamily with sequence similarity 181, member A6128969513128976013Rat
6503583LOC100909439ankyrin repeat and SOCS box protein 2-like6128985265128990709Rat
6503178LOC100909476ATP-dependent RNA helicase DDX24-like6128995015129001611Rat
6503444LOC100909524protein Z-dependent protease inhibitor-like6129004249129012705Rat
6503028LOC100909567serine protease inhibitor A3B-like6129024013129029617Rat
6502633LOC100909605serine protease inhibitor A3F-like6129052476129060050Rat
11450443LOC108351296uncharacterized LOC1083512966129102259129112109Rat
6500901LOC100909917uncharacterized LOC1009099176129148295129193684Rat
6501064LOC100909954uncharacterized LOC1009099546129259581129322113Rat
7729657LOC102550757uncharacterized LOC1025507576129279839129282827Rat
2201Bdkrb2bradykinin receptor B26129399468129429676Rat
9078821LOC103692699uncharacterized LOC1036926996129402430129411068Rat
620401Bdkrb1bradykinin receptor B16129437423129441553Rat
1304878Atg2bautophagy related 2B6129449451129519599Rat
1308470GskipGSK3B interacting protein6129512950129536320Rat
1309600Ak7adenylate kinase 76129538648129606960Rat
1308673Papolapoly (A) polymerase alpha6129609068129662002Rat
7668175LOC102551116uncharacterized LOC1025511166129791489129795723Rat
11498195LOC108351297uncharacterized LOC1083512976129835318129835820Rat
1306069Vrk1VRK serine/threonine kinase 16129835788129902839Rat
7677646LOC102551214uncharacterized LOC1025512146130110332130112713Rat
7574917LOC102554026uncharacterized LOC1025540266130313652130320507Rat
9179167LOC103692700uncharacterized LOC1036927006130995164131000946Rat
9180282LOC103692701uncharacterized LOC1036927016131252459131253518Rat
7564924LOC10255441440S ribosomal protein S6-like6131462045131462810Rat
6496142LOC100910833histone-lysine N-methyltransferase setd3-like6131602149131650424Rat
1311128Bcl11bBAF chromatin remodeling complex subunit BCL11B6131834097131927251Rat
9338625LOC103692704uncharacterized LOC1036927046131861118131864450Rat
9396023LOC103692703uncharacterized LOC1036927036131876681131878904Rat
9170090LOC103692702uncharacterized LOC1036927026131900041131909240Rat
1309550Setd3SET domain containing 3, actin histidine methyltransferase6132023128132090072Rat
1595690Ccnkcyclin K6132090235132113560Rat
1589818Ccdc85ccoiled-coil domain containing 85C6132113806132183434Rat
7625983LOC102554801uncharacterized LOC1025548016132186660132191228Rat
1311698Hhipl1HHIP-like 16132218583132242852Rat
1306605Cyp46a1cytochrome P450, family 46, subfamily a, polypeptide 16132242328132273788Rat
1306374Eml1EMAP like 16132367342132450488Rat
621150EvlEnah/Vasp-like6132470283132590242Rat
7576094LOC102555052uncharacterized LOC1025550526132523083132551389Rat
11419405LOC108351298E3 ubiquitin-protein ligase RNF34 pseudogene6132532963132536490Rat
2325615Mir342microRNA 3426132561169132561267Rat
1305023Degs2delta(4)-desaturase, sphingolipid 26132591968132608600Rat
1588675Ybx1-ps7Y box protein 1 related, pseudogene 76132645143132654052Rat
11503689LOC108351299uncharacterized LOC1083512996132670125132672233Rat
3982Yy1YY1 transcription factor6132702443132726848Rat
9439988LOC103692705S-phase kinase-associated protein 1 pseudogene6132708214132714675Rat
1308104Slc25a29solute carrier family 25 member 296132736964132747912Rat
2325465Mir345microRNA 3456132748968132749063Rat
1303247Slc25a47solute carrier family 25, member 476132762306132767940Rat
1308278Wars1tryptophanyl-tRNA synthetase 16132771026132802262Rat
1562505Wdr25WD repeat domain 256132802327132932254Rat
708347Begainbrain-enriched guanylate kinase-associated6132936964132972569Rat
7729423LOC102555774uncharacterized LOC1025557746133170169133171409Rat
9075746LOC103692713uncharacterized LOC1036927136133296698133299026Rat
9325997LOC10369271440S ribosomal protein S18-like6133394255133404910Rat
619931Dlk1delta like non-canonical Notch ligand 16133576513133583751Rat
7648501LOC102557203uncharacterized LOC1025572036133645582133653099Rat
1566401RGD1566401similar to GTL2, imprinted maternally expressed untranslated6133658937133691130Rat
2325415Mir770microRNA 7706133682965133683040Rat
2325493Mir673microRNA 6736133691381133691463Rat
2325524Mir493microRNA 4936133699509133699592Rat
2325618Mir337microRNA 3376133705920133706016Rat
4888562Mir3544microRNA 35446133705932133706019Rat
2325368Mir540microRNA 5406133706202133706285Rat
2325437Mir665microRNA 6656133706457133706550Rat
11378340Rtl1retrotransposon-like 16133710207133721191Rat
2325450Mir431microRNA 4316133711425133711538Rat
2325423Mir433microRNA 4336133712334133712426Rat
2325430Mir127microRNA 1276133713430133713526Rat
4888615Mir3543microRNA 35436133715345133715459Rat
2325442Mir434microRNA 4346133715378133715458Rat
2325384Mir136microRNA 1366133716761133716842Rat
9685630Mir341microRNA 3416133733240133733335Rat
4888588Mir1188microRNA 11886133733578133733659Rat
2325369Mir370microRNA 3706133739916133739994Rat
2325447Mir379microRNA 3796133857700133857784Rat
2325500Mir411microRNA 4116133858849133858924Rat
4888603Mir299bmicroRNA 299b6133859295133859412Rat
2325540Mir299microRNA 2996133859324133859386Rat
4888583Mir3579microRNA 35796133860473133860585Rat
2325443Mir380microRNA 3806133860490133860566Rat
2325625Mir323microRNA 3236133861199133861284Rat
2325440Mir758microRNA 7586133861498133861575Rat
2325621Mir329microRNA 3296133862168133862264Rat
2325523Mir494microRNA 4946133864370133864452Rat
4888541Mir1193microRNA 11936133864698133864817Rat
2325471Mir666microRNA 6666133866523133866621Rat
2325526Mir543microRNA 5436133866660133866739Rat
2325496Mir495microRNA 4956133868288133868367Rat
2325472Mir667microRNA 6676133869570133869661Rat
2325522Mir376cmicroRNA 376c6133872439133872522Rat
2325421Mir376bmicroRNA 376b6133873095133873180Rat
4888533Mir3595microRNA 35956133873587133873706Rat
2325367Mir376amicroRNA 376a6133873605133873686Rat
2325424Mir300microRNA 3006133874152133874230Rat
2325521Mir381microRNA 3816133876615133876675Rat
2325343Mir487bmicroRNA 487b6133877124133877205Rat
4888585Mir3576microRNA 35766133877812133877926Rat
2325448Mir539microRNA 5396133877832133877907Rat
7489042Mir6331microRNA 63316133878578133878700Rat
2325481Mir544microRNA 5446133879169133879246Rat
4888569Mir3592microRNA 35926133884161133884276Rat
2325520Mir382microRNA 3826133884178133884257Rat
2325429Mir134microRNA 1346133884547133884619Rat
2325353Mir668microRNA 6686133885141133885208Rat
2325519Mir485microRNA 4856133885299133885377Rat
2325562Mir154microRNA 1546133888586133888669Rat
2325410Mir496microRNA 4966133889283133889361Rat
2325344Mir377microRNA 3776133890690133890761Rat
2325525Mir541microRNA 5416133892655133892744Rat
4888593Mir3581microRNA 35816133893418133893497Rat
2325366Mir409microRNA 4096133893419133893495Rat
2325529Mir412microRNA 4126133893571133893640Rat
4888586Mir3578microRNA 35786133893672133893788Rat
2325518Mir369microRNA 3696133893693133893771Rat
2325501Mir410microRNA 4106133893997133894072Rat
7489041Mir3072microRNA 30726133898795133898905Rat
1597098LOC366728similar to ribosomal protein L3 isoform b6133965856133967045Rat
11366014LOC108351376uncharacterized LOC1083513766134185730134187379Rat
7671458LOC102546378uncharacterized LOC1025463786134313483134314723Rat
7653627Dio3osDIO3 opposite strand upstream RNA6134623450134626974Rat
9685092Mir1247microRNA 12476134626097134626178Rat
68420Dio3iodothyronine deiodinase 36134627278134629139Rat
11407431LOC108351301uncharacterized LOC1083513016134711770134713014Rat
7577271LOC102546875uncharacterized LOC1025468756134713247134722650Rat
7503814LOC102546759uncharacterized LOC1025467596134722859134728701Rat
2323734LOC100362959hypothetical LOC1003629596134760371134762569Rat
7648879LOC102546957uncharacterized LOC1025469576134770560134775100Rat
1585097Ppp2r5cprotein phosphatase 2, regulatory subunit B', gamma6134804128134941912Rat
7661450LOC102547242uncharacterized LOC1025472426134834805134843511Rat
7496779LOC102547175uncharacterized LOC1025471756134838357134839708Rat
9279266LOC103692715uncharacterized LOC1036927156134951426134953528Rat
2511Dync1h1dynein cytoplasmic 1 heavy chain 16134958854135085769Rat
9288399LOC103690170uncharacterized LOC1036901706135022606135036089Rat
9292348LOC103692716heat shock protein HSP 90-alpha6135044833135050417Rat
1305298RGD1305298hypothetical LOC2993306135085566135098513Rat
631409Hsp90aa1heat shock protein 90 alpha family class A member 16135107262135112793Rat
7503866LOC102549239uncharacterized LOC1025492396135112997135118200Rat
11469370LOC10835137760S ribosomal protein L35a pseudogene6135139217135139658Rat
1306499Wdr20WD repeat domain 206135156984135226425Rat
1309274MokMOK protein kinase6135228755135259645Rat
11458125LOC108351302uncharacterized LOC1083513026135259712135269682Rat
11511766Trnai-aau3transfer RNA isoleucine (anticodon AAU) 36135266567135266640Rat
1562557Zfp839zinc finger protein 8396135269727135287371Rat
9169459LOC103692717uncharacterized LOC1036927176135288305135290968Rat
1563395Cinpcyclin-dependent kinase 2-interacting protein6135290528135304422Rat
1307503Tecpr2tectonin beta-propeller repeat containing 26135304536135405865Rat
1307662Ankrd9ankyrin repeat domain 96135409698135412552Rat
7505493Rcor1REST corepressor 16135475470135552155Rat
7560937LOC102547964uncharacterized LOC1025479646135562667135565437Rat
1304633Traf3Tnf receptor-associated factor 36135610698135720247Rat
1308634Amnamnion associated transmembrane protein6135724455135731896Rat
621753Cdc42bpbCDC42 binding protein kinase beta6135746743135830144Rat
1560608Lbhd2LBH domain containing 26135856218135861059Rat
1307749Exoc3l4exocyst complex component 3-like 46135866132135880724Rat
1594556Tnfaip2TNF alpha induced protein 26135890869135903647Rat
1565168Diras3DIRAS family GTPase 36135938345135940205Rat
7735855LOC102554678uncharacterized LOC1025546786135940217135946964Rat
9372492LOC103692718uncharacterized LOC1036927186135982533136000677Rat
11471634NEWGENE_619861eukaryotic translation initiation factor 56136002962136011409Rat
619861Eif5eukaryotic translation initiation factor 56136002983136011409Rat
7596428LOC102554517transcription initiation factor TFIID subunit 4-like6136040164136040772Rat
619883Mark3microtubule affinity regulating kinase 36136040957136129780Rat
2357Ckbcreatine kinase B6136142956136145838Rat
1359191Trmt61atRNA methyltransferase 61A6136150768136156785Rat
1310847Bag5BAG cochaperone 56136180640136185651Rat
1304719Coa8cytochrome c oxidase assembly factor 86136185772136210936Rat
11399534LOC108351303uncharacterized LOC1083513036136197503136198263Rat
9330187LOC103692719tRNA (adenine(58)-N(1))-methyltransferase catalytic subunit TRMT61A6136244466136250496Rat
9457021Bag5l1BCL2-associated athanogene 5-like 16136274351136279414Rat
1304719Coa8cytochrome c oxidase assembly factor 86136279476136304317Rat
11440664LOC108351304uncharacterized LOC1083513046136291165136291925Rat
621411Klc1kinesin light chain 16136330151136373716Rat
1306849Xrcc3X-ray repair cross complementing 36136366917136380751Rat
1311036Zfyve21zinc finger FYVE-type containing 216136380968136400810Rat
1304651Ppp1r13bprotein phosphatase 1, regulatory subunit 13B6136397658136469757Rat
2324773LOC100363116hypothetical protein LOC1003631166136473683136475156Rat
7560279LOC102548399uncharacterized LOC1025483996136493758136502379Rat
6486223LOC1009125576.8 kDa mitochondrial proteolipid-like6136525892136531509Rat
1306942Tdrd9tudor domain containing 96136536636136650481Rat
1583936LOC691437similar to ATP synthase, H+ transporting, mitochondrial Fo complex, subunit G6136540846136541265Rat
1305627Rd3lRD3 like6136548412136550316Rat
7592659LOC102548527rRNA 2'-O-methyltransferase fibrillarin-like6136566921136569284Rat
708388Aspgasparaginase6136682279136701673Rat
4888612Mir3545microRNA 35456136704947136705061Rat
2325452Mir203microRNA 2036136704961136705057Rat
1307957Kif26akinesin family member 26A6136720254136755515Rat
11496885LOC108351305uncharacterized LOC1083513056136903531136908774Rat
7699217LOC102549170uncharacterized LOC1025491706136931079136945020Rat
9403112LOC103692720uncharacterized LOC1036927206137021169137023568Rat
1583888LOC691485hypothetical protein LOC6914856137063532137073406Rat
1310269Tmem179transmembrane protein 1796137073684137084739Rat
7641989LOC102552388uncharacterized LOC1025523886137116766137122703Rat
1308350Inf2inverted formin 26137162593137180198Rat
1590342Adssl1adenylosuccinate synthase like 16137184818137206694Rat
1561872Siva1SIVA1, apoptosis-inducing factor6137209999137214379Rat
2081Akt1AKT serine/threonine kinase 16137218398137239970Rat
1582758Zbtb42zinc finger and BTB domain containing 426137238899137247115Rat
1595689Cep170bcentrosomal protein 170B6137283814137311512Rat
7635982LOC102552635uncharacterized LOC1025526356137311113137313442Rat
1598308Pld4phospholipase D family, member 46137323713137331231Rat
1309696Ahnak2AHNAK nucleoprotein 26137335273137380219Rat
1307315Clba1clathrin binding box of aftiphilin containing 16137386694137393490Rat
1563593Cdca4cell division cycle associated 46137396133137421283Rat
9077436LOC103692725probable fibrosin-16137580158137608017Rat
1310817Gpr132G protein-coupled receptor 1326137652213137671658Rat
9430186LOC103692726keratin-associated protein 5-9-like6137692566137693354Rat
2938Jag2jagged canonical Notch ligand 26137711144137733331Rat
1310583Nudt14nudix hydrolase 146137738150137745143Rat
1311158Brf1BRF1, RNA polymerase III transcription initiation factor subunit6137762230137808573Rat
1597323Btbd6BTB domain containing 66137785662137788442Rat
1597262Pacs2phosphofurin acidic cluster sorting protein 26137824136137889144Rat
1597257Tex22testis expressed 226137889197137903312Rat
621018Mta1metastasis associated 16137911302137950066Rat
1302959Crip2cysteine-rich protein 26137953545137958491Rat
1597237Crip1cysteine rich protein 16137959171137967042Rat
1596085Tedc1tubulin epsilon and delta complex 16137967119137976324Rat
1597216Tmem121transmembrane protein 1216137994675138002897Rat
9394498LOC103692721uncharacterized LOC1036927216138051812138052405Rat
2880Igheimmunoglobulin heavy constant epsilon6138066728138068606Rat
1597096LOC366738similar to dihydrolipoamide dehydrogenase (E3 component of pyruvate dehydrogenase complex, 2-oxo-glutarate complex, branched chain keto acid dehydrogenase complex)6138188467138190108Rat

Nucleotide Sequences
GenBank Nucleotide FQ215299 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ219106 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (Rnor_6.0)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
2301972Bp325Blood pressure QTL 3254.8arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)6175623393Rat
1354664Slep2Serum leptin concentration QTL 24.49blood leptin amount (VT:0005667)serum leptin level (CMO:0000780)6112039375023446Rat
1576309Emca7Estrogen-induced mammary cancer QTL 74mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)62537030111715717Rat
1578665Bss16Bone structure and strength QTL 164.4femur morphology trait (VT:0000559)bone trabecular cross-sectional area (CMO:0002311)6616172276002731Rat
1578668Bmd14Bone mineral density QTL 143.8femur mineral mass (VT:0010011)total volumetric bone mineral density (CMO:0001728)6616172276002731Rat
4145119Mcs25Mammary carcinoma susceptibility QTL 250.0001mammary gland integrity trait (VT:0010552)ratio of deaths to total study population during a period of time (CMO:0001023)67009971115379601Rat
634322Bw12Body weight QTL 120body mass (VT:0001259)body weight (CMO:0000012)71017386255173862Rat
1300164Rf15Renal function QTL 153.12renal blood flow trait (VT:2000006)absolute change in renal blood flow rate (CMO:0001168)61312295857516539Rat
10401812Kidm54Kidney mass QTL 54kidney mass (VT:0002707)both kidneys wet weight (CMO:0000085)61681010761810107Rat
10401800Kidm49Kidney mass QTL 49kidney mass (VT:0002707)both kidneys wet weight (CMO:0000085)61681010761810107Rat
8552910Pigfal5Plasma insulin-like growth factor 1 level QTL 54.3blood insulin-like growth factor amount (VT:0010479)plasma insulin-like growth factor 1 level (CMO:0001299)61941788764417887Rat
1641898Colcr4Colorectal carcinoma resistance QTL43.710.0007intestine integrity trait (VT:0010554)well differentiated malignant colorectal tumor surface area measurement (CMO:0002077)62151530265784818Rat
2293839Kiddil2Kidney dilation QTL 24.8kidney pelvis morphology trait (VT:0004194)hydronephrosis severity score (CMO:0001208)62204285484763421Rat
2293841Kiddil4Kidney dilation QTL 44.4kidney pelvis morphology trait (VT:0004194)hydronephrosis severity score (CMO:0001208)62204285484763421Rat
8693632Alc27Alcohol consumption QTL 272.20.791drinking behavior trait (VT:0001422)calculated ethanol drink intake rate (CMO:0001615)63425776653855198Rat
1300143Rf14Renal function QTL 142.92renal blood flow trait (VT:2000006)absolute change in renal blood flow rate (CMO:0001168)63436743680490628Rat
1331779Rf38Renal function QTL 382.876kidney blood vessel physiology trait (VT:0100012)absolute change in renal vascular resistance (CMO:0001900)63499565675623393Rat
634318Bw118Body weight QTL 1183.55abdominal fat pad mass (VT:1000711)abdominal fat pad weight (CMO:0000088)63626028860606186Rat
6893340Cm77Cardiac mass QTL 770.260.57heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)63626028884763275Rat
1354632Scl29Serum cholesterol level QTL 293.74blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)63760898075023446Rat
634307Bp141Blood pressure QTL 1414arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)63810630883106308Rat
70199Coreg1Compensatory renal growth QTL 111.8kidney mass (VT:0002707)compensatory renal growth score (CMO:0001894)63819641260606431Rat
9590290Uminl2Urine mineral level QTL 23.960.001urine mineral amount (VT:0015086)urine electrolyte level (CMO:0000593)64167904686679046Rat
9590306Scort18Serum corticosterone level QTL 182.880.001blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)64167904686679046Rat
9590140Scort4Serum corticosterone level QTL 414.490.001blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)64167904686679046Rat
634330Pia16Pristane induced arthritis QTL 163.9joint integrity trait (VT:0010548)arthritic paw count (CMO:0001460)648432758108268790Rat
4889848Pur25Proteinuria QTL 25140.003total urine protein amount (VT:0000032)urine total protein excretion rate (CMO:0000756)65980306594001333Rat
1558641Cm47Cardiac mass QTL 472.90.001heart mass (VT:0007028)heart wet weight (CMO:0000069)660606431108154445Rat
6893332Cm74Cardiac mass QTL 740.40.64heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)660606431108154445Rat
70176Mcsm1Mammary carcinoma susceptibility modifier QTL 1mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)662263348107263348Rat
12801471Schws9Schwannoma susceptibility QTL 9nervous system integrity trait (VT:0010566)percentage of study population developing trigeminal nerve neurilemmomas during a period of time (CMO:0002017)666129520111129520Rat
2293088Iddm28Insulin dependent diabetes mellitus QTL 285.21blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)66622261275023308Rat
731173Uae22Urinary albumin excretion QTL 2210.1urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)668781170147991367Rat
2290393Uae37Urinary albumin excretion QTL 370.0001urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)668781170147991367Rat
1641904Alcrsp4Alcohol response QTL 4response to alcohol trait (VT:0010489)duration of loss of righting reflex (CMO:0002289)671206251116206251Rat
1300075Glom7Glomerulus QTL 75.60.0000002kidney glomerulus morphology trait (VT:0005325)count of superficial glomeruli not directly contacting the kidney surface (CMO:0001002)675449871120449871Rat
1331789Rf37Renal function QTL 373.224kidney blood vessel physiology trait (VT:0100012)absolute change in renal vascular resistance (CMO:0001900)675623277120276465Rat
70196BpQTLcluster7Blood pressure QTL cluster 76.82arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)675623277120623277Rat
724536Uae7Urinary albumin excretion QTL 73.5urine albumin amount (VT:0002871)urine albumin level (CMO:0000130)675623277136143011Rat
1331799Bp211Blood pressure QTL 2113.66407arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)675623277136426962Rat
2301964Bp323Blood pressure QTL 3234.3arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)67562339384763275Rat
1581550Pur8Proteinuria QTL 8total urine protein amount (VT:0000032)urine total protein excretion rate (CMO:0000756)675623393136142742Rat
1581563Uae33Urinary albumin excretion QTL 33urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)675623393136142742Rat
724524Uae2Urinary albumin excretion QTL 22.70.0005urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)676902247114203334Rat
2293837Kiddil1Kidney dilation QTL 13.7kidney pelvis morphology trait (VT:0004194)hydronephrosis severity score (CMO:0001208)684763275108464097Rat
2293842Kiddil3Kidney dilation QTL 34.3kidney pelvis morphology trait (VT:0004194)hydronephrosis severity score (CMO:0001208)684763275108464097Rat
737827Hcar11Hepatocarcinoma resistance QTL 114.4liver integrity trait (VT:0010547)liver tumorous lesion number (CMO:0001068)686422697115379601Rat
1576302Schws4Schwannoma susceptibility QTL 40.0078nervous system integrity trait (VT:0010566)percentage of study population developing trigeminal nerve neurilemmomas during a period of time (CMO:0002017)687418448111129520Rat
738034Anxrr5Anxiety related response QTL 55.9exploratory behavior trait (VT:0010471)percentage of entries into a discrete space in an experimental apparatus (CMO:0000961)688507712133507712Rat
724513Uae14Urinary albumin excretion QTL 146.5urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)688996335139410483Rat
10054138Gmadr3Adrenal mass QTL 33.680.00045adrenal gland mass (VT:0010420)both adrenal glands wet weight (CMO:0000164)689631358134631358Rat
10054123Srcrt6Stress Responsive Cort QTL 62.50.0043blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)689631358134631358Rat
1300076Glom8Glomerulus QTL 870.000000009kidney glomerulus morphology trait (VT:0005325)count of superficial glomeruli directly contacting the kidney surface (CMO:0001001)691703409136703409Rat
2303624Vencon5Ventilatory control QTL 54.45respiration trait (VT:0001943)minute ventilation (VE) (CMO:0000132)692879510137879510Rat
1331722Thshl1Thyroid stimulating hormone level QTL 111.70.0001blood thyroid-stimulating hormone amount (VT:0005119)serum thyroid stimulating hormone level (CMO:0001248)693706176111134673Rat
1331725Bp212Blood pressure QTL 2123.52475arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)697949772133849286Rat
12801411Schws8Schwannoma susceptibility QTL 8nervous system integrity trait (VT:0010566)percentage of study population developing trigeminal nerve neurilemmomas during a period of time (CMO:0002017)699273921144273921Rat
61414Pia3Pristane induced arthritis QTL 34.5joint integrity trait (VT:0010548)post-insult time to onset of experimental arthritis (CMO:0001450)699273921144792678Rat
8552796Vie3Viral induced encephalitis QTL 32.6brain integrity trait (VT:0010579)encephalitis incidence/prevalence measurement (CMO:0002361)6101207574147991367Rat
1358355Srcrt4Stress Responsive Cort QTL 46.39blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)6104363890147991367Rat
2313399Anxrr28Anxiety related response QTL 28aggression-related behavior trait (VT:0015014)tameness/aggressiveness composite score (CMO:0002136)6104381930138066274Rat
1331797Bp213Blood pressure QTL 2133.291arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)6108154445133849286Rat
4145118Mcs26Mammary carcinoma susceptibility QTL 260.0001mammary gland integrity trait (VT:0010552)post-insult time to mammary tumor formation (CMO:0000345)6111134524138065254Rat
737976Pia24Pristane induced arthritis QTL 24joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)6117355600147991367Rat
1298087Iddm18Insulin dependent diabetes mellitus QTL 180.0001urine glucose amount (VT:0001758)percentage of study population developing diabetes mellitus during a period of time (CMO:0001114)6121224054135658578Rat
1641917Colcr5Colorectal carcinoma resistance QTL 53.180.0009intestine integrity trait (VT:0010554)benign colorectal tumor number (CMO:0001795)6127286494144745573Rat
2293085Iddm29Insulin dependent diabetes mellitus QTL 297.66blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)6127286494147249902Rat
61329Eae9Experimental allergic encephalomyelitis QTL 93.7body mass (VT:0001259)change in body weight (CMO:0002045)6127286494147991367Rat
2312560Pur20Proteinuria QTL 202.10.005total urine protein amount (VT:0000032)urine total protein excretion rate (CMO:0000756)6130561943144745573Rat
71111Iddm8Insulin dependent diabetes mellitus QTL 81.90.002blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)6132652096138068606Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 298942 UniSTS
  366738 UniSTS
  366772 UniSTS
  367586 UniSTS
UniSTS 211035 UniSTS