UniSTS:463464 Marker Search Result - Rat Genome Database
Submit Data |  Help |  Video Tutorials |  News |  Publications |  FTP Download |  REST API |  Citing RGD |  Contact   

Marker: UniSTS:463464

Symbol: UniSTS:463464
Also known as:
RGD ID: 5036053
Expected Size: 61 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
Rnor_6.0147,509,477 - 7,509,537NCBIRnor6.0
Rnor_6.01410,709,868 - 10,709,928NCBIRnor6.0
Rnor_5.0147,487,276 - 7,487,336UniSTSRnor5.0
Rnor_5.01410,657,123 - 10,657,183UniSTSRnor5.0
RGSC_v3.41410,320,871 - 10,320,931UniSTSRGSC3.4
Celera149,178,518 - 9,178,578UniSTS
Cytogenetic Map14p22UniSTS
Is Marker For: Genes:   Plac8   LOC100910270  


Annotation


References - curated
1. RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer TTCTGTCCTGTTTGCTCTGTG
Reverse Primer TCATGGCTCTCCTCCTGTTA
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
3663Mapk10mitogen activated protein kinase 101480799558371508Rat
61969Hpseheparanase141053435810576686Rat
69318Nkx6-1NK6 homeobox 11495552649562197Rat
621185Cds1CDP-diacylglycerol synthase 11493965119456964Rat
727800Slc10a6solute carrier family 10 member 61476180227682377Rat
1306722Coq2coenzyme Q2, polyprenyltransferase141058110210601093Rat
1308102Plac8placenta associated 8141069279910714556Rat
1307997Mrps18cmitochondrial ribosomal protein S18C141044069110446909Rat
1306669Arhgap24Rho GTPase activating protein 241483832118600526Rat
1307097Wdfy3WD repeat and FYVE domain containing 31491694099384835Rat
1305287Abraxas1abraxas 1, BRCA1 A complex subunit141042467410439010Rat
1560216Helqhelicase, POLQ-like141044698110491042Rat
1565703Gpat3glycerol-3-phosphate acyltransferase 3141034328710396565Rat
1563360Ptpn13protein tyrosine phosphatase, non-receptor type 131476885517863664Rat
1560931RGD1560931similar to proliferating cell nuclear antigen1490235589041346Rat
1585864LOC680925similar to SET protein (Phosphatase 2A inhibitor I2PP2A) (I-2PP2A) (Template-activating factor I) (TAF-I) (Liver regeneration-related protein LRRGR00002)141011288810123723Rat
1564576Aff1-as1AFF1 antisense RNA 11475811897636823Rat
1560413Ndufb4l1-ps1NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 4-like 1, pseudogene 11479492177949662Rat
1597133LOC364105hypothetical LOC3641051498428669843177Rat
1597134LOC364103similar to TBC1 domain family, member 11490841569085788Rat
2322973LOC100363472nuclear receptor-binding factor 2-like141062410110625913Rat
6499131LOC100910270uncharacterized LOC1009102701475059127514158Rat
7539914LOC10255061760S ribosomal protein L7a-like141045903910460667Rat
7632243LOC102549277uncharacterized LOC1025492771488129398829148Rat
7589278LOC102550272uncharacterized LOC102550272141005330710061978Rat
7718381LOC102546454uncharacterized LOC1025464541476475977648369Rat
7702897LOC102546534uncharacterized LOC1025465341476579067659941Rat
9130199LOC103692566uncharacterized LOC1036925661489559968968768Rat
9132166LOC103692565cytochrome c oxidase protein 20 homolog pseudogene1481489968150347Rat
9216872LOC103693725ubiquitin-conjugating enzyme E2 variant 2 pseudogene141068553910686410Rat
9338365LOC103693723multiple epidermal growth factor-like domains protein 61493133009316302Rat
9474183LOC103693724uncharacterized LOC1036937241492321569246340Rat
11372248LOC10835270040S ribosomal protein S25 pseudogene1480899688092579Rat
11463885LOC108352701uncharacterized LOC1083527011485100958521902Rat
11467926LOC108352710uncharacterized LOC108352710141052052010526280Rat
11441489LOC108352708uncharacterized LOC108352708141029636010297735Rat
11416353LOC108352704uncharacterized LOC1083527041488941488900203Rat
11395525LOC108352707uncharacterized LOC1083527071495248099531320Rat
11389755LOC108352705uncharacterized LOC1083527051494572249508908Rat
11391501LOC108352702uncharacterized LOC1083527021484323188438833Rat
11392357LOC108352699uncharacterized LOC1083526991479731427998126Rat
11478148LOC108352709uncharacterized LOC108352709141030934710326974Rat
11482723LOC108352706uncharacterized LOC1083527061495319829533431Rat
11483305LOC108352703uncharacterized LOC1083527031484211318423672Rat



QTLs in Region (Rnor_6.0)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
2300159Bmd61Bone mineral density QTL 615.30.0001femur mineral mass (VT:0010011)volumetric bone mineral density (CMO:0001553)14127597761Rat
2300183Bmd60Bone mineral density QTL 605.70.0001femur mineral mass (VT:0010011)volumetric bone mineral density (CMO:0001553)14127597761Rat
619619Rf4Renal disease susceptibility QTL 44.10.002total urine protein amount (VT:0000032)urine protein excretion rate to body weight ratio (CMO:0001099)14134403399Rat
9589814Gluco67Glucose level QTL 674.540.001blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)14141333960Rat
7411573Bw139Body weight QTL 1394.70.001body mass (VT:0001259)body weight gain (CMO:0000420)14141333960Rat
634352Apr6Acute phase response QTL 63.7blood interleukin-6 amount (VT:0008595)plasma interleukin-6 level (CMO:0001927)14142766285Rat
71115Niddm15Non-insulin dependent diabetes mellitus QTL 154.8blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)14222782512680613Rat
70204Niddm20Non-insulin dependent diabetes mellitus QTL 205.10.000008blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)14222782519230541Rat
724541Niddm53Non-insulin dependent diabetes mellitus QTL 530.001blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)14483323310729268Rat
2293089Iddm31Insulin dependent diabetes mellitus QTL 314.7blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)14483323319909932Rat
2293089Iddm31Insulin dependent diabetes mellitus QTL 314.7blood glucose amount (VT:0000188)age at onset/diagnosis of type 1 diabetes mellitus (CMO:0001140)14483323319909932Rat
1300114Srn2Serum renin concentration QTL 23.27blood renin amount (VT:0003349)plasma renin activity level (CMO:0000116)14483323323004027Rat
70195Mcs8Mammary carcinoma susceptibility QTL 84.28mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)14483323326466248Rat
1331740Bw26Body weight QTL 263.028body mass (VT:0001259)body weight (CMO:0000012)14483323333040042Rat
1581500Renag1Renal agenesis QTL 1kidney development trait (VT:0000527)percentage of study population developing unilateral renal agenesis during a period of time (CMO:0000940)14975643572854397Rat
1358296Ael3Aortic elastin QTL 33.70.00051aorta elastin amount (VT:0003905)aortic elastin141053997755539977Rat
2302045Pia39Pristane induced arthritis QTL 394.90.001blood immunoglobulin amount (VT:0002460)serum immunoglobulin G2a level (CMO:0002116)141053997755539977Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 100910270 UniSTS
  360914 UniSTS
UniGene Rn.2649 UniSTS
UniSTS 463464 UniSTS