AU048592 Marker Search Result - Rat Genome Database

Send us a Message
Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Search RGD Grant Resources Citing RGD About Us Contact Us
Genes Variants Community Projects QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data
OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer)
Aging & Age-Related Disease Cancer & Neoplastic Disease Cardiovascular Disease Coronavirus Disease Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease
Find Models   new Genetic Models Autism Models Rat PhenoMiner (Quantitative Phenotypes) Chinchilla PhenoMiner Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive
Pathways
Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Presentations Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources

Marker: AU048592

Symbol: AU048592
Previously known as:
RGD ID: 5036611
Expected Size: 199 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.24114,153,294 - 114,153,491 (+)MAPPERmRatBN7.2
mRatBN7.2719,606,763 - 19,606,814 (+)MAPPERmRatBN7.2
Rnor_6.04112,320,382 - 112,320,580NCBIRnor6.0
Rnor_5.04177,009,099 - 177,009,297UniSTSRnor5.0
RGSC_v3.44115,806,653 - 115,806,851UniSTSRGSC3.4
Celera4103,155,274 - 103,155,472UniSTS


Annotation


References - curated
# Reference Title Reference Citation
1. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer AACTGCTTTGAAGGCAAACC
Reverse Primer ACAGACACACATATACATGTGCACA
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
41343476LOC120093543uncharacterized LOC12009354371955161119637656Rat

Nucleotide Sequences
GenBank Nucleotide AU048592 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
2298550Neuinf6Neuroinflammation QTL 63.3nervous system integrity trait (VT:0010566)spinal cord RT1-B protein level (CMO:0002132)7127829089Rat
7411566Bw136Body weight QTL 13610.40.001body mass (VT:0001259)body weight gain (CMO:0000420)7131962314Rat
9590142Scort5Serum corticosterone level QTL 524.40.001blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)7131962314Rat
724560Plsm3Polydactyly-luxate syndrome (PLS) morphotypes QTL 30.0003tibia length (VT:0004357)tibia length (CMO:0000450)7134000259Rat
2317047Wbc4White blood cell count QTL 40.01leukocyte quantity (VT:0000217)white blood cell count (CMO:0000027)7135342956Rat
61410Bw19Body weight QTL 196.20.001body mass (VT:0001259)body weight (CMO:0000012)7144782185Rat
631503Bp102Blood pressure QTL 1021.9arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)7144822433Rat
1300176Hrtrt10Heart rate QTL 103.19heart pumping trait (VT:2000009)heart rate (CMO:0000002)766427026029351Rat
634336Anxrr17Anxiety related response QTL 173.66locomotor behavior trait (VT:0001392)number of entries into a discrete space in an experimental apparatus (CMO:0000960)7924703115097879Rat
10755438Coatc9Coat color QTL 90coat/hair pigmentation trait (VT:0010463)pigmented ventral coat/hair area to total ventral coat/hair area ratio (CMO:0001812)7352928048529280Rat
9590102Sffal5Serum free fatty acids level QTL 58.620.001blood free fatty acid amount (VT:0001553)plasma free fatty acids level (CMO:0000546)7532901950329019Rat
10755440Coatc10Coat color QTL 100coat/hair pigmentation trait (VT:0010463)pigmented ventral coat/hair area to total ventral coat/hair area ratio (CMO:0001812)7749649952496499Rat
10059592Kidm45Kidney mass QTL 453.950.025kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)7757398552573985Rat
2298547Neuinf5Neuroinflammation QTL 53.7nervous system integrity trait (VT:0010566)spinal cord Cd74 protein level (CMO:0002131)7946224658265113Rat
1643004Pain2Pain QTL 21mechanical nociception trait (VT:0002734)self mutilation severity score (CMO:0002145)7946224698011544Rat
1578652Bmd15Bone mineral density QTL 155.2femur mineral mass (VT:0010011)trabecular volumetric bone mineral density (CMO:0001729)7986646760460686Rat
738033Anxrr6Anxiety related response QTL 64.1exploratory behavior trait (VT:0010471)percentage of entries into a discrete space in an experimental apparatus (CMO:0000961)71557388960573889Rat
1582260Bw72Body weight QTL 723.20.0043body mass (VT:0001259)body weight (CMO:0000012)71579556538073970Rat
1582261Bw69Body weight QTL 693.20.0048body mass (VT:0001259)body weight (CMO:0000012)71579556538073970Rat
1582262Bw75Body weight QTL 7530.0038body mass (VT:0001259)body weight (CMO:0000012)71579556538073970Rat
2317059Aia15Adjuvant induced arthritis QTL 152.46joint integrity trait (VT:0010548)right rear ankle joint diameter (CMO:0002150)71700459862004598Rat
10755451Coatc11Coat color QTL 110coat/hair pigmentation trait (VT:0010463)pigmented ventral coat/hair area to total ventral coat/hair area ratio (CMO:0001812)71794435762944357Rat
70207Niddm31Non-insulin dependent diabetes mellitus QTL 313.9blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)71816950526029351Rat
61369Mcs2Mammary carcinoma susceptibility QTL 23.38mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)71903280735526300Rat
2303168Bp330Blood pressure QTL 3304.250.017arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)45214602146446691Rat
2316958Gluco58Glucose level QTL 5810blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)411320076180699135Rat
12798520Anxrr55Anxiety related response QTL 554.450.01locomotor behavior trait (VT:0001392)number of rearing movements with lid-pushing in an experimental apparatus (CMO:0002715)432583980114627242Rat
1358352Srcrt3Stress Responsive Cort QTL 32.29blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)438465774146803430Rat
1300139Hrtrt6Heart rate QTL 62.85heart pumping trait (VT:2000009)heart rate (CMO:0000002)439524264116179656Rat
1576305Emca6Estrogen-induced mammary cancer QTL 65.8mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)444463720155883716Rat
1354612Foco1Food consumption QTL 18.87eating behavior trait (VT:0001431)food intake rate (CMO:0000427)444463908148090542Rat
1354660Salc1Saline consumption QTL 111.26drinking behavior trait (VT:0001422)saline drink intake rate (CMO:0001627)444463908148090542Rat
2312567Glom19Glomerulus QTL 191.90.006kidney glomerulus morphology trait (VT:0005325)index of glomerular damage (CMO:0001135)445456990146803430Rat
1298082Stresp4Stress response QTL 4blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)450119848146803430Rat
70200Alc18Alcohol consumption QTL 189.2drinking behavior trait (VT:0001422)ethanol intake volume to total fluid intake volume ratio (CMO:0001591)456647873149491524Rat
1641833Alc21Alcohol consumption QTL 218.60.0001drinking behavior trait (VT:0001422)ethanol drink intake rate (CMO:0001407)456698790126192555Rat
738009Sach4Saccharine consumption QTL 44.90.000016consumption behavior trait (VT:0002069)saccharin intake volume to total fluid intake volume ratio (CMO:0001601)459948935154902892Rat
738016Alc16Alcohol consumption QTL 163.60.00015consumption behavior trait (VT:0002069)ethanol drink intake rate to body weight ratio (CMO:0001616)459948935154902892Rat
738031Alc14Alcohol consumption QTL 147.60.00003consumption behavior trait (VT:0002069)ethanol drink intake rate to body weight ratio (CMO:0001616)459948935154902892Rat
1549839Bw52Body weight QTL 520.0001body mass (VT:0001259)body weight gain (CMO:0000420)461697658115089733Rat
61418Pia5Pristane induced arthritis QTL 54.5joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)462277855128289560Rat
70192BpQTLcluster5Blood pressure QTL cluster 54.183arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)462933508114921294Rat
70192BpQTLcluster5Blood pressure QTL cluster 54.183arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)462933508114921294Rat
70192BpQTLcluster5Blood pressure QTL cluster 54.183arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)462933508114921294Rat
70192BpQTLcluster5Blood pressure QTL cluster 54.183arterial blood pressure trait (VT:2000000)percent change in mean arterial blood pressure (CMO:0002035)462933508114921294Rat
70192BpQTLcluster5Blood pressure QTL cluster 54.183arterial blood pressure trait (VT:2000000)percent change in systolic blood pressure (CMO:0000747)462933508114921294Rat
70192BpQTLcluster5Blood pressure QTL cluster 54.183arterial blood pressure trait (VT:2000000)absolute change in pulse pressure (CMO:0001882)462933508114921294Rat
70192BpQTLcluster5Blood pressure QTL cluster 54.183arterial blood pressure trait (VT:2000000)absolute change in mean arterial blood pressure (CMO:0000533)462933508114921294Rat
631674Iddm14Insulin dependent diabetes mellitus QTL 14blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)464528739157573521Rat
61330Eau1Experimental allergic uveoretinitis QTL 10.0003uvea integrity trait (VT:0010551)experimental autoimmune uveitis score (CMO:0001504)470362013132642728Rat
634344Hcar7Hepatocarcinoma resistance QTL 77.8liver integrity trait (VT:0010547)liver tumorous lesion area to total liver area ratio (CMO:0001075)470808386115808386Rat
634344Hcar7Hepatocarcinoma resistance QTL 77.8liver integrity trait (VT:0010547)liver tumorous lesion number (CMO:0001068)470808386115808386Rat
631646Stl4Serum triglyceride level QTL 46.50.0001blood triglyceride amount (VT:0002644)plasma triglyceride level (CMO:0000548)473169846132642728Rat
724522Bp146Blood pressure QTL 1462.20.0021arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)473630210118630210Rat
2302051Pia28Pristane induced arthritis QTL 285.30.001blood autoantibody amount (VT:0003725)serum immunoglobulin G-type rheumatoid factor level relative to an arbitrary reference serum (CMO:0002112)473630210118630210Rat
70167Bw22Body weight QTL 223.1body mass (VT:0001259)body weight (CMO:0000012)476647384117676292Rat
1357342Bw40Body weight QTL 400.001body mass (VT:0001259)body weight (CMO:0000012)476647384117676292Rat
631662Hcar2Hepatocarcinoma resistance QTL 23.10.0003liver integrity trait (VT:0010547)volume of individual liver tumorous lesion (CMO:0001078)478878504123878504Rat
631556Bp135Blood pressure QTL 1350.017arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)478881294117676292Rat
738015Pia9Pristane induced arthritis QTL 94.50.048joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)480694870125694870Rat
2306899Bp338Blood pressure QTL 3380.071arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)481006124120102625Rat
1641919Alc22Alcohol consumption QTL 220.0005drinking behavior trait (VT:0001422)ethanol drink intake rate (CMO:0001407)481192555126192555Rat
70177Xhs1X-ray hypersensitivity QTL 125.1intestine integrity trait (VT:0010554)post-insult time to onset of moribundity (CMO:0001896)482798864152731274Rat
1576316Ept5Estrogen-induced pituitary tumorigenesis QTL 53.8pituitary gland mass (VT:0010496)pituitary gland wet weight (CMO:0000853)483428419177635233Rat
634334Xhs3X-ray hypersensitivity QTL 310intestine integrity trait (VT:0010554)post-insult time to onset of moribundity (CMO:0001896)484728680129854654Rat
1582232Gluco25Glucose level QTL 253.60.0023blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)485253748148090731Rat
12798523Anxrr56Anxiety related response QTL 562.830.05locomotor behavior trait (VT:0001392)amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)485253748150276390Rat
1358202Gluco11Glucose level QTL 112.40.02adipocyte glucose uptake trait (VT:0004185)absolute change in adipocyte glucose uptake (CMO:0000873)485379421167139601Rat
61476Aia3Adjuvant induced arthritis QTL 33.9joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)486730991131730991Rat
1578662Bss15Bone structure and strength QTL 1519.6femur width (VT:1000666)femoral neck width (CMO:0001695)487327165132327165Rat
1578670Bss14Bone structure and strength QTL 1416.4femur morphology trait (VT:0000559)bone trabecular cross-sectional area (CMO:0002311)487327165132327165Rat
1578655Bmd11Bone mineral density QTL 1111femur mineral mass (VT:0010011)total volumetric bone mineral density (CMO:0001728)490850165135850165Rat
634335Anxrr16Anxiety related response QTL 167.22locomotor behavior trait (VT:0001392)number of entries into a discrete space in an experimental apparatus (CMO:0000960)493308457167139447Rat
631689Scl4Serum cholesterol level QTL 41.90.008blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)495174120140174120Rat
61434Cia3Collagen induced arthritis QTL 34.8joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)4103194656148194656Rat
2302049Pia32Pristane induced arthritis QTL 325.10.001blood autoantibody amount (VT:0003725)serum immunoglobulin G-type rheumatoid factor level relative to an arbitrary reference serum (CMO:0002112)4105789505150789505Rat
731165Uae21Urinary albumin excretion QTL 212.40.0001urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)4106649412151649412Rat
61406Scwia1Streptococcal cell wall induced arthritis QTL 12.3joint integrity trait (VT:0010548)experimental arthritis severity measurement (CMO:0001459)4106805662151805662Rat
7207480Bss105Bone structure and strength QTL 1058.1femur strength trait (VT:0010010)femur midshaft polar moment of inertia (CMO:0001669)4109827074154827074Rat
1549832Bss3Bone structure and strength QTL 311femur morphology trait (VT:0000559)femur midshaft cortical cross-sectional area (CMO:0001663)4109827074154827074Rat
737821Hcar9Hepatocarcinoma resistance QTL 93.7liver integrity trait (VT:0010547)volume of individual liver tumorous lesion (CMO:0001078)4109866907167139601Rat
1331759Hrtrt13Heart rate QTL 133.54628heart pumping trait (VT:2000009)heart rate (CMO:0000002)4110275411168266883Rat
6478760Anxrr45Anxiety related response QTL 450.06717locomotor behavior trait (VT:0001392)amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)4110870972155870972Rat
6478763Anxrr46Anxiety related response QTL 460.07428locomotor behavior trait (VT:0001392)amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)4110870972155870972Rat


Additional Information

Database Acc Id Source(s)
UniSTS 145042 UniSTS