WI-18797 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: WI-18797

Symbol: WI-18797
Previously known as:
RGD ID: 5035695
Expected Size: 165 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.215990,952 - 991,117 (+)MAPPERmRatBN7.2
Rnor_6.0151,038,604 - 1,038,768NCBIRnor6.0
Rnor_5.0151,026,860 - 1,027,024UniSTSRnor5.0
RGSC_v3.415940,030 - 940,194UniSTSRGSC3.4
Celera153,566,352 - 3,566,516UniSTS
Cytogenetic Map15p16UniSTS
Is Marker For: Genes:   Kcnma1  


Annotation


References - curated
# Reference Title Reference Citation
1. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer CTCATTTCCCCAGTTGGTGT
Reverse Primer GCTCAAGGGTTTTATGGTGG
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
620715Kcnma1potassium calcium-activated channel subfamily M alpha 1153024801007675Rat

Nucleotide Sequences
GenBank Nucleotide FT177470 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  U11058 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
1354657Despr13Despair related QTL 130.0022locomotor behavior trait (VT:0001392)amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)15129912054Rat
8552920Pigfal8Plasma insulin-like growth factor 1 level QTL 83blood insulin-like growth factor amount (VT:0010479)plasma insulin-like growth factor 1 level (CMO:0001299)15134723002Rat
8694361Abfw6Abdominal fat weight QTL 610.20.001visceral adipose mass (VT:0010063)abdominal fat pad weight to body weight ratio (CMO:0000095)15134723002Rat
9589149Insul29Insulin level QTL 299.060.001blood insulin amount (VT:0001560)plasma insulin level (CMO:0000342)15134723002Rat
731170Pur3Proteinuria QTL 32.30.0005urine protein amount (VT:0005160)urine protein excretion rate (CMO:0000759)15141686771Rat
1641887Alcrsp14Alcohol response QTL 14response to alcohol trait (VT:0010489)brain neurotensin receptor 1 density (CMO:0002068)15142356671Rat
2298549Neuinf12Neuroinflammation QTL 123.5nervous system integrity trait (VT:0010566)spinal cord beta-2 microglobulin mRNA level (CMO:0002125)15155302115Rat
10401805Kidm51Kidney mass QTL 51kidney mass (VT:0002707)both kidneys wet weight (CMO:0000085)1530632945306329Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 83731 UniSTS
UniSTS 36809 UniSTS