RH44468 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Pathways

Marker: RH44468

Symbol: RH44468
Previously known as:
RGD ID: 5035102
Expected Size: 165 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.25161,512,312 - 161,512,477 (+)MAPPERmRatBN7.2
Rnor_6.05168,140,237 - 168,140,401NCBIRnor6.0
Rnor_5.05171,717,332 - 171,717,496UniSTSRnor5.0
RGSC_v3.45168,204,774 - 168,204,938UniSTSRGSC3.4
Celera5159,764,487 - 159,764,651UniSTS
Cytogenetic Map5q36UniSTS
Is Marker For: Genes:   Camta1  


Annotation


References - curated
# Reference Title Reference Citation
1. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer CCATAGCCACTAATGCTTTGC
Reverse Primer TCACAAAGGTCAATAACATGGC
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
1562703Camta1calmodulin binding transcription activator 15161510283162356902Rat

Nucleotide Sequences
RefSeq Transcripts NM_001195559 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
GenBank Nucleotide FQ214478 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (GRCr8)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
10053720Scort26Serum corticosterone level QTL 262.060.0147blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)5124965598166875058Rat
631272Lanf1Left ventricular atrial natriuretic factor QTL 112heart left ventricle natriuretic peptide A amount (VT:0010596)heart left ventricle natriuretic peptide A level (CMO:0002165)5151113452166875058Rat
1576314Eutr1Estrogen induced uterine response QTL 1uterus integrity trait (VT:0010575)pyometritis severity score (CMO:0002009)52138965166875058Rat
631562Apr2Acute phase response QTL 23.7blood murinoglobulin 1 amount (VT:0010597)plasma murinoglobulin 1 level (CMO:0001931)5135927956166875058Rat
634349Bp139Blood pressure QTL 1390.001arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)5128924607166875058Rat
61444Strs2Sensitivity to stroke QTL 24.7cerebrum integrity trait (VT:0010549)post-insult time to onset of cerebrovascular lesion (CMO:0002343)5135929696166875058Rat
724525Bp147Blood pressure QTL 1474.30.0001arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)5126424772166875058Rat
1549904Neuinf1Neuroinflammation QTL 130nervous system integrity trait (VT:0010566)blood T lymphocyte count (CMO:0000110)5154828214166875058Rat
738018Anxrr4Anxiety related response QTL 45.1exploratory behavior trait (VT:0010471)percentage of entries into a discrete space in an experimental apparatus (CMO:0000961)5130130159166875058Rat
8552908Pigfal4Plasma insulin-like growth factor 1 level QTL 46.6blood insulin-like growth factor amount (VT:0010479)plasma insulin-like growth factor 1 level (CMO:0001299)5128506074166875058Rat
7794791Mcs33Mammary carcinoma susceptibility QTL 331.93mammary gland integrity trait (VT:0010552)mammary tumor incidence/prevalence measurement (CMO:0000946)5131345754166875058Rat
1354631Swd2Spike wave discharge measurement QTL 23.640.0002brain electrophysiology trait (VT:0010557)brain total spike-and-wave discharge duration (CMO:0001740)5151113452164465185Rat
1302790Scl20Serum cholesterol level QTL 206.40.0001blood cholesterol amount (VT:0000180)plasma total cholesterol level (CMO:0000585)582394392166664054Rat
1598861Cm64Cardiac mass QTL 642.9heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)5127798274166875058Rat
631505Bp103Blood pressure QTL 1033.2arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)5132717196165560427Rat
1641920Colcs1Colorectal carcinoma susceptibility QTL 12.990.0055intestine integrity trait (VT:0010554)benign colorectal tumor surface area measurement (CMO:0001799)5121846814166846814Rat
1598819Bp292Blood pressure QTL 2924.3arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)5127798274166875058Rat
8694169Bw148Body weight QTL 14850.001body mass (VT:0001259)body weight gain (CMO:0000420)5128506074166875058Rat
1331721Bp210Blood pressure QTL 2103.413arterial blood pressure trait (VT:2000000)blood pressure time series experimental set point of the baroreceptor response (CMO:0002593)5143069996166846814Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 362665 UniSTS