RH136939 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: RH136939

Symbol: RH136939
Also known as: AA925251; 
RGD ID: 5032911
Expected Size: 181 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.2483,535,605 - 83,535,785 (+)MAPPER
mRatBN7.24165,129,895 - 165,130,076 (+)MAPPER
Rnor_6.04165,606,957 - 165,607,137NCBIRnor6.0
Rnor_6.0484,582,471 - 84,582,650NCBIRnor6.0
Rnor_5.04228,170,410 - 228,170,590UniSTSRnor5.0
Rnor_5.04149,241,374 - 149,241,553UniSTSRnor5.0
RGSC_v3.44169,076,652 - 169,076,832UniSTSRGSC3.4
RGSC_v3.4482,808,157 - 82,808,336UniSTSRGSC3.4
Celera478,404,672 - 78,404,851UniSTS
Celera4153,733,653 - 153,733,833UniSTS
Cytogenetic Map4q42UniSTS
Is Marker For: Genes:   Ybx3  


Annotation


References - curated
1. RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer TTGGAAGTTTAGCACCAGCATC
Reverse Primer CCCATTTCAGCAACCTAGTGC
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
708559Wipf3WAS/WASL interacting protein family, member 348459630584676775Rat
9219980LOC103692134uncharacterized LOC10369213448465038984656807Rat
1560999Scrn1secernin 148467897884740701Rat
7685582LOC102553885uncharacterized LOC10255388548473970284758303Rat
1311705Fkbp14FKBP prolyl isomerase 1448475362884768314Rat
1563940Plekha8pleckstrin homology domain containing A848477029484820887Rat
7537419LOC102554291mitochondrial import receptor subunit TOM7 homolog48478544884790480Rat
9180275LOC103692135uncharacterized LOC10369213548479319484793975Rat
1549700Mturnmaturin, neural progenitor differentiation regulator homolog48485434184875300Rat
6500991LOC100909941uncharacterized LOC10090994148491735984921988Rat
1306645Znrf2zinc and ring finger 248500935085090914Rat
1562269Nod1nucleotide-binding oligomerization domain containing 148512396585175206Rat
1304876Ggctgamma-glutamyl cyclotransferase48518664485192857Rat
2325113LOC10035961360S ribosomal protein L12-like48521169185215864Rat
7703180LOC102550675uncharacterized LOC10255067548521818285228217Rat
1307856Garsglycyl-tRNA synthetase48523512285276085Rat
70547Crhr2corticotropin releasing hormone receptor 248528637185329374Rat
7724284LOC102550746uncharacterized LOC10255074648535254085374090Rat
7660754LOC102550873uncharacterized LOC10255087348535255685359850Rat
1597087Inmtindolethylamine N-methyltransferase48538190785386203Rat
1562590Mindy4MINDY lysine 48 deubiquitinase 448542774185536264Rat
11481284LOC108350810proline-rich protein 36-like48552736885549162Rat
2141Aqp1aquaporin 148555150385563683Rat
9287270LOC103692136uncharacterized LOC10369213648555225785560573Rat
2688Ghrhrgrowth hormone releasing hormone receptor48558732185602389Rat
7509699LOC102551107uncharacterized LOC10255110748561204885625087Rat
7644658LOC102551794uncharacterized LOC10255179448566113385669342Rat
2038Adcyap1r1ADCYAP receptor type I48566280985711696Rat
1562793Neurod6neuronal differentiation 648591186185915107Rat
1561131Itprid1ITPR interacting domain containing 148608041286233808Rat
628647Ppp1r17protein phosphatase 1, regulatory subunit 1748627513086292435Rat
7733535LOC102551170uncharacterized LOC10255117048627726086285875Rat
68332Pde1cphosphodiesterase 1C48635976286925044Rat
7496134LOC102551243apolipoprotein O-like48637663386380981Rat
1565107RGD1565107similar to 40S ribosomal protein SA (p40) (34/67 kDa laminin receptor)48692929086930225Rat
1308655Lsm5LSM5 homolog, U6 small nuclear RNA and mRNA degradation associated48701600387019219Rat
1564615Avl9AVL9 cell migration associated48702647187070738Rat
1310317Kbtbd2kelch repeat and BTB domain containing 248708875987111576Rat
1549757Fkbp9FKBP prolyl isomerase 948716751487234198Rat
1312013Nt5c3a5'-nucleotidase, cytosolic IIIA48723832587281234Rat
9226725LOC103692137uncharacterized LOC10369213748725767687277831Rat
1585226LOC688782similar to Heterogeneous nuclear ribonucleoprotein A1 (Helix-destabilizing protein) (Single-strand binding protein) (hnRNP core protein A1) (HDP-1) (Topoisomerase-inhibitor suppressed)48729388987295170Rat
1585214Vom1r65vomeronasal 1 receptor 6548731273687313899Rat
11356528LOC108350861glyceraldehyde-3-phosphate dehydrogenase pseudogene48732965287330654Rat
1549708Vom1r67vomeronasal 1 receptor 6748735325487354165Rat
2316407Vom1r-ps69vomeronasal 1 receptor pseudogene 6948739024687391242Rat
1584130Vom1r-ps70vomeronasal 1 receptor pseudogene 7048740371587404625Rat
1549721Vom1r68vomeronasal 1 receptor 6848744099687441907Rat
1549722Vom1r69vomeronasal 1 receptor 6948745500187455909Rat
2323070Selenot-ps1selenoprotein T, pseudogene 148745906887459615Rat
1549744Vom1r66vomeronasal 1 receptor 6648751621887517162Rat
1549777Vom1r71vomeronasal 1 receptor 7148760830187609203Rat
7614437LOC102553321uncharacterized LOC10255332148768817687704752Rat
1549709Vom1r72vomeronasal 1 receptor 7248769973287700631Rat
1549715Vom1r73vomeronasal 1 receptor 7348775818187759098Rat
1582950Vom1r-ps71vomeronasal 1 receptor pseudogene 7148778618287787111Rat
6487873LOC100912229tubulin gamma-1 chain-like48778883587790160Rat
1549695Vom1r74vomeronasal 1 receptor 7448781474187815652Rat
11405111Vom1r75vomeronasal 1 receptor 7548782755287828514Rat
1549714Vom1r76vomeronasal 1 receptor 7648785274987853648Rat
1597453LOC689033hypothetical protein LOC68903348786013487867414Rat
1359218Vom1r77vomeronasal 1 receptor 7748787233087873247Rat
9351699LOC10369489440S ribosomal protein S6 pseudogene48789085787891643Rat
9290612LOC10369214440S ribosomal protein S6 pseudogene48791551487917046Rat
1549704Vom1r78vomeronasal 1 receptor 7848794315287944069Rat
1359257Vom1r79vomeronasal 1 receptor 7948798186987982729Rat
1549747Vom1r80vomeronasal 1 receptor 8048802603388026932Rat
1587250LOC500147similar to tubulin, gamma 148802798188030859Rat
1549765Vom1r81vomeronasal 1 receptor 8148804826788049199Rat
1596167Vom1r-ps72vomeronasal 1 receptor pseudogene 7248808262788083534Rat
1549746Vom1r82vomeronasal 1 receptor 8248810005288120975Rat
1560845Vom1r-ps73vomeronasal 1 receptor pseudogene 7348813694788137481Rat
1549731Vom1r83vomeronasal 1 receptor 8348818495688185894Rat
1549753Vom1r84vomeronasal 1 receptor 8448820695488208035Rat
1549732Vom1r85vomeronasal 1 receptor 8548823200988232917Rat
1549696Vom1r86vomeronasal 1 receptor 8648827106188271969Rat
1587190Vom1r-ps74vomeronasal 1 receptor pseudogene 7448830404088304934Rat
1549756Vom1r87vomeronasal 1 receptor 8748832806188328969Rat
1596849Vom1r-ps111vomeronasal 1 receptor pseudogene 11148837953488380442Rat
1549699Vom1r88vomeronasal 1 receptor 8848841717588424973Rat
1306494Vopp1VOPP1 WW domain binding protein48844106788515141Rat
1310809Lancl2LanC like 248852421288565113Rat
1565524PyurfPIGY upstream open reading frame48858424288587877Rat
1561739Herc6HECT and RLD domain containing E3 ubiquitin protein ligase family member 648860685188649424Rat
1563162LOC500148similar to 40S ribosomal protein S7 (S8)48867515288684415Rat
1308501Ppm1kprotein phosphatase, Mg2+/Mn2+ dependent, 1K48869439588721374Rat
7722197LOC10254678360S ribosomal protein L29-like48875384288754315Rat
631345Abcg2ATP binding cassette subfamily G member 248876544188890268Rat
1587249LOC500149similar to peptidylprolyl isomerase D48897578188977049Rat
1307803Herc3HECT and RLD domain containing E3 ubiquitin protein ligase 348907867089169150Rat
1584123Nap1l5nucleosome assembly protein 1-like 548914931489152511Rat
1309807Fam13afamily with sequence similarity 13, member A48918318089281282Rat
1593482LOC689382hypothetical protein LOC68938248939189389415580Rat
1559612Tigd2tigger transposable element derived 248953541889538535Rat
7709956LOC102549524uncharacterized LOC10254952448954291389560993Rat
2322105LOC100360451hypothetical LOC10036045148967292589677366Rat
7505827LOC102550113sentrin-specific protease 6-like48967300489675631Rat
1565690Gprin3GPRIN family member 348969067889778302Rat
11398622LOC108350811igE-binding protein-like48987273089876205Rat
11451272LOC108350862uncharacterized LOC10835086248988192089900021Rat
11424945LOC108350863uncharacterized LOC10835086348992558389927014Rat
9075196LOC103692145uncharacterized LOC10369214549065339190660044Rat
3729Sncasynuclein alpha49078241290883236Rat
1591097LOC689530similar to Alpha-enolase (2-phospho-D-glycerate hydro-lyase) (Non-neural enolase) (NNE) (Enolase 1)49095939790960693Rat
1587248Mmrn1multimerin 149097753791038747Rat
2321912LOC100360545protein phosphatase 6, catalytic subunit49105881991086295Rat
11519725LOC108350812uncharacterized LOC10835081249122913591244135Rat
1565731Ccser1coiled-coil serine-rich protein 149123588592516800Rat
9336400LOC103692146uncharacterized LOC10369214649160176691671297Rat
11450417LOC108350840uncharacterized LOC10835084049195969092027301Rat
11440908LOC108350839high mobility group protein B1-like49243151792432354Rat
9438714LOC103692148developmental pluripotency-associated protein 2 pseudogene49244329392444985Rat
9451639LOC103692149axoneme-associated protein mst101(2)-like49250166392502256Rat
9156672LOC103692147glutamate receptor ionotropic, delta-2-like49301279193035216Rat
620960Hint1-ps1histidine triad nucleotide binding protein 1, pseudogene 149340566593406239Rat
9264819Tshr-ps1thyroid stimulating hormone receptor, pseudogene 149344741293448194Rat
68368Grid2glutamate ionotropic receptor delta type subunit 249406811295476864Rat
1565171Atoh1atonal bHLH transcription factor 149549800395500098Rat
1588783LOC689705hypothetical protein LOC68970549564751395647912Rat
1587189LOC502786similar to non-POU domain containing, octamer-binding49573772695739122Rat
1309640Smarcad1SWI/SNF-related, matrix-associated actin-dependent regulator of chromatin, subfamily a, containing DEAD/H box 1`49588402095945248Rat
69251Hpgdshematopoietic prostaglandin D synthase49594535695970666Rat
9386529LOC10369215114-3-3 protein theta pseudogene49606030296062112Rat
1560028RGD1560028similar to RIKEN cDNA C130060K24 gene49625263496331555Rat
1588732Tnip3TNFAIP3 interacting protein 349638620796490517Rat
9190320LOC103692152uncharacterized LOC10369215249641918996435994Rat
1311080Ndnfneuron-derived neurotrophic factor49652883096565780Rat
1588700Prdm5PR/SET domain 549665906296810816Rat
735071RSA-14-44RSA-14-44 protein49683188096833252Rat
6491577LOC100911638protein lin-28 homolog A-like49699600196996589Rat
1587188LOC502787similar to eukaryotic translation initiation factor 4, gamma 1 isoform a49716979697172124Rat
1587548LOC689832similar to 60S ribosomal protein L7a49721228097212603Rat
1564699RGD1564699similar to High mobility group protein 1 (HMG-1)49731964797320210Rat
1307592Lin28clin-28 homolog C (C. elegans)49737372397376654Rat
1310889Mad2l1mitotic arrest deficient 2 like 149753099397543179Rat
1359215Vom1r89vomeronasal 1 receptor 8949756692797567844Rat
621516Gng12G protein subunit gamma 1249763492597763478Rat
9428718LOC103692153uncharacterized LOC10369215349766730797682102Rat
2654Gadd45agrowth arrest and DNA-damage-inducible, alpha49778251297784814Rat
6488311LOC100912188uncharacterized LOC10091218849778426397833267Rat
619907Serbp1Serpine1 mRNA binding protein 149802756398044717Rat
620026Il12rb2interleukin 12 receptor subunit beta 249804919598141562Rat
1586368Il23rinterleukin 23 receptor49820378898306729Rat
1359498Tacstd2tumor-associated calcium signal transducer 249834118798342887Rat
7706369LOC102549228histone deacetylase 2-like49846181898463508Rat
11493642LOC108350715uncharacterized LOC10835071549851412798518772Rat
9399880LOC103692154uncharacterized LOC10369215449852484198556660Rat
1311377Rpiaribose 5-phosphate isomerase A49856802898593664Rat
7583063LOC102549525uncharacterized LOC10254952549864582898648396Rat
70884Eif2ak3eukaryotic translation initiation factor 2 alpha kinase 349864851398709695Rat
1560163RGD1560163similar to SPCS2 protein49871142198713892Rat
1562720Tex37testis expressed 3749872810998735346Rat
1561816Foxi3forkhead box I349877590898780082Rat
1309144Thnsl2threonine synthase-like 249897655998997187Rat
2590Fabp1fatty acid binding protein 149906318199066957Rat
1305105Smyd1SET and MYND domain containing 149907112299125143Rat
7727476LOC102549052low molecular weight phosphotyrosine protein phosphatase-like49911976399121314Rat
1306495Krcc1lysine-rich coiled-coil 149913373599148236Rat
7647571LOC102552663uncharacterized LOC10255266349916139899169504Rat
11434940LOC108350716uncharacterized LOC10835071649916942399186027Rat
2317Cd8bCD8b molecule49918596099201887Rat
1587245LOC500198similar to Tubulin alpha-3 chain (Alpha-tubulin 3)49920286799215408Rat
11365136LOC108350717uncharacterized LOC10835071749921543199217458Rat
2316Cd8aCD8a molecule49921764099243352Rat
1309766Rmnd5arequired for meiotic nuclear division 5 homolog A49924915999305805Rat
6500636LOC100909974uncharacterized LOC10090997449930604399399123Rat
620586Rnf103ring finger protein 10349939847999415193Rat
708556Chmp3charged multivesicular body protein 349944921399496156Rat
708351Kdm3alysine demethylase 3A49950316099547315Rat
1305230Reep1receptor accessory protein 149961862299735329Rat
1307065Mrpl35mitochondrial ribosomal protein L3549973879299749665Rat
1310684Immtinner membrane mitochondrial protein49975344699789921Rat
1565582Ptcd3Pentatricopeptide repeat domain 349979564699822960Rat
620824Polr1aRNA polymerase I subunit A49982296499903969Rat
7727762LOC102552926uncharacterized LOC10255292649990120299907617Rat
2319759LOC100361613hypothetical LOC10036161349991669099919416Rat
7553872LOC102556495uncharacterized LOC10255649549993475399937421Rat
620875St3gal5ST3 beta-galactoside alpha-2,3-sialyltransferase 549993749999999905Rat
7524413LOC102546367uncharacterized LOC10254636749997288199976525Rat
1561512Atoh8atonal bHLH transcription factor 84100067341100099517Rat
7543255LOC102549599S-formylglutathione hydrolase-like4100158527100159602Rat
621700Sftpbsurfactant protein B4100166855100175941Rat
1308103Usp39ubiquitin specific peptidase 394100181408100211425Rat
1587471LOC691113hypothetical protein LOC6911134100208612100215824Rat
619998Tmem150atransmembrane protein 150A4100217986100222131Rat
1359698Rnf181ring finger protein 1814100222087100228809Rat
620419Vamp5vesicle-associated membrane protein 54100231561100232560Rat
620421Vamp8vesicle-associated membrane protein 84100250301100252756Rat
68383Ggcxgamma-glutamyl carboxylase4100277345100293097Rat
619985Mat2amethionine adenosyltransferase 2A4100297478100303047Rat
11355186LOC108350864ATP synthase subunit g, mitochondrial pseudogene4100362619100363230Rat
1587427Sh2d6SH2 domain containing 64100373808100382209Rat
1311724Capgcapping actin protein, gelsolin like4100395693100419447Rat
1306408Elmod3ELMO domain containing 34100422256100465152Rat
7588245LOC102549229endochitinase 2-like4100449487100451644Rat
628802Retsatretinol saturase4100465365100474128Rat
620445Tgoln2trans-golgi network protein 24100475415100483229Rat
7699711LOC102549526uncharacterized LOC1025495264100484485100498975Rat
1311671Tcf7l1transcription factor 7 like 14100492796100660401Rat
7562795LOC102549458uncharacterized LOC1025494584100577408100581521Rat
7716905LOC102549702uncharacterized LOC1025497024100716730100720289Rat
1591490Kcmf1potassium channel modulatory factor 14100759526100783017Rat
2323800LOC100359493thymosin, beta 10-like4100835563100835753Rat
62022Tmsb10thymosin, beta 104100882216100883303Rat
621797Dnah6dynein, axonemal, heavy chain 64100936834101157511Rat
7639290LOC102550335prohibitin-like4100955585100956580Rat
9173236LOC103692155uncharacterized LOC1036921554101162335101167473Rat
619821Suclg1succinate-CoA ligase GDP/ADP-forming subunit alpha4101181315101210692Rat
9083581LOC103692156uncharacterized LOC1036921564101292794101319043Rat
1334150Olr822-psolfactory receptor pseudogene 8224101350108101350974Rat
1562515RGD1562515similar to RIKEN cDNA 4931417E114101392229101393329Rat
11364654LOC108350814Ig kappa chain V-V region L6-like4101591203101591689Rat
9102747LOC103692159Ig kappa chain V-V region L6-like4101989144101989630Rat
9113781LOC103690612uncharacterized LOC1036906124102059148102069379Rat
9439280LOC103692161uncharacterized LOC1036921614102135596102136094Rat
9330732LOC103690609NADH dehydrogenase [ubiquinone] 1 beta subcomplex subunit 3 pseudogene4102426173102426639Rat
11052016LOC102551948Ig kappa chain V-II region RPMI 6410-like4102536200102537176Rat
1561722RGD1561722similar to immunoglobulin light chain4102643914102644773Rat
11051993LOC102557466Ig kappa chain V-II region 26-10-like4102970365102974615Rat
11052029LOC102552751mucin-2-like4103015617103024899Rat
1586033LOC500205similar to polypyrimidine tract binding protein 1 isoform b4104020045104021841Rat
9215783LOC103692162uncharacterized LOC1036921624104053246104086200Rat
11472949LOC108350866uncharacterized LOC1083508664104301152104303423Rat
1586032LOC500206similar to src homology 2 domain-containing transforming protein C14104310988104312286Rat
9348276LOC103692163uncharacterized LOC1036921634105037379105048228Rat
6576138Trnas-gcutransfer RNA serine (anticodon GCU)4105177093105177174Rat
11468430Trnas-gcu6transfer RNA serine (anticodon GCU) 64105177093105177174Rat
1586002LOC502848similar to cactin CG1676-PA4105218227105219987Rat
2320685LOC100361176solute carrier family 25, member 394105707513105708605Rat
1585901LOC679688hypothetical protein LOC6796884105924927105939707Rat
7640293LOC102554402high mobility group protein B1-like4106076155106076798Rat
11051999LOC684133Ig kappa chain V-V region HP 123E6-like4106352500106362103Rat
2316392Vom1r-ps76vomeronasal 1 receptor pseudogene 764106871463106872247Rat
2320349LOC100361316hypothetical LOC1003613164106982479106983306Rat
11474954LOC108350867igE-binding protein-like4107133757107138178Rat
11402703LOC10835081760S ribosomal protein L27a-like4107330018107340567Rat
1584754LOC679788similar to ribosomal protein L64107442942107446479Rat
1305060Ctnna2catenin alpha 24107880611109042724Rat
1585921LRRTM1leucine rich repeat transmembrane neuronal 14108300927108316373Rat
11518322LOC108350841uncharacterized LOC1083508414108471612108495151Rat
1583643LOC679846hypothetical protein LOC6798464109050643109142960Rat
11385872LOC108350868glyceraldehyde-3-phosphate dehydrogenase pseudogene4109222968109223956Rat
3254Reg3bregenerating family member 3 beta4109467272109470510Rat
2319874LOC100361595hypothetical LOC1003615954109473140109475570Rat
621401Reg3aregenerating islet-derived 3 alpha4109477893109480659Rat
3552Reg1aregenerating family member 1 alpha4109497962109500626Rat
7688358LOC102556035uncharacterized LOC1025560354109521653109546592Rat
3256Reg3gregenerating family member 3 gamma4109529679109532234Rat
7552576LOC102546411syntaxin-binding protein 3-like4109654109109658999Rat
7708743LOC102556090uncharacterized LOC1025560904109675683109681109Rat
1560707Lrrtm4leucine rich repeat transmembrane neuronal 44110699577111497643Rat
11394131LOC108350843uncharacterized LOC1083508434111213643111243451Rat
11492979LOC108350842uncharacterized LOC1083508424111258784111413055Rat
7538165LOC102549600uncharacterized LOC1025496004111434832111444699Rat
1586028LOC500220similar to L-lactate dehydrogenase A chain (LDH-A) (LDH muscle subunit) (LDH-M)4111506069111508337Rat
1595483LOC680141hypothetical protein LOC6801414111566218111566807Rat
1586001LOC502850similar to mannose-6-phosphate receptor binding protein 14111929956111931270Rat
1594207LOC680224similar to Aspartate aminotransferase, mitochondrial precursor (Transaminase A) (Glutamate oxaloacetate transaminase 2)4112357036112357666Rat
6493044LOC100911370uncharacterized LOC1009113704112641827112645315Rat
1304792Gcfc2GC-rich sequence DNA-binding factor 24112662556112700505Rat
1587381Mrpl19mitochondrial ribosomal protein L194112703041112707270Rat
1559797Eva1aeva-1 homolog A, regulator of programmed cell death4112714023112823659Rat
7719052LOC102547556uncharacterized LOC1025475564112739237112759385Rat
7520921LOC102547617peroxiredoxin-6-like4112864026112884722Rat
6491861Rps27a-ps17ribosomal protein S27a, pseudogene 174113222490113223031Rat
3811Tacr1tachykinin receptor 14113247236113416139Rat
1307793Pole4DNA polymerase epsilon 4, accessory subunit4113491644113497455Rat
7711844LOC102547728uncharacterized LOC1025477284113497559113502453Rat
2797Hk2hexokinase 24113559396113609897Rat
1592965Rps27a-ps18ribosomal protein S27a, pseudogene 184113679590113680131Rat
3658Sema4fssemaphorin 4F4113738225113764532Rat
1563842M1apmeiosis 1 associated protein4113772716113864171Rat
1596846LOC680041similar to 40S ribosomal protein S254113800635113801094Rat
7638586LOC10254916260S ribosomal protein L9-like4113808078113808639Rat
1309499Dok1docking protein 14113864211113866695Rat
1311011Loxl3lysyl oxidase-like 34113866782113883713Rat
1308906Htra2HtrA serine peptidase 24113883671113886833Rat
1591777Aup1AUP1, lipid droplet regulating VLDL assembly factor4113887030113890103Rat
1591766Dqx1DEAQ box RNA-dependent ATPase 14113890201113899355Rat
1549782Pcgf1polycomb group ring finger 14113911129113913718Rat
1561172Lbx2ladybird homeobox 24113918680113920565Rat
1561779Ccdc142coiled-coil domain containing 1424113933466113941297Rat
1306709Mrpl53mitochondrial ribosomal protein L534113942037113942927Rat
2322824LOC100363523hypothetical LOC1003635234113943994113945047Rat
69240Mogsmannosyl-oligosaccharide glucosidase4113948328113951731Rat
1304961Wbp1WW domain binding protein 14113951873113954272Rat
1562258Ino80bINO80 complex subunit B4113954612113957774Rat
11518313LOC108350719uncharacterized LOC1083507194113966643113969597Rat
7631689LOC10255319460S ribosomal protein L7a-like4114042424114043224Rat
1595506Tlx2T-cell leukemia homeobox 24114766401114768243Rat
9080732LOC10369218360S ribosomal protein L23 pseudogene4114809722114810775Rat
727874Rtknrhotekin4114833453114850705Rat
1561494Wdr54WD repeat domain 544114847722114871989Rat
1566019LOC500227hypothetical gene supported by BC0794244114854449114860678Rat
62038Dctn1dynactin subunit 14114876770114896567Rat
7718040LOC102548304uncharacterized LOC1025483044114881322114885927Rat
1303009Slc4a5solute carrier family 4 member 54114918488115002290Rat
9126671LOC103692174uncharacterized LOC1036921744114979130114987846Rat
1311313Mthfd2methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2, methenyltetrahydrofolate cyclohydrolase4115004433115015965Rat
1307014Mob1aMOB kinase activator 1A4115024927115041904Rat
1305975Bola3bolA family member 34115046693115056140Rat
1590584Tet3tet methylcytosine dioxygenase 34115060702115160800Rat
7650908LOC102548361uncharacterized LOC1025483614115143413115154202Rat
1304799Dguokdeoxyguanosine kinase4115180433115208061Rat
2027Actg2actin gamma 2, smooth muscle4115215160115239746Rat
619963StambpStam binding protein4115249343115277340Rat
621062Clec4fC-type lectin domain family 4, member F4115322300115332021Rat
1565913Cd207CD207 molecule4115333124115355034Rat
9389444LOC103692184glyceraldehyde-3-phosphate dehydrogenase pseudogene4115355207115388533Rat
11402107LOC108350818uncharacterized LOC1083508184115379134115386903Rat
621133Vax2ventral anterior homeobox 24115388839115412515Rat
11488278LOC108350721uncharacterized LOC1083507214115404314115408911Rat
1310619Atp6v1b1ATPase H+ transporting V1 subunit B14115417100115435754Rat
1561200Ankrd53ankyrin repeat domain 534115439325115447995Rat
1305851Tex261testis expressed 2614115446830115454035Rat
11437638LOC10835072260S ribosomal protein L27 pseudogene4115462918115473665Rat
7729408LOC10255425660S ribosomal protein L27-like4115471341115472967Rat
1305057NagkN-acetylglucosamine kinase4115473848115485027Rat
1307930Paip2bpoly(A) binding protein interacting protein 2B4115484676115516307Rat
1309746Zfp638zinc finger protein 6384115555185115690272Rat
1586000LOC502853similar to 40S ribosomal protein S15 (RIG protein)4115572975115573488Rat
1311023Dysfdysferlin4115700942115901873Rat
9122976LOC103692175uncharacterized LOC1036921754115953874115976638Rat
11421296LOC10835086960S ribosomal protein L31 pseudogene4116132266116132772Rat
631379Cyp26b1cytochrome P450, family 26, subfamily b, polypeptide 14116261796116278615Rat
1560638Exoc6bexocyst complex component 6B4116314695116786466Rat
1585860LOC680929similar to serine/threonine kinase4116805256116806586Rat
7581904LOC102554508uncharacterized LOC1025545084116831236116839280Rat
7688339LOC102554699uncharacterized LOC1025546994116857807116872666Rat
11435431LOC108350724sperm motility kinase X-like4116862310116882056Rat
11472036LOC108350723UPF0587 protein C1orf123 homolog pseudogene4116869145116876378Rat
7524941LOC102554796uncharacterized LOC1025547964116883169116904635Rat
3753Sprsepiapterin reductase4116912343116916073Rat
1560795RGD1560795similar to Sepiapterin reductase (SPR)4116933277116936466Rat
1564002Emx1empty spiracles homeobox 14116967646116984136Rat
628706Sfxn5sideroflexin 54116995238117111548Rat
1592069Rab11fip5RAB11 family interacting protein 54117113067117154495Rat
1584703LOC681041similar to Argininosuccinate synthase (Citrulline--aspartate ligase)4117158492117172731Rat
1562910Notonotochord homeobox4117206355117210856Rat
1309153Smyd5SMYD family member 54117215064117229873Rat
1583112Pradc1protease-associated domain containing 14117230523117235496Rat
1306422Cct7chaperonin containing TCP1 subunit 74117235023117252265Rat
1566130Fbxo41F-box protein 414117255143117285228Rat
2546Egr4early growth response 44117293620117296082Rat
1311590Alms1ALMS1, centrosome and basal body associated protein4117371544117472310Rat
9142253LOC103692181nuclease-sensitive element-binding protein 1 pseudogene4117379561117380587Rat
9128058LOC103692176uncharacterized LOC1036921764117417914117422642Rat
621607Nat8f3N-acetyltransferase 8 (GCN5-related) family member 34117488089117492315Rat
621610Nat8f5N-acetyltransferase 8 (GCN5-related) family member 54117506731117531480Rat
1586026LOC500236similar to elastin microfibril interfacer 14117508795117512811Rat
621609Nat8N-acetyltransferase 84117525963117527443Rat
2324329LOC100362629camello-like 44117550582117552858Rat
621606Nat8f1N-acetyltransferase 8 (GCN5-related) family member 14117582779117589464Rat
1309786TprkbTp53rk binding protein4117589527117604481Rat
621605Nat8bN-acetyltransferase 8B4117606022117607366Rat
1307038Dusp11dual specificity phosphatase 114117617640117631674Rat
7547913LOC102549328uncharacterized LOC1025493284117649961117663174Rat
1564754Figlafolliculogenesis specific bHLH transcription factor4117679256117683618Rat
2042Add2adducin 24117691294117887556Rat
7712970LOC102549703uncharacterized LOC1025497034117733588117745562Rat
1561619Nat8f2N-acetyltransferase 8 (GCN5-related) family member 24117749538117752107Rat
7636572Nat8f4N-acetyltransferase 8 (GCN5-related) family member 44117755646117760096Rat
3849Tgfatransforming growth factor alpha4117961877118045923Rat
11502286LOC108350725uncharacterized LOC1083507254118125178118130525Rat
6486422LOC100912595katanin p80 WD40-containing subunit B1-like4118134312118135193Rat
1596714LOC681376similar to katanin p80 (WD40-containing) subunit B 14118146585118147466Rat
1304825Fam136afamily with sequence similarity 136, member A4118160147118166062Rat
1584713Snrpgsmall nuclear ribonucleoprotein polypeptide G4118167267118174846Rat
628652Pcyox1prenylcysteine oxidase 14118187133118198029Rat
11508600Trnag-ccc4transfer RNA glycine (anticodon CCC) 44118207496118207566Rat
1305742Tia1TIA1 cytotoxic granule-associated RNA binding protein4118207845118238246Rat
1306746RGD1306746similar to Hypothetical protein MGC255294118240681118271771Rat
7589793LOC102554318uncharacterized LOC1025543184118314971118320831Rat
1561319Pcbp1poly(rC) binding protein 14118327185118329223Rat
7500259LOC102554481uncharacterized LOC1025544814118330044118340122Rat
1584384LOC684976hypothetical protein LOC6849764118341934118342930Rat
7667063LOC102554372uncharacterized LOC1025543724118373031118385223Rat
1560859Asprv1aspartic peptidase, retroviral-like 14118431755118433286Rat
1564525Mxd1max dimerization protein 14118451752118472150Rat
1310925Snrnp27small nuclear ribonucleoprotein U4/U6.U5 subunit 274118478075118487633Rat
1359265Gmcl1germ cell-less 1, spermatogenesis associated4118494997118534301Rat
621171Anxa4annexin A44118538775118595591Rat
9276610LOC103692178uncharacterized LOC1036921784118599778118632286Rat
1305520Aak1AP2 associated kinase 14118653851118806796Rat
2322888LOC100360057ribosomal protein L22-like4118705191118705687Rat
1307823Nfu1NFU1 iron-sulfur cluster scaffold4118814284118834955Rat
1549703Gfpt1glutamine fructose-6-phosphate transaminase 14118852046118901583Rat
7640703LOC102554877uncharacterized LOC1025548774118885395118889434Rat
1307144Antxr1ANTXR cell adhesion molecule 14118946267119131202Rat
11504247LOC108350726uncharacterized LOC1083507264118988428118991398Rat
1311934Gkn2gastrokine 24119131255119177329Rat
735014Gkn1gastrokine 14119143070119148358Rat
1597754Gkn3gastrokine 34119181970119188356Rat
7692651LOC102554941uncharacterized LOC1025549414119188353119194465Rat
1562986Bmp10bone morphogenetic protein 104119224906119230534Rat
1562105Arhgap25Rho GTPase activating protein 254119249682119327822Rat
708443Prokr1prokineticin receptor 14119375790119386551Rat
708395Vom1r101vomeronasal 1 receptor 1014119398004119400770Rat
708384Vom1r102vomeronasal 1 receptor 1024119465253119466286Rat
1565557Aplfaprataxin and PNKP like factor4119514822119568764Rat
2323785Cfap92cilia and flagella associated protein 924119572669119626852Rat
6497663LOC100910604uncharacterized LOC1009106044119632943119633551Rat
1596494Efcc1EF-hand and coiled-coil domain containing 14119633214119663081Rat
1561601Gp9glycoprotein IX (platelet)4119680671119682006Rat
1565300Rab43RAB43, member RAS oncogene family4119695012119714490Rat
1307688Isy1ISY1 splicing factor homolog4119721659119742349Rat
621807CnbpCCHC-type zinc finger, nucleic acid binding protein4119747890119756787Rat
2323735LOC100362958hypothetical LOC1003629584119764433119765427Rat
9124640LOC10369217960S ribosomal protein L34 pseudogene4119810755119811105Rat
1565292Copg1COPI coat complex subunit gamma 14119815041119840997Rat
1559800Hmces5-hydroxymethylcytosine binding, ES cell specific4119841088119864115Rat
11508794LOC108350727uncharacterized LOC1083507274119865784119877033Rat
1565596H1f10H1.10 linker histone4119889016119892661Rat
7650153LOC102552138uncharacterized LOC1025521384119895653119910825Rat
61908Rab7aRAB7A, member RAS oncogene family4119910461119963065Rat
3594Rpn1ribophorin I4119997232120018687Rat
1583218LOC685085similar to 40S ribosomal protein S254120040765120041256Rat
9252280LOC103692180uncharacterized LOC1036921804120054538120060839Rat
7562079LOC102554068uncharacterized LOC1025540684120064813120074394Rat
2664Gata2GATA binding protein 24120129028120142490Rat
1561981Dnajb8DnaJ heat shock protein family (Hsp40) member B84120156640120159708Rat
11455017LOC108350728uncharacterized LOC1083507284120163047120164389Rat
1562716Tcp1-ps1t-complex protein 1, pseudogene 14120180605120182231Rat
1560552Eefseceukaryotic elongation factor, selenocysteine-tRNA-specific4120194335120390203Rat
1592633LOC685514similar to ribosomal protein L364120403170120403551Rat
68373Ruvbl1RuvB-like AAA ATPase 14120411917120447458Rat
6493053LOC10091137140S ribosomal protein S25-like4120413647120414138Rat
68321Sec61a1SEC61 translocon subunit alpha 14120453577120467932Rat
1585999Kbtbd12kelch repeat and BTB domain containing 124120492541120567755Rat
71039Mgllmonoglyceride lipase4120671436120773458Rat
7609272LOC102554878uncharacterized LOC1025548784120750833120752329Rat
1359363Abtb1ankyrin repeat and BTB domain containing 14120778580120784807Rat
1305815Podxl2podocalyxin-like 24120785494120817335Rat
1305577Mcm2minichromosome maintenance complex component 24120825699120840221Rat
620858Tpra1transmembrane protein adipocyte associated 14120843374120854534Rat
7696532LOC102554942uncharacterized LOC1025549424120881995120934151Rat
7591615LOC102555035uncharacterized LOC1025550354120944213120958941Rat
7550029LOC102555094uncharacterized LOC1025550944120993623120996241Rat
1591392Prr20eproline rich 20E4121040810121053910Rat
1560871Plxna1plexin A14121217658121262697Rat
1304561Chchd6coiled-coil-helix-coiled-coil-helix domain containing 64121340952121565222Rat
11431714LOC108350729glyceraldehyde-3-phosphate dehydrogenase pseudogene4121439306121440757Rat
1308363Txnrd3thioredoxin reductase 34121612332121650543Rat
9087191LOC103692185uncharacterized LOC1036921854121630814121632736Rat
1585998LOC502860hypothetical LOC5028604121658524121659443Rat
708509Vom1r90vomeronasal 1 receptor 904121675261121684264Rat
2323419LOC100363221hypothetical LOC1003632214121677926121679555Rat
7512196LOC102547820uncharacterized LOC1025478204121701430121706862Rat
1590235LOC685733similar to vomeronasal V1r-type receptor V1rb64121703480121704364Rat
1564573Vom1r92vomeronasal 1 receptor 924121758942121761699Rat
1549740Vom1r93vomeronasal 1 receptor 934121771681121779354Rat
1359098Vom1r94vomeronasal 1 receptor 944121810559121811539Rat
1359401Vom1r95vomeronasal 1 receptor 954121821837121822781Rat
2316391Vom1r-ps77vomeronasal 1 receptor pseudogene 774121848074121848968Rat
1549781Vom1r96vomeronasal 1 receptor 964121870699121871658Rat
708391Vom1r97vomeronasal 1 receptor 974121898248121900419Rat
2316390Vom1r-ps78vomeronasal 1 receptor pseudogene 784121906592121907419Rat
1549694Vom1r98vomeronasal 1 receptor 984121912352121913296Rat
2316389Vom1r-ps79vomeronasal 1 receptor pseudogene 794121931315121932132Rat
2316388Vom1r-ps80vomeronasal 1 receptor pseudogene 804121932963121933127Rat
1589006Vom1r99vomeronasal 1 receptor 994121968622121969446Rat
1549727Vom1r100vomeronasal 1 receptor 1004122005560122009301Rat
2316387Vom1r-ps81vomeronasal 1 receptor pseudogene 814122045600122046503Rat
2316386Vom1r-ps82vomeronasal 1 receptor pseudogene 824122055101122056097Rat
2316385Vom1r-ps83vomeronasal 1 receptor pseudogene 834122067831122068733Rat
2316384Vom1r-ps84vomeronasal 1 receptor pseudogene 844122072934122073845Rat
2316383Vom1r-ps85vomeronasal 1 receptor pseudogene 854122085455122086053Rat
2316408Vom1r103vomeronasal 1 receptor 1034122124451122131712Rat
708382Vom1r105vomeronasal 1 receptor 1054122124451122131893Rat
1587829Vom1r104vomeronasal 1 receptor 1044122169765122170730Rat
2316382Vom1r-ps86vomeronasal 1 receptor pseudogene 864122185642122186571Rat
1587811LOC685964hypothetical protein LOC6859644122217505122221999Rat
1562825Chst13carbohydrate sulfotransferase 134122223846122244848Rat
1587777Uroc1urocanate hydratase 14122244744122276357Rat
1561296ZxdcZXD family zinc finger C4122282119122314251Rat
1305768Cfap100cilia and flagella associated protein 1004122314462122338862Rat
70918Klf15Kruppel-like factor 154122364688122377690Rat
69339Nup210nucleoporin 2104122643952122741322Rat
9129755LOC103692186uncharacterized LOC1036921864122717433122718470Rat
1311706Hdac11histone deacetylase 114122781095122798355Rat
628685Fbln2fibulin 24122835237122895127Rat
69079Wnt7aWnt family member 7A4122994425123040609Rat
2316381Vom1r-ps87vomeronasal 1 receptor pseudogene 874123062299123062925Rat
1310746Chchd4coiled-coil-helix-coiled-coil-helix domain containing 44123108924123118186Rat
1549711Tmem43transmembrane protein 434123118468123133610Rat
1305760XpcXPC complex subunit, DNA damage recognition and repair factor4123134457123161985Rat
1305971Lsm3LSM3 homolog, U6 small nuclear RNA and mRNA degradation associated4123162086123168330Rat
11469674LOC108350730uncharacterized LOC1083507304123272132123294291Rat
9140318LOC103690748uncharacterized LOC1036907484123285245123286792Rat
1596313Iqsec1IQ motif and Sec7 domain ArfGEF 14123400717123454656Rat
1589573Slc41a3solute carrier family 41, member 34123467552123513447Rat
621294Aldh1l1aldehyde dehydrogenase 1 family, member L14123516553123564067Rat
11453727LOC108350870glyceraldehyde-3-phosphate dehydrogenase pseudogene4123573149123574032Rat
621668Grip2glutamate receptor interacting protein 24123585184123636040Rat
61912Slc6a6solute carrier family 6 member 64123638619123713469Rat
7539827LOC102548902uncharacterized LOC1025489024123703946123738341Rat
1305225Ccdc174coiled-coil domain containing 1744123760708123787529Rat
11410861LOC10835080140S ribosomal protein S11-like4123764849123765341Rat
1560289RGD1560289similar to chromosome 3 open reading frame 204123790516123839149Rat
7553480LOC102554857uncharacterized LOC1025548574123858182123864108Rat
1305589Fgd5FYVE, RhoGEF and PH domain containing 54123865557123962904Rat
3201Nr2c2nuclear receptor subfamily 2, group C, member 24124005287124030349Rat
1308770Mrps25mitochondrial ribosomal protein S254124036654124048417Rat
1305397Rbsnrabenosyn, RAB effector4124050559124080919Rat
9301889LOC103692187uncharacterized LOC1036921874124080874124090409Rat
3903Trhthyrotropin releasing hormone4124110716124113242Rat
1306723Prickle2prickle planar cell polarity protein 24124238167124584176Rat
9377556LOC103692188uncharacterized LOC1036921884124537165124539501Rat
1306889Adamts9ADAM metallopeptidase with thrombospondin type 1 motif, 94124660254124860997Rat
7661237LOC102554570uncharacterized LOC1025545704124700015124752686Rat
7590189LOC102555978uncharacterized LOC1025559784125044157125133795Rat
7514013LOC102556061uncharacterized LOC1025560614125191567125247001Rat
9070006LOC103692189uncharacterized LOC1036921894125604132125608677Rat
9285430LOC103692190uncharacterized LOC1036921904125644800125657336Rat
1586441LOC688659similar to acidic ribosomal phosphoprotein P04125658901125660013Rat
1586025Magi1membrane associated guanylate kinase, WW and PDZ domain containing 14125684816126300013Rat
7537443LOC102556496uncharacterized LOC1025564964125688257125697591Rat
7545388LOC102556397gamma-aminobutyric acid receptor-associated protein-like4126015048126016219Rat
2319160LOC100361920dynein light chain 1-like4126070800126074935Rat
9075742LOC103692191uncharacterized LOC1036921914126220395126226449Rat
1585997LOC502863similar to transcription elongation factor B (SIII), polypeptide 24126305326126305689Rat
2320195LOC100364870hypothetical LOC1003648704126369560126410240Rat
2323903LOC100362876hypothetical LOC1003628764126515242126520847Rat
7707413LOC10254641260S ribosomal protein L23a-like4126520330126520871Rat
1308811Slc25a26solute carrier family 25 member 264126522335126615402Rat
1306788Lrig1leucine-rich repeats and immunoglobulin-like domains 14126615998126717434Rat
9101484LOC103692192uncharacterized LOC1036921924126632734126635384Rat
11484082LOC108350731uncharacterized LOC1083507314126806910126876502Rat
11504573LOC108350732uncharacterized LOC1083507324126884411126899044Rat
11357165LOC108350733uncharacterized LOC1083507334126901623126927870Rat
2318954LOC100362026cytochrome c oxidase, subunit VIc-like4126905378126905672Rat
11398915Trnal-aag2transfer RNA leucine (anticodon AAG) 24126941939126942020Rat
11432238LOC108350734uncharacterized LOC1083507344126953162126981104Rat
1585996LOC502864similar to proteasome beta 3 subunit4127025024127028562Rat
1563166Kbtbd8kelch repeat and BTB domain containing 84127164728127177537Rat
1586024LOC500263similar to heterogeneous nuclear ribonucleoprotein A34127193389127194243Rat
1583000LOC688907similar to Elongation factor 1-gamma (EF-1-gamma) (eEF-1B gamma)4127328444127334012Rat
1305008Suclg2succinate-CoA ligase GDP-forming subunit beta4127552100127824970Rat
9414372LOC103692194uncharacterized LOC1036921944127561439127562904Rat
9215796LOC103692193uncharacterized LOC1036921934127796666127800972Rat
1564292RGD1564292similar to Nucleolar protein 14127966113127968435Rat
7508836LOC102549269uncharacterized LOC1025492694128152877128221659Rat
11081189LOC500265nucleoporin 50-like4128264112128267776Rat
7643253LOC102550115ribosome biogenesis regulatory protein homolog4128659271128662434Rat
1563030Tafa1TAFA chemokine like family member 14128818468128942088Rat
1597443Tafa4TAFA chemokine like family member 44129196658129430438Rat
9340208LOC103692195uncharacterized LOC1036921954129318247129319649Rat
1359357EogtEGF domain specific O-linked N-acetylglucosamine transferase4129477779129515435Rat
620551Tmf1TATA element modulatory factor 14129521986129546024Rat
621084Uba3ubiquitin-like modifier activating enzyme 34129548411129569550Rat
708572Arl6ip5ADP-ribosylation factor like GTPase 6 interacting protein 54129574363129598240Rat
1564924Lmod3leiomodin 34129604378129619136Rat
620172Frmd4bFERM domain containing 4B4129658137129984735Rat
11470597LOC108350736uncharacterized LOC1083507364129680778129690167Rat
11494882LOC108350735uncharacterized LOC1083507354129863376129880065Rat
9139503LOC10369219660S ribosomal protein L23a pseudogene4129896833129898054Rat
11400915LOC108350821glyceraldehyde-3-phosphate dehydrogenase pseudogene4130078501130082491Rat
11455689LOC108350871uncharacterized LOC1083508714130118654130152487Rat
3092Mitfmelanocyte inducing transcription factor4130172484130425496Rat
11400782LOC108350872uncharacterized LOC1083508724130537776130548325Rat
2323009Mdfic2MyoD family inhibitor domain containing 24130649564130751397Rat
1308669Foxp1forkhead box P14131362178131963466Rat
7669867LOC102555037uncharacterized LOC1025550374131990634131993482Rat
1586185Eif4e3eukaryotic translation initiation factor 4E family member 34132068581132111092Rat
71067Gpr27G protein-coupled receptor 274132137793132138926Rat
1561565Ier3ip1immediate early response 3 interacting protein 14132140802132152059Rat
620280Prok2prokineticin 24132157556132171244Rat
7507912LOC102555186uncharacterized LOC1025551864132290011132294070Rat
1560513RGD1560513similar to macrophage migration inhibitory factor4132295929132298552Rat
9229745LOC103692198uncharacterized LOC1036921984132330276132374231Rat
9307839LOC103692197uncharacterized LOC1036921974132430947132439747Rat
9261195LOC103692199uncharacterized LOC1036921994132530834132579765Rat
11380835LOC108350738uncharacterized LOC1083507384132608924132610834Rat
11518111LOC108350737uncharacterized LOC1083507374132615974132624020Rat
1307077RybpRING1 and YY1 binding protein4132689623132740823Rat
7643619LOC102555246uncharacterized LOC1025552464133008974133013814Rat
1310610Shq1SHQ1, H/ACA ribonucleoprotein assembly factor4133037515133127183Rat
1310610Shq1SHQ1, H/ACA ribonucleoprotein assembly factor4133131711133133170Rat
1593481LOC689383similar to cytoplasmic beta-actin4133137034133139247Rat
1586482Gxylt2glucoside xylosyltransferase 24133179185133263493Rat
1307312Ppp4r2protein phosphatase 4, regulatory subunit 24133285552133323755Rat
9272263LOC103692200uncharacterized LOC1036922004133406466133413628Rat
7731047LOC102555697uncharacterized LOC1025556974133406466133469099Rat
11480110LOC108350739uncharacterized LOC1083507394133415250133420934Rat
1586603LOC686093similar to Spindlin-like protein 3 (SPIN-3) (Protein DXF34)4133523773133541592Rat
11385382LOC10835087360S ribosomal protein L17 pseudogene4133680324133680845Rat
9255243LOC103692201UPF0729 protein C18orf32 homolog4133680844133681086Rat
1592353LOC689407similar to smoothelin isoform a4133688739133690763Rat
1305250Pdzrn3PDZ domain containing RING finger 34133717139133951282Rat
11469179LOC108350740uncharacterized LOC1083507404134178846134183878Rat
1586021LOC500273similar to tubulin, alpha 8 like 34134290913134291859Rat
1592322LOC689440similar to 60S ribosomal protein L134134507143134512545Rat
3253Cntn3contactin 34134783671135159309Rat
11513147LOC108350822uncharacterized LOC1083508224135374528135384688Rat
7698712LOC102547280uncharacterized LOC1025472804135465906135470160Rat
7565639LOC102549329uncharacterized LOC1025493294135876685135891505Rat
1585995LOC502869similar to karyopherin (importin) alpha 24135948298135950166Rat
1586020LOC500277similar to Ras-GTPase-activating protein binding protein 1 (ATP-dependent DNA helicase VIII) (GAP SH3-domain binding protein 1) (G3BP-1) (HDH-VIII)4136078376136079997Rat
1560353RGD1560353similar to 60S ribosomal protein L134136124902136127166Rat
1563492RGD1563492similar to ATP-binding cassette, sub-family F (GCN20), member 24136226867136229249Rat
62008Cntn6contactin 64136512201136904355Rat
621361Cntn4contactin 44137785166138787527Rat
1586019LOC500279similar to Phosphoglycerate kinase 14138432885138434587Rat
70938Il5rainterleukin 5 receptor subunit alpha4138796165138834164Rat
1308857Trnt1tRNA nucleotidyl transferase 14138855497138869217Rat
1310533Crbncereblon4138864910138885786Rat
11479425LOC108348222GDP-Man:Man(3)GlcNAc(2)-PP-Dol alpha-1,2-mannosyltransferase pseudogene4139024096139026202Rat
1585994LOC502870similar to B0361.84139024096139165637Rat
1589884LOC689694similar to 40S ribosomal protein S7 (S8)4139537980139538525Rat
1564145Lrrn1leucine rich repeat neuronal 14139633310139679730Rat
11408865LOC108350741uncharacterized LOC1083507414139683245139690535Rat
6487745LOC100912325actin, cytoplasmic 2-like4139990873139991923Rat
1565882SetmarSET domain and mariner transposase fusion gene4140092346140104495Rat
1309939Sumf1sulfatase modifying factor 14140139017140220482Rat
2933Itpr1inositol 1,4,5-trisphosphate receptor, type 14140247297140580749Rat
7723051LOC102547466uncharacterized LOC1025474664140564422140594171Rat
7692497LOC102547402uncharacterized LOC1025474024140620451140656139Rat
11461811LOC108350742uncharacterized LOC1083507424140656378140666835Rat
68439Bhlhe40basic helix-loop-helix family, member e404140703619140709319Rat
1562830Arl8bADP-ribosylation factor like GTPase 8B4140837745140881866Rat
1563633Edem1ER degradation enhancing alpha-mannosidase like protein 14140886644140918654Rat
11400916LOC108350874uncharacterized LOC1083508744141021819141023201Rat
1586018LOC500283similar to Proteasome 26S subunit subunit 4 ATPase CG5289-PA4141168128141169458Rat
11358358LOC108350743uncharacterized LOC1083507434141997425142006546Rat
619857Grm7glutamate metabotropic receptor 74142452616143368460Rat
9199378LOC103692202cyclin-dependent kinases regulatory subunit 2 pseudogene4142969739142970846Rat
11418581LOC108350844uncharacterized LOC1083508444143266215143272319Rat
9205690LOC103692203uncharacterized LOC1036922034144070869144117408Rat
1308963Lmcd1LIM and cysteine-rich domains 14144192989144252554Rat
1562010Ssuh2ssu-2 homolog4144301913144322197Rat
2281Cav3caveolin 34144382945144398919Rat
3239Oxtroxytocin receptor4144399326144417598Rat
1306993Rad18RAD18 E3 ubiquitin protein ligase4144537329144620606Rat
7609120LOC102548080uncharacterized LOC1025480804144620731144687704Rat
1563152Srgap3SLIT-ROBO Rho GTPase activating protein 34144638782144869961Rat
7623898LOC102548337uncharacterized LOC1025483374144953748144985765Rat
1560852Thumpd3THUMP domain containing 34144985850145010164Rat
6491660Thumpd3-as1THUMPD3 antisense RNA 14145010882145017388Rat
1310433Setd5SET domain containing 54145017549145095247Rat
11478132LOC108350744uncharacterized LOC1083507444145091322145113115Rat
727967Lhfpl4LHFPL tetraspan subfamily member 44145117533145147397Rat
1304842Mtmr14myotubularin related protein 144145195046145238097Rat
1309212Cpne9copine family member 94145238011145262444Rat
1584828Brpf1bromodomain and PHD finger containing, 14145264445145280943Rat
621168Ogg18-oxoguanine DNA glycosylase4145282828145289367Rat
629473Camk1calcium/calmodulin-dependent protein kinase I4145289300145300146Rat
2319531LOC100361743chaperonin containing Tcp1, subunit 3 (gamma)4145307845145310648Rat
2319475LOC100361799cDNA sequence BC006662-like4145312923145313543Rat
1564009Tada3transcriptional adaptor 34145318417145330291Rat
1310096Arpc4actin related protein 2/3 complex, subunit 44145330457145340985Rat
1311255Ttll3tubulin tyrosine ligase like 34145341059145366614Rat
1307582Rpusd3RNA pseudouridine synthase D34145361937145370992Rat
7499834LOC102548450uncharacterized LOC1025484504145373527145376624Rat
1562113Cideccell death-inducing DFFA-like effector c4145377482145390497Rat
2319333LOC100361844mCG51413-like4145395849145398300Rat
1565488Jagn1jagunal homolog 14145399885145404605Rat
735148Il17reinterleukin 17 receptor E4145413157145426608Rat
1306392Il17rcinterleukin 17 receptor C4145426647145439845Rat
1309412Creld1cysteine-rich with EGF-like domains 14145440284145449894Rat
1562419Prrt3proline-rich transmembrane protein 34145449574145458900Rat
1311566Emc3ER membrane protein complex subunit 34145471466145487375Rat
1303172Fancd2FA complementation group D24145489869145551479Rat
1565997Fancd2osFANCD2 opposite strand4145549248145556054Rat
1598136Brk1BRICK1 subunit of SCAR/WAVE actin nucleating complex4145559206145574438Rat
3960Vhlvon Hippel-Lindau tumor suppressor4145580869145587835Rat
1309584Irak2interleukin-1 receptor-associated kinase 24145594575145651066Rat
1586017Tatdn2TatD DNase domain containing 24145653299145669343Rat
632283Ghrlghrelin and obestatin prepropeptide4145674157145678066Rat
1359555Sec13SEC13 homolog, nuclear pore and COPII coat complex component4145686186145699577Rat
2176Atp2b2ATPase plasma membrane Ca2+ transporting 24145704779145948997Rat
9152984LOC103692204uncharacterized LOC1036922044145798664145803494Rat
11380647LOC108350745uncharacterized LOC1083507454146071280146086117Rat
628737Slc6a11solute carrier family 6 member 114146106386146223228Rat
11426638LOC108350746uncharacterized LOC1083507464146181234146202910Rat
620533Slc6a1solute carrier family 6 member 14146258842146292176Rat
7575330LOC102548867uncharacterized LOC1025488674146292860146302162Rat
9139504LOC103692205uncharacterized LOC1036922054146302250146304311Rat
2830Hrh1histamine receptor H 14146374596146458148Rat
11470762LOC108350747endogenous retrovirus group K member 10 Gag polyprotein-like4146558384146560078Rat
1304817Atg7autophagy related 74146570113146777093Rat
1311653Vgll4vestigial-like family member 44146778556146890063Rat
1586150Tamm41TAM41 mitochondrial translocator assembly and maintenance homolog4146922085146954159Rat
7601218LOC102556150mth938 domain-containing protein-like4146962237146962825Rat
11475264LOC108350875uncharacterized LOC1083508754146972672146982399Rat
3798Syn2synapsin II4147037179147195096Rat
2319464LOC100365210hypothetical LOC1003652104147103945147108065Rat
6491335LOC100911724tubulin alpha-1C chain-like4147104219147105627Rat
69077Timp4TIMP metallopeptidase inhibitor 44147156948147163467Rat
3371Ppargperoxisome proliferator-activated receptor gamma4147274055147399383Rat
11382098LOC108350748uncharacterized LOC1083507484147383624147390408Rat
1309946Tsen2tRNA splicing endonuclease subunit 24147455506147490869Rat
2320714Mkrn2osMKRN2 opposite strand4147497139147505339Rat
1310618Mkrn2makorin, ring finger protein, 24147514041147532086Rat
3531Raf1Raf-1 proto-oncogene, serine/threonine kinase4147532040147592769Rat
1587025Tmem40transmembrane protein 404147645333147657847Rat
620480Cand2cullin-associated and neddylation-dissociated 2 (putative)4147686487147714593Rat
621203Rpl32ribosomal protein L324147715480147719044Rat
1586985Efcab12EF-hand calcium binding domain 124147720813147743342Rat
1585874Mbd4methyl-CpG binding domain 4 DNA glycosylase4147744673147756462Rat
1311302Ift122intraflagellar transport 1224147756574147826983Rat
3573Rhorhodopsin4147832136147837298Rat
1566236H1f8H1.8 linker histone4147844658147849779Rat
1310796Plxnd1plexin D14147854309147894170Rat
1311909Tmcc1transmembrane and coiled-coil domain family 14147920987148048852Rat
1592944LOC680385similar to Sjogren syndrome antigen B4147929498147931250Rat
735230Washc2cWASH complex subunit 2C4148139512148197363Rat
7515225LOC102548151uncharacterized LOC1025481514148168185148170863Rat
11384346LOC10835075060S ribosomal protein L9-like4148178627148182006Rat
628707Zfand4zinc finger AN1-type containing 44148198810148270273Rat
1309339Marchf8membrane associated ring-CH-type finger 84148285467148398148Rat
1591759LOC680441similar to 60S ribosomal protein L23a4148361040148362371Rat
2096Alox5arachidonate 5-lipoxygenase4148398004148446308Rat
11501754LOC10835074960S ribosomal protein L7 pseudogene4148421489148426621Rat
1333902Olr823olfactory receptor 8234148469704148477869Rat
1333048Olr824olfactory receptor 8244148519816148520799Rat
1333814Olr825olfactory receptor 8254148544958148545941Rat
1332818Olr826olfactory receptor 8264148567386148568369Rat
1332631Olr827olfactory receptor 8274148589144148590127Rat
9311266LOC103692206uncharacterized LOC1036922064148610220148618888Rat
1586016LOC500299similar to heat shock protein 1, alpha4148617263148619575Rat
1333047Olr828olfactory receptor 8284148623770148624753Rat
1585993LOC502876similar to protein phosphatase 1, regulatory subunit 15B4148628116148631016Rat
1332875Olr829olfactory receptor 8294148647654148650506Rat
1334034Olr830olfactory receptor 8304148664043148665912Rat
1333628Olr831olfactory receptor 8314148690066148690998Rat
1333171Olr832olfactory receptor 8324148710898148711830Rat
11489696Trnac-gca29transfer RNA cysteine (anticodon GCA) 294148720025148720096Rat
620229Zfp422zinc finger protein 4224148757362148761594Rat
1307785Rassf4Ras association domain family member 44148769092148804295Rat
1565700Depp1DEPP1, autophagy regulator4148780330148784566Rat
1308850Tmem72transmembrane protein 724148819906148845199Rat
1560120Akr1b1-ps2aldo-keto reductase family 1, member B1 (aldose reductase), pseudogene 24148951611148952561Rat
11446777LOC108350751uncharacterized LOC1083507514148958591148960322Rat
11463298LOC108350876uncharacterized LOC1083508764149183163149191926Rat
3651Cxcl12C-X-C motif chemokine ligand 124149261044149273891Rat
7749382LOC102548743uncharacterized LOC1025487434149371163149395805Rat
1596703LOC681387similar to ubiquitin-conjugating enzyme E2M4149558413149562252Rat
2321730LOC100360627DAZ associated protein 2-like4149777904149778604Rat
1563294RGD1563294similar to Alpha enolase (2-phospho-D-glycerate hydro-lyase)4149800558149802051Rat
1559850Zfp637zinc finger protein 6374149857127149882828Rat
6502210Zfp239zinc finger protein 2394149902278149909841Rat
620366Hnrnpfheterogeneous nuclear ribonucleoprotein F4149957143149978896Rat
70998Fxyd4FXYD domain-containing ion transport regulator 44149984206149988744Rat
1583233LOC685069similar to H2A histone family, member V isoform 14150029954150030549Rat
9169449LOC103692207uncharacterized LOC1036922074150061415150068584Rat
1305836Rasgef1aRasGEF domain family, member 1A4150063484150144203Rat
1563660Csgalnact2chondroitin sulfate N-acetylgalactosaminyltransferase 24150148626150185062Rat
1597753LOC685129similar to developmental pluripotency-associated 34150199518150200671Rat
3556Retret proto-oncogene4150202170150249196Rat
1597729LOC685154similar to DNA-directed RNA polymerase II 7.6 kDa polypeptide (RPB10) (RPB7.6) (RPABC5)4150301680150302082Rat
1308043Bms1BMS1 ribosome biogenesis factor4150433567150471783Rat
9378282LOC103692208uncharacterized LOC1036922084150439712150442834Rat
11379695LOC10835075260S ribosomal protein L17 pseudogene4150449282150450389Rat
2293498Zfp9zinc finger protein 94150482989150533610Rat
1561270Zfp248zinc finger protein 2484150483571150507303Rat
1310736Ankrd26ankyrin repeat domain 264150548656150616928Rat
2245Cacna1ccalcium voltage-gated channel subunit alpha1 C4150635808151270790Rat
7701318LOC102553751uncharacterized LOC1025537514150637437150645687Rat
9476032LOC103692209uncharacterized LOC1036922094151061845151062415Rat
11451530LOC108350845uncharacterized LOC1083508454151100038151102685Rat
11446381LOC108350846uncharacterized LOC1083508464151178451151183152Rat
1562214Dcp1bdecapping mRNA 1B4151249654151287018Rat
1562038Cacna2d4calcium voltage-gated channel auxiliary subunit alpha2delta 44151298548151409263Rat
1587001Lrtm2leucine-rich repeats and transmembrane domains 24151375568151397485Rat
1307891Adipor2adiponectin receptor 24151412135151480108Rat
628850Wnt5bWnt family member 5B4151500962151516894Rat
1305523Fbxl14F-box and leucine-rich repeat protein 144151986890151990706Rat
628733Erc1ELKS/RAB6-interacting/CAST family member 14152087393152380023Rat
7728321LOC102552689caspase-6-like4152348542152350401Rat
7544823LOC102552625uncharacterized LOC1025526254152381178152388672Rat
9455361LOC103694898COMM domain-containing protein 6 pseudogene4152417753152418815Rat
1304975Rad52RAD52 homolog, DNA repair protein4152429826152451875Rat
621141Wnk1WNK lysine deficient protein kinase 14152452211152578469Rat
9472652LOC10369221040S ribosomal protein S12 pseudogene4152544088152544530Rat
620552Ninj2ninjurin 24152630464152733631Rat
1584727LOC681016similar to ribosomal protein L44152701244152703124Rat
1561056B4galnt3beta-1,4-N-acetyl-galactosaminyl transferase 34152736036152835521Rat
1310710Ccdc77coiled-coil domain containing 774152860669152892518Rat
1305429Kdm5alysine demethylase 5A4152892388152972196Rat
1306559Il17rainterleukin 17 receptor A4152995865153018394Rat
1565302Tmem121btransmembrane protein 121B4153018163153029673Rat
1306557Hdhd5haloacid dehalogenase like hydrolase domain containing 54153046701153079065Rat
11370866LOC108350753uncharacterized LOC1083507534153176647153197173Rat
1564182Cecr2CECR2, histone acetyl-lysine reader4153217521153327153Rat
11510229LOC108350754uncharacterized LOC1083507544153235242153239012Rat
1590470Slc25a18solute carrier family 25 member 184153330069153350447Rat
735157Atp6v1e1ATPase H+ transporting V1 subunit E14153351434153373558Rat
1306985Bcl2l13BCL2 like 134153385200153438096Rat
620160BidBH3 interacting domain death agonist4153439812153465247Rat
1359504Mical3microtubule associated monooxygenase, calponin and LIM domain containing 34153484876153631986Rat
9436680LOC103692212uncharacterized LOC1036922124153652519153658619Rat
9164480LOC103695224uncharacterized LOC1036952244153661814153663795Rat
9350903LOC103692211uncharacterized LOC1036922114153667251153677633Rat
1584998Pex26peroxisomal biogenesis factor 264153747715153760446Rat
1566041Tuba8tubulin, alpha 84153774511153791223Rat
1359153Usp18ubiquitin specific peptidase 184153812312153834374Rat
7621965LOC102553072uncharacterized LOC1025530724153834686153836470Rat
7574093LOC102553128uncharacterized LOC1025531284153871346153879582Rat
620788Slc6a13solute carrier family 6 member 134153874942153912185Rat
620255Slc6a12solute carrier family 6 member 124153921199153941333Rat
1593191Iqsec3IQ motif and Sec7 domain ArfGEF 34153948052154044493Rat
1564159RGD1564159similar to eukaryotic translation elongation factor 1 epsilon 14154113718154114250Rat
1302962Mug2murinoglobulin 24154215262154282608Rat
2004A2malpha-2-macroglobulin4154309426154359138Rat
9079285LOC103692213alpha-1-inhibitor 3-like4154391636154393231Rat
6490793LOC100911742voltage-dependent anion-selective channel protein 2-like4154406157154406972Rat
1584999LOC297568alpha-1-inhibitor III4154505736154565104Rat
11453896LOC108350755thymosin beta-10 pseudogene4154528331154529259Rat
1584878LOC500309similar to salvador homolog 14154576907154578154Rat
9469492LOC103692215uncharacterized LOC1036922154154611314154617299Rat
9392689LOC103692214uncharacterized LOC1036922144154619084154622986Rat
621366Mug1murinoglobulin 14154676382154729288Rat
9129106LOC103692217uncharacterized LOC1036922174154689470154695455Rat
9452268LOC103692216uncharacterized LOC1036922164154697242154701144Rat
11450202LOC108350756uncharacterized LOC1083507564154736564154746548Rat
1566313Cpamd8C3 and PZP-like, alpha-2-macroglobulin domain containing 84154780044154997086Rat
9232704LOC103692218murinoglobulin-1-like4154809348154823705Rat
11369401LOC108350757thymosin beta-10 pseudogene4154842346154845489Rat
11358635LOC108350758thymosin beta-10 pseudogene4154977518154980661Rat
1561215RGD1561215similar to killer cell lectin-like receptor subfamily G, member 14155008355155017246Rat
61978Klrg1killer cell lectin like receptor G14155038936155051449Rat
1359355M6prmannose-6-phosphate receptor, cation dependent4155084755155093896Rat
1309203Phc1polyhomeotic homolog 14155093947155118838Rat
9120357LOC10369221928S ribosomal protein S36, mitochondrial pseudogene4155189177155189647Rat
11488957Trnaa-agc5transfer RNA alanine (anticodon AGC) 54155196677155196751Rat
1560851Rimklbribosomal modification protein rimK-like family member B4155258241155292809Rat
1307919Mfap5microfibril associated protein 54155313671155336228Rat
1303222Aicdaactivation-induced cytidine deaminase4155359909155371104Rat
2133Apobec1apolipoprotein B mRNA editing enzyme catalytic subunit 14155386367155414034Rat
1564178Gdf3growth differentiation factor 34155417667155422014Rat
1310932Dppa3developmental pluripotency-associated 34155437675155441059Rat
1588989LOC685897hypothetical protein LOC6858974155467736155468168Rat
1303178NanogNanog homeobox4155531906155539268Rat
7710056LOC102550056ATP synthase subunit g, mitochondrial-like4155536316155536662Rat
3706Slc2a3solute carrier family 2 member 34155549991155626018Rat
7647486LOC10255013660S ribosomal protein L29-like4155583009155586196Rat
1565101Foxj2forkhead box J24155653446155679815Rat
620537C3ar1complement C3a receptor 14155681767155691240Rat
1563551RGD1563551similar to ribosomal protein L314155702631155703049Rat
1306053Necap1NECAP endocytosis associated 14155709712155724801Rat
7546468LOC102550396LRRGT001884155727868155740193Rat
1359163Clec4a2C-type lectin domain family 4, member A24155793059155867731Rat
1359528Clec4a3C-type lectin domain family 4, member A34155913366155923079Rat
1359109Clec4a1C-type lectin domain family 4, member A14155947794155959909Rat
1586681LOC686015similar to 60S ribosomal protein L74155963472155964363Rat
1359662Clec4aC-type lectin domain family 4, member A4156049800156069260Rat
1359354Clec4b2C-type lectin domain family 4, member B24156107720156131226Rat
1359505Clec6a-ps1C-type lectin domain family 6, member A, pseudogene 14156186251156219375Rat
1559669RGD1559669similar to Slbp protein4156223785156224699Rat
1303339Clec4dC-type lectin domain family 4, member D4156253084156264766Rat
1359298Clec4eC-type lectin domain family 4, member E4156271087156276243Rat
11516150LOC108350823eukaryotic translation initiation factor 4E pseudogene4156316525156320318Rat
1585454Vom2r48vomeronasal 2 receptor, 484156324922156366577Rat
1566165Vom2r50vomeronasal 2 receptor, 504156482446156504818Rat
1561712Vom2r51vomeronasal 2 receptor, 514156515299156563438Rat
735022Vom2r52vomeronasal 2 receptor, 524156597780156629949Rat
1561715RGD1561715similar to complement component 1, s subcomponent4156728192156730309Rat
1310382Cd163CD163 molecule4156752063156785467Rat
1307916RGD1307916LOC3624334156824273156945126Rat
11417787LOC108350759uncharacterized LOC1083507594156963218156966075Rat
1307612Pex5peroxisomal biogenesis factor 54156983914157009675Rat
9230431LOC10369222160S ribosomal protein L17 pseudogene4157026327157026935Rat
621153Clstn3calsyntenin 34157044736157078013Rat
2319177Zfp42lZinc finger protein 42-like4157053980157058957Rat
7702915LOC102553636uncharacterized LOC1025536364157091445157100430Rat
1302936C1rlcomplement C1r subcomponent like4157108190157122689Rat
7639415LOC102553847uncharacterized LOC1025538474157126038157126857Rat
1309091C1rcomplement C1r4157126060157136825Rat
619983C1scomplement C1s4157143592157155592Rat
1310223Lpcat3lysophosphatidylcholine acyltransferase 34157181722157222997Rat
1307665Emg1EMG1 N1-specific pseudouridine methyltransferase4157222366157230647Rat
620203Phb2prohibitin 24157230769157235375Rat
2325407Mir141microRNA 1414157236346157236439Rat
4888590Mir3575microRNA 35754157236759157236873Rat
2325553Mir200cmicroRNA 200c4157236786157236854Rat
620660Ptpn6protein tyrosine phosphatase, non-receptor type 64157239141157263890Rat
2318975Grcc10gene rich cluster, C10 gene4157264383157266042Rat
61832Atn1atrophin 14157267394157281199Rat
2554Eno2enolase 24157285192157294090Rat
1304779Lrrc23leucine rich repeat containing 234157294386157304590Rat
1310854Spsb2splA/ryanodine receptor domain and SOCS box containing 24157325980157328380Rat
3896Tpi1triosephosphate isomerase 14157328375157331905Rat
1308438Usp5ubiquitin specific peptidase 54157332735157347803Rat
1359093Cdca3cell division cycle associated 34157347876157351889Rat
708344Gnb3G protein subunit beta 34157352558157359237Rat
1305699P3h3prolyl 3-hydroxylase 34157359331157375186Rat
1307437Gpr162G protein-coupled receptor 1624157375184157381780Rat
2306Cd4Cd4 molecule4157381862157408357Rat
1302990Lag3lymphocyte activating 34157425644157433700Rat
621529Ptmsparathymosin4157435371157439507Rat
7566034LOC102553981uncharacterized LOC1025539814157436647157447681Rat
1306294Mlf2myeloid leukemia factor 24157452578157457254Rat
1310070Cops7aCOP9 signalosome subunit 7A4157479549157486944Rat
1304952PianpPILR alpha associated neural protein4157508862157517676Rat
708346Zfp384zinc finger protein 3844157523083157552606Rat
7507389LOC102554095uncharacterized LOC1025540954157544048157563790Rat
1309407Ing4inhibitor of growth family, member 44157554729157563353Rat
1564880Acrbpacrosin binding protein4157563990157577045Rat
1562580Lpar5lysophosphatidic acid receptor 54157581000157596454Rat
620064Chd4chromodomain helicase DNA binding protein 44157612531157645660Rat
1304616Nop2NOP2 nucleolar protein4157646759157658502Rat
1308257Iffo1intermediate filament family orphan 14157659115157676335Rat
2661Gapdhglyceraldehyde-3-phosphate dehydrogenase4157676336157680322Rat
1562596Ncapd2non-SMC condensin I complex, subunit D24157682855157705903Rat
1306686Mrpl51mitochondrial ribosomal protein L514157705790157709452Rat
3948Vamp1vesicle-associated membrane protein 14157726941157733644Rat
1307893TapbplTAP binding protein-like4157735748157743199Rat
1560499Cd27CD27 molecule4157744881157751609Rat
7654957LOC102555485uncharacterized LOC1025554854157751751157754498Rat
7708239LOC102555545uncharacterized LOC1025555454157773270157786363Rat
1565719Tuba3atubulin, alpha 3A4157789874157798763Rat
1309448Ltbrlymphotoxin beta receptor4157822838157829291Rat
3639Scnn1asodium channel epithelial 1 subunit alpha4157834339157860472Rat
621237Tnfrsf1aTNF receptor superfamily member 1A4157864905157877634Rat
2318544Plekhg6pleckstrin homology and RhoGEF domain containing G64157877725157897167Rat
2318Cd9CD9 molecule4157977163158010091Rat
621759Vwfvon Willebrand factor4158085059158219525Rat
1591606Ano2anoctamin 24158222650158577595Rat
619728Ntf3neurotrophin 34158636883158705886Rat
7508270LOC102546745uncharacterized LOC1025467454158827536158875862Rat
2322439LOC100363712proteasome (prosome, macropain) assembly chaperone 4-like4158941785158942230Rat
2953Kcna5potassium voltage-gated channel subfamily A member 54159077195159079003Rat
9220545LOC103692222uncharacterized LOC1036922224159091018159096875Rat
9366675LOC103692223uncharacterized LOC1036922234159103586159122631Rat
2949Kcna1potassium voltage-gated channel subfamily A member 14159190781159192526Rat
9438173LOC103692224uncharacterized LOC1036922244159236326159248402Rat
62083Kcna6potassium voltage-gated channel subfamily A member 64159253934159287193Rat
7609596LOC102555729probable polypeptide N-acetylgalactosaminyltransferase 8-like4159339665159356334Rat
9174049Galnt8polypeptide N-acetylgalactosaminyltransferase 84159340750159362350Rat
9252630LOC103692225probable polypeptide N-acetylgalactosaminyltransferase 84159349368159350055Rat
1307307Ndufa9NADH:ubiquinone oxidoreductase subunit A94159371263159399636Rat
1359735Akap3A-kinase anchoring protein 34159399686159425512Rat
1306800Dyrk4dual specificity tyrosine phosphorylation regulated kinase 44159426447159467973Rat
1597431Rad51ap1RAD51 associated protein 14159469803159482869Rat
1311164RGD1311164similar to DNA segment, Chr 6, Wayne State University 163, expressed4159483089159518387Rat
1564885RGD1564885similar to 40S ribosomal protein S24159523672159524889Rat
1597399LOC689087similar to protein associated with PRK14159535068159536340Rat
1559795RGD1559795similar to 40S ribosomal protein S7 (S8)4159540222159540858Rat
620130Fgf6fibroblast growth factor 64159563798159572333Rat
7701270LOC102547991uncharacterized LOC1025479914159591366159609079Rat
620178Fgf23fibroblast growth factor 234159622404159630082Rat
1560038TigarTP53 induced glycolysis regulatory phosphatase4159635145159654108Rat
621083Ccnd2cyclin D24159674885159697207Rat
7739274LOC102548109uncharacterized LOC1025481094159725763159734711Rat
11455586LOC108350761uncharacterized LOC1083507614159729616159742579Rat
7707214LOC102548180uncharacterized LOC1025481804159877380159887672Rat
2322558LOC100363692hypothetical LOC1003636924159994017159994485Rat
1561791Parp11poly (ADP-ribose) polymerase family, member 114160013968160059981Rat
1563719Cracr2acalcium release activated channel regulator 2A4160143160160238744Rat
1587677Prmt8protein arginine methyltransferase 84160253409160334647Rat
7623583LOC102548836uncharacterized LOC1025488364160341527160357962Rat
1305424Tspan11tetraspanin 114160455845160522905Rat
11412441LOC108350762uncharacterized LOC1083507624160505932160518204Rat
1304740Tspan9tetraspanin 94160530726160725056Rat
7507121LOC102556609uncharacterized LOC1025566094160775846160789387Rat
1303230Senp18Sumo1/sentrin/SMT3 specific peptidase 184160802131160803558Rat
7513880LOC102548970sentrin-specific protease 2-like4160837812160842103Rat
1303080Senp17Sumo1/sentrin/SMT3 specific peptidase 174160865065160866064Rat
11392596LOC108350763uncharacterized LOC1083507634160932991160946131Rat
1586882LOC683408similar to Sumo1/sentrin/Smt3 specific protease 174160965845160966601Rat
1592312LOC689450similar to sentrin 184160993711160998128Rat
11411257LOC108350764uncharacterized LOC1083507644161022056161024250Rat
6503339LOC100909503sentrin-specific protease 2-like4161089247161093515Rat
9313900LOC103692226uncharacterized LOC1036922264161094630161111986Rat
1593529LOC689335similar to Sumo1/sentrin/Smt3 specific protease 174161150615161155019Rat
6502726LOC100909633sentrin-specific protease 2-like4161171893161174552Rat
7498296LOC102555930uncharacterized LOC1025559304161204862161206019Rat
2324522LOC100362532Sumo1/sentrin/SMT3 specific peptidase 18-like4161212121161214576Rat
7575465LOC102556820uncharacterized LOC1025568204161262076161262728Rat
1585990LOC502897similar to Sumo1/sentrin/Smt3 specific protease 174161277249161279028Rat
7733986LOC102555303transcriptional enhancer factor TEF-3-like4161279410161292962Rat
6500818LOC100910015sentrin-specific protease 2-like4161308147161310576Rat
7660769LOC102557052uncharacterized LOC1025570524161316704161317861Rat
9362818LOC103692227uncharacterized LOC1036922274161341670161391249Rat
6498874LOC100910346sentrin-specific protease 2-like4161348171161349926Rat
11421259LOC108350766uncharacterized LOC1083507664161350920161360467Rat
9408805LOC103692234transcriptional enhancer factor TEF-3-like4161374660161378006Rat
6500045LOC100910090sentrin-specific protease 2-like4161392437161394865Rat
11382743LOC108350768uncharacterized LOC1083507684161427275161447034Rat
1593520LOC689344similar to sentrin 184161432460161434215Rat
6499742LOC100910168sentrin-specific protease 2-like4161451663161456288Rat
1584876LOC500327similar to Sumo1/sentrin/Smt3 specific protease 174161507032161509354Rat
1591108LOC689519similar to Transcriptional enhancer factor TEF-3 (TEA domain family member 4) (TEAD-4) (ETF-related factor 2) (ETFR-2) (TEF-1-related factor 1) (TEF-1-related factor FR-19) (RTEF-1)4161518886161520128Rat
1585671Tead4TEA domain transcription factor 44161542566161619848Rat
2318745LOC100362138influenza virus NS1A binding protein (predicted)-like4161629712161631838Rat
1585259Tulp3TUB like protein 34161636084161677807Rat
1359404Rhno1RAD9-HUS1-RAD1 interacting nuclear orphan 14161679674161685060Rat
61807Foxm1forkhead box M14161685236161697633Rat
11514824LOC108350769uncharacterized LOC1083507694161695653161723108Rat
2323784Tex52testis expressed 524161696884161708793Rat
1589959Nrip2nuclear receptor interacting protein 24161719434161729673Rat
7550381LOC102555665nuclear receptor-interacting protein 2-like4161728890161729673Rat
1311944Itfg2integrin alpha FG-GAP repeat containing 24161730643161744281Rat
628729Fkbp4FKBP prolyl isomerase 44161748993161757447Rat
7574084LOC102554670uncharacterized LOC1025546704161757525161768039Rat
628643Pzppregnancy-zone protein4161804792161850877Rat
1565709A2ml1alpha-2-macroglobulin-like 14161863609161907897Rat
9328344LOC103692228uncharacterized LOC1036922284161925072161928707Rat
7556630LOC102554736uncharacterized LOC1025547364161928728161945250Rat
1586149Klrb1akiller cell lectin-like receptor subfamily B, member 1A4161950270161966582Rat
11403029LOC108350877uncharacterized LOC1083508774161994920161995741Rat
9100480LOC103692229transcription elongation factor B polypeptide 1 pseudogene4162006434162006717Rat
2975Klrb1bkiller cell lectin-like receptor subfamily B member 1B4162012653162025090Rat
11449336LOC108350770uncharacterized LOC1083507704162037330162039751Rat
1564464LOC500331similar to osteoclast inhibitory lectin4162073423162088240Rat
9368660LOC103692230uncharacterized LOC1036922304162152484162161554Rat
1588731LOC689757similar to osteoclast inhibitory lectin4162181798162229435Rat
9351185LOC103692231uncharacterized LOC1036922314162186180162216264Rat
620070Clec2dC-type lectin domain family 2, member D4162278252162302881Rat
9305054LOC103692232uncharacterized LOC1036922324162281712162294299Rat
7696800LOC102547086serine/threonine-protein phosphatase 2A 56 kDa regulatory subunit alpha isoform-like4162297061162298056Rat
7635298LOC102549299uncharacterized LOC1025492994162388917162394856Rat
1588698Clec2dl1C-type lectin domain family 2 member D-like 14162391309162402569Rat
6484980LOC100912974uncharacterized LOC1009129744162421606162440495Rat
1562831Clec2d2C-type lectin domain family 2 member D24162434155162450770Rat
1587580LOC689800similar to osteoclast inhibitory lectin4162480400162499556Rat
1582927LOC688980hypothetical protein LOC6889804162497479162498582Rat
11469562LOC108350771uncharacterized LOC1083507714162518417162519381Rat
1583336Klrb1ckiller cell lectin like receptor B1C4162528614162553421Rat
1359302Ly49i7immunoreceptor Ly49i74162711534162731831Rat
1587563Klrb1killer cell lectin like receptor B14162774050162792804Rat
1306865Clec2hC-type lectin domain family 2, member H4162810384162844330Rat
7506429LOC102553980ankyrin repeat domain-containing protein 13C-like4162828391162832043Rat
1587527Clec2eC-type lectin domain family 2, member E4162849880162866383Rat
2318170LOC100362418killer cell lectin-like receptor subfamily B member 1C4162880504162885852Rat
1587506LOC689874similar to Homeobox protein Rhox5 (Reproductive homeobox on chromosome X 5) (Homeobox protein Pem) (Placenta and embryonic expression protein)4162930556162932247Rat
1563148Clec2gC-type lectin domain family 2, member G4162934195162942891Rat
9417559LOC103692233uncharacterized LOC1036922334162956165162960845Rat
11377651LOC108350773uncharacterized LOC1083507734162978190162979667Rat
6500959LOC100909928uncharacterized LOC1009099284162988326162991176Rat
11402575LOC108350772uncharacterized LOC1083507724162991017163020853Rat
61318Cd69Cd69 molecule4163041147163049065Rat
1564770RGD1564770similar to CD69 antigen (p60, early T-cell activation antigen)4163085480163095387Rat
1592991Clec12aC-type lectin domain family 12, member A4163112100163130979Rat
1584868Chtopl1chromatin target of PRMT1-like 14163118314163119533Rat
1560487Clec12bC-type lectin domain family 12, member B4163140883163157996Rat
1563517Clec1bC-type lectin domain family 1, member B4163161941163170470Rat
1562513Clec9aC-type lectin domain containing 9A4163173593163189532Rat
1566110Clec1aC-type lectin domain family 1, member A4163191503163214678Rat
1565140Clec7aC-type lectin domain containing 7A4163216152163227367Rat
620515Olr1oxidized low density lipoprotein receptor 14163239853163261937Rat
1586337Tmem52btransmembrane protein 52B4163267410163273533Rat
7702000LOC102554909uncharacterized LOC1025549094163282610163293610Rat
1596143Gabarapl1GABA type A receptor associated protein like 14163293724163302866Rat
727903Klre1killer cell lectin-like receptor, family E, member 14163346684163355050Rat
2978Klrd1killer cell lectin like receptor D14163358355163369925Rat
3180Klrk1killer cell lectin like receptor K14163392652163403735Rat
1560637Klrc3killer cell lectin like receptor C34163416373163427331Rat
2977Klrc2killer cell lectin like receptor C24163433993163445136Rat
2976Klrc1killer cell lectin like receptor C14163453435163463718Rat
2323822LOC100359471HCLS1 associated X-1-like4163477550163491795Rat
1359344Klri1killer cell lectin-like receptor family I member 14163494979163528237Rat
2318121LOC100362467HCLS1 associated X-1-like4163558420163559778Rat
1359205Klri2killer cell lectin-like receptor family I member 24163561525163571113Rat
621452Klrh1killer cell lectin-like receptor subfamily H, member 14163595909163611383Rat
1585190LOC690020similar to killer cell lectin-like receptor, subfamily A, member 174163628633163649820Rat
1585178LOC690033similar to immunoreceptor Ly49si34163678221163704855Rat
1359487Ly49si1immunoreceptor Ly49si14163736132163890806Rat
9369277LOC103690111killer cell lectin-like receptor 54163879946163890805Rat
1359240Ly49si2immunoreceptor Ly49si24163920579163968089Rat
9428184LOC103692265killer cell lectin-like receptor 44163954872163977255Rat
1359669Ly49si3immunoreceptor Ly49si34163986547164028520Rat
1585116LOC690097similar to immunoreceptor Ly49si34164026176164053682Rat
1584856LOC502907similar to immunoreceptor Ly49si14164105037164127770Rat
2291887LOC497796hypothetical protein LOC4977964164174738164211880Rat
11509626LOC108350774uncharacterized LOC1083507744164198358164200452Rat
1584041LOC690127similar to Ly49 stimulatory receptor 54164241372164253109Rat
1359728Ly49s5Ly49 stimulatory receptor 54164284910164306500Rat
1359210Ly49i5Ly49 inhibitory receptor 54164345763164357619Rat
3023Klra22killer cell lectin-like receptor subfamily A, member 224164384701164406096Rat
1549735Ly49s6Ly49 stimulatory receptor 64164428761164453267Rat
1549723Ly49s4Ly49 stimulatory receptor 44164470396164493252Rat
1549758Ly49i4Ly49 inhibitory receptor 44164515105164537019Rat
1591115LOC689512similar to killer cell lectin-like receptor subfamily A, member 224164561074164592113Rat
11432247LOC108350775killer cell lectin-like receptor 74164616136164657243Rat
6495905LOC100910923killer cell lectin-like receptor 5-like4164664191164691471Rat
1359730Ly49i3immunoreceptor Ly49i34164743490164748179Rat
9263295LOC103692235uncharacterized LOC1036922354164788458164788838Rat
6495444LOC100911057killer cell lectin-like receptor 4-like4164803688164817439Rat
628669Ly49i2Ly49 inhibitory receptor 24164876252164901832Rat
1359586Klra1killer cell lectin-like receptor, subfamily A, member 14165005722165026562Rat
11433693LOC108350824peptidyl-prolyl cis-trans isomerase D pseudogene4165089449165090823Rat
1562972LOC502908Ly49s84165093769165118489Rat
735134Klra5killer cell lectin-like receptor, subfamily A, member 54165169417165317573Rat
1359667Klra2killer cell lectin-like receptor, subfamily A, member 24165426365165460140Rat
11458448LOC108350878uncharacterized LOC1083508784165482667165484410Rat
1597384Magohbmago homolog B, exon junction complex subunit4165514584165522366Rat
1564211Styk1serine/threonine/tyrosine kinase 14165528027165543365Rat
621056Ybx3Y box binding protein 34165606819165630041Rat



QTLs in Region (Rnor_6.0)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
2316958Gluco58Glucose level QTL 5810blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)47850904182171018Rat
731165Uae21Urinary albumin excretion QTL 212.40.0001urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)4106347236151347236Rat
737821Hcar9Hepatocarcinoma resistance QTL 93.7liver integrity trait (VT:0010547)volume of individual liver tumorous lesion (CMO:0001078)4105971071168047091Rat
1298082Stresp4Stress response QTL 4blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)446898276145611886Rat
631556Bp135Blood pressure QTL 1350.017arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)479557856116916073Rat
631646Stl4Serum triglyceride level QTL 46.50.0001blood triglyceride amount (VT:0002644)plasma triglyceride level (CMO:0000548)473786419132455556Rat
631651Bp124Blood pressure QTL 1243arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)463938412108938412Rat
631662Hcar2Hepatocarcinoma resistance QTL 23.10.0003liver integrity trait (VT:0010547)volume of individual liver tumorous lesion (CMO:0001078)479555067124555067Rat
631674Iddm14Insulin dependent diabetes mellitus QTL 14blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)463537179157286626Rat
631683Bp116Blood pressure QTL 1160.0001arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)4123111827168111827Rat
631689Scl4Serum cholesterol level QTL 41.90.008blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)494414208139414208Rat
737978Pia23Pristane induced arthritis QTL 235.3joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)4131532269168047091Rat
2317587Eae26Experimental allergic encephalomyelitis QTL 26nervous system integrity trait (VT:0010566)experimental autoimmune encephalomyelitis severity score (CMO:0001419)48977755299067150Rat
2317588Eae27Experimental allergic encephalomyelitis QTL 27nervous system integrity trait (VT:0010566)percentage of study population developing experimental autoimmune encephalomyelitis during a period of time (CMO:0001047)499066972110635449Rat
6478718Anxrr34Anxiety related response QTL 340.00896locomotor behavior trait (VT:0001392)amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)4145547014184226339Rat
6478720Alc23Alcohol consumption QTL 230.00509drinking behavior trait (VT:0001422)ethanol drink intake rate to body weight ratio (CMO:0001616)4155386197184226339Rat
6478728Anxrr36Anxiety related response QTL 360.01061locomotor behavior trait (VT:0001392)amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)4155386197184226339Rat
6478733Anxrr37Anxiety related response QTL 370.00095locomotor behavior trait (VT:0001392)amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)4155386197184226339Rat
6478737Anxrr38Anxiety related response QTL 380.00159locomotor behavior trait (VT:0001392)amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)4155386197184226339Rat
6478743Anxrr40Anxiety related response QTL 400.83076defecation behavior trait (VT:0010462)defecation rate (CMO:0000998)463812687108812687Rat
6478748Anxrr42Anxiety related response QTL 420.28008locomotor behavior trait (VT:0001392)amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)4145547014184226339Rat
6478754Anxrr43Anxiety related response QTL 430.14035locomotor behavior trait (VT:0001392)distance moved per unit of time into, out of or within a discrete space in an experimental apparatus (CMO:0001493)4145547014184226339Rat
6478757Anxrr44Anxiety related response QTL 440.01087locomotor behavior trait (VT:0001392)amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)4155386197184226339Rat
6478760Anxrr45Anxiety related response QTL 450.06717locomotor behavior trait (VT:0001392)amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)4110702761155702761Rat
6478763Anxrr46Anxiety related response QTL 460.07428locomotor behavior trait (VT:0001392)amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)4110702761155702761Rat
6478772Anxrr49Anxiety related response QTL 490.15488defecation behavior trait (VT:0010462)defecation rate (CMO:0000998)463812687108812687Rat
6478778Anxrr51Anxiety related response QTL 510.25384locomotor behavior trait (VT:0001392)measurement of voluntary locomotion into, out of or within a discrete space in an experimental apparatus (CMO:0000957)4123587009168587009Rat
6893678Bw108Body weight QTL 1082.60.006body mass (VT:0001259)body weight (CMO:0000012)44241577787415777Rat
1298524Oia8Oil induced arthritis QTL 8joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)4136351734174694858Rat
731178Oia7Oil induced arthritis QTL 70.0001joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)4155657051156945571Rat
738009Sach4Saccharine consumption QTL 44.90.000016consumption behavior trait (VT:0002069)saccharin intake volume to total fluid intake volume ratio (CMO:0001601)458640017154427984Rat
738015Pia9Pristane induced arthritis QTL 94.50.048joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)476567036121567036Rat
738016Alc16Alcohol consumption QTL 163.60.00015consumption behavior trait (VT:0002069)ethanol drink intake rate to body weight ratio (CMO:0001616)458640017154427984Rat
6478782Anxrr52Anxiety related response QTL 520.02091locomotor behavior trait (VT:0001392)amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)4155386197184226339Rat
6478785Anxrr53Anxiety related response QTL 530.01397locomotor behavior trait (VT:0001392)amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)4155386197184226339Rat
6478693Anxrr32Anxiety related response QTL 320.00092locomotor behavior trait (VT:0001392)measurement of voluntary locomotion into, out of or within a discrete space in an experimental apparatus (CMO:0000957)4145547014184226339Rat
6478700Anxrr33Anxiety related response QTL 330.00896locomotor behavior trait (VT:0001392)amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)4145547014184226339Rat
738031Alc14Alcohol consumption QTL 147.60.00003consumption behavior trait (VT:0002069)ethanol drink intake rate to body weight ratio (CMO:0001616)458640017154427984Rat
631511Pia7Pristane induced arthritis QTL 74.3joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)4131532269168047091Rat
631546Bp86Blood pressure QTL 863.2arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)45579156492484312Rat
634334Xhs3X-ray hypersensitivity QTL 310intestine integrity trait (VT:0010554)post-insult time to onset of moribundity (CMO:0001896)485794049129615056Rat
634342Cia24Collagen induced arthritis QTL 244.5joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)4145373934176509907Rat
634344Hcar7Hepatocarcinoma resistance QTL 77.8liver integrity trait (VT:0010547)liver tumorous lesion area to total liver area ratio (CMO:0001075)471476518116476518Rat
634344Hcar7Hepatocarcinoma resistance QTL 77.8liver integrity trait (VT:0010547)liver tumorous lesion number (CMO:0001068)471476518116476518Rat
634347Hcar8Hepatocarcinoma resistance QTL 85.8liver integrity trait (VT:0010547)liver tumorous lesion area to total liver area ratio (CMO:0001075)4123478354168478354Rat
7411558Bw133Body weight QTL 13313.840.001body mass (VT:0001259)body weight gain (CMO:0000420)4124442168169442168Rat
8662350Eae35Experimental allergic encephalomyelitis QTL 356.2blood tumor necrosis factor amount (VT:0008552)inflammatory exudate tumor necrosis factor level (CMO:0001435)49850016499633958Rat
7207480Bss105Bone structure and strength QTL 1058.1femur strength trait (VT:0010010)femur midshaft polar moment of inertia (CMO:0001669)4109636356154636356Rat
1300109Rf13Renal function QTL 133.91renal blood flow trait (VT:2000006)absolute change in renal blood flow rate (CMO:0001168)4157423126184226339Rat
1300116Hrtrt5Heart rate QTL 53.76heart pumping trait (VT:2000009)heart rate (CMO:0000002)4115372758150038284Rat
1300139Hrtrt6Heart rate QTL 62.85heart pumping trait (VT:2000009)heart rate (CMO:0000002)437703272115372927Rat
1358352Srcrt3Stress Responsive Cort QTL 32.29blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)436615599145611886Rat
1358363Sradr3Stress Responsive Adrenal Weight QTL 36.19adrenal gland mass (VT:0010420)both adrenal glands wet weight (CMO:0000164)458166424103166424Rat
1358364Sradr4Stress Responsive Adrenal Weight QTL 44.92adrenal gland mass (VT:0010420)both adrenal glands wet weight (CMO:0000164)4128602727173602727Rat
1331738Bp209Blood pressure QTL 2092.979arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)4136351734180689124Rat
10053718Scort25Serum corticosterone level QTL 252.150.0097blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)4156855449184226339Rat
1331802Srn5Serum renin concentration QTL 53.045renin activity (VT:0005581)plasma renin activity level (CMO:0000116)4116726724157291438Rat
1354612Foco1Food consumption QTL 18.87eating behavior trait (VT:0001431)food intake rate (CMO:0000427)443414792146942075Rat
1354660Salc1Saline consumption QTL 111.26drinking behavior trait (VT:0001422)saline drink intake rate (CMO:0001627)443414792146942075Rat
1558651Swd3Spike wave discharge measurement QTL 34.620.000024brain electrophysiology trait (VT:0010557)brain spike-and-wave discharge frequency (CMO:0001742)45710107792990863Rat
1358202Gluco11Glucose level QTL 112.40.02adipocyte glucose uptake trait (VT:0004185)absolute change in adipocyte glucose uptake (CMO:0000873)486438317168047091Rat
1549827Scl46Serum cholesterol level QTL 463.5blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)4131864442176864442Rat
1549832Bss3Bone structure and strength QTL 311femur morphology trait (VT:0000559)femur midshaft cortical cross-sectional area (CMO:0001663)4109636356154636356Rat
1578657Bss12Bone structure and strength QTL 128.9femur morphology trait (VT:0000559)femoral neck cross-sectional area (CMO:0001697)456092756101092756Rat
1578658Bss13Bone structure and strength QTL 138femur strength trait (VT:0010010)femoral neck polar moment of inertia (CMO:0001670)456092756101092756Rat
1582232Gluco25Glucose level QTL 253.60.0023blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)486312589146942261Rat
1641919Alc22Alcohol consumption QTL 220.0005drinking behavior trait (VT:0001422)ethanol drink intake rate (CMO:0001407)462947687125671711Rat
1581566Eae21Experimental allergic encephalomyelitis QTL 216.2body mass (VT:0001259)maximum body weight loss to initial body weight ratio (CMO:0001400)4157399119158564471Rat
1581574Eae20Experimental allergic encephalomyelitis QTL 207.8nervous system integrity trait (VT:0010566)percentage of study population developing experimental autoimmune encephalomyelitis during a period of time (CMO:0001047)4152482121158564471Rat
1576305Emca6Estrogen-induced mammary cancer QTL 65.8mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)443414605155469929Rat
1576316Ept5Estrogen-induced pituitary tumorigenesis QTL 53.8pituitary gland mass (VT:0010496)pituitary gland wet weight (CMO:0000853)484475257178931073Rat
1641833Alc21Alcohol consumption QTL 218.60.0001drinking behavior trait (VT:0001422)ethanol drink intake rate (CMO:0001407)455375865125671711Rat
1578662Bss15Bone structure and strength QTL 1519.6femur width (VT:1000666)femoral neck width (CMO:0001695)487136446132136446Rat
1578670Bss14Bone structure and strength QTL 1416.4femur morphology trait (VT:0000559)bone trabecular cross-sectional area (CMO:0002311)487136446132136446Rat
1578674Bmd12Bone mineral density QTL 123.8femur mineral mass (VT:0010011)cortical volumetric bone mineral density (CMO:0001730)4137171018182171018Rat
61330Eau1Experimental allergic uveoretinitis QTL 10.0003uvea integrity trait (VT:0010551)experimental autoimmune uveitis score (CMO:0001504)470773471132455556Rat
61362Oia2Oil induced arthritis QTL 20.001joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)4136351734174694858Rat
61364Iddm2Insulin dependent diabetes mellitus QTL 2blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)47956245198542106Rat
61406Scwia1Streptococcal cell wall induced arthritis QTL 12.3joint integrity trait (VT:0010548)experimental arthritis severity measurement (CMO:0001459)4105682594150682594Rat
61418Pia5Pristane induced arthritis QTL 54.5joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)461038901127777403Rat
61422Cia13Collagen induced arthritis QTL 134.5joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)4132455408168047091Rat
61434Cia3Collagen induced arthritis QTL 34.8joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)499066823144066823Rat
70177Xhs1X-ray hypersensitivity QTL 125.1intestine integrity trait (VT:0010554)post-insult time to onset of moribundity (CMO:0001896)481959983152055009Rat
70200Alc18Alcohol consumption QTL 189.2drinking behavior trait (VT:0001422)ethanol intake volume to total fluid intake volume ratio (CMO:0001591)455324953148360954Rat
631261Tcas3Tongue tumor susceptibility QTL 36.88tongue integrity trait (VT:0010553)number of squamous cell tumors of the tongue with diameter greater than 3 mm (CMO:0001950)4734240492484039Rat
61446Coreg2Compensatory renal growth QTL 23.5kidney mass (VT:0002707)compensatory renal growth score (CMO:0001894)4147274055157294090Rat
61476Aia3Adjuvant induced arthritis QTL 33.9joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)486532519131532519Rat
724522Bp146Blood pressure QTL 1462.20.0021arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)475258970120258970Rat
724558Plsm2Polydactyly-luxate syndrome (PLS) morphotypes QTL 20.0003hindlimb integrity trait (VT:0010563)hind foot phalanges count (CMO:0001949)4131834282176834282Rat
2293840Kiddil9Kidney dilation QTL 92.9kidney pelvis morphology trait (VT:0004194)hydronephrosis severity score (CMO:0001208)4120400597146942261Rat
2302049Pia32Pristane induced arthritis QTL 325.10.001blood autoantibody amount (VT:0003725)serum immunoglobulin G-type rheumatoid factor level relative to an arbitrary reference serum (CMO:0002112)4105277348150277348Rat
2302051Pia28Pristane induced arthritis QTL 285.30.001blood autoantibody amount (VT:0003725)serum immunoglobulin G-type rheumatoid factor level relative to an arbitrary reference serum (CMO:0002112)475258970120258970Rat
2306899Bp338Blood pressure QTL 3380.071arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)481874073119546974Rat
2312569Pur19Proteinuria QTL 193.40.001total urine protein amount (VT:0000032)urine total protein excretion rate (CMO:0000756)46598924397759057Rat
2303623Vencon2Ventilatory control QTL 23.8respiration trait (VT:0001943)minute ventilation (VE) (CMO:0000132)4134917642179917642Rat
2306794Ean2Experimental allergic neuritis QTL 26.4nervous system integrity trait (VT:0010566)IFNG-secreting splenocyte count (CMO:0002122)48447525797479149Rat
1357342Bw40Body weight QTL 400.001body mass (VT:0001259)body weight (CMO:0000012)477307388116916073Rat
70167Bw22Body weight QTL 223.1body mass (VT:0001259)body weight (CMO:0000012)477307388116916073Rat
12798523Anxrr56Anxiety related response QTL 562.830.05locomotor behavior trait (VT:0001392)amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)486312589147702403Rat
724535Cm18Cardiac mass QTL 182.6heart mass (VT:0007028)calculated heart weight (CMO:0000073)4117926139162926139Rat
1549843Bw53Body weight QTL 530.0001body mass (VT:0001259)body weight gain (CMO:0000420)46043912799066957Rat
2312567Glom19Glomerulus QTL 191.90.006kidney glomerulus morphology trait (VT:0005325)index of glomerular damage (CMO:0001135)449906054145611886Rat
10755501Bp390Blood pressure QTL 3902.5arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)423850384169318094Rat
7394826Bw126Body weight QTL 1260.002body mass (VT:0001259)body weight gain (CMO:0000420)46170810388565113Rat
61451Ciaa4CIA Autoantibody QTL 43.1blood autoantibody amount (VT:0003725)calculated serum anti-rat type 2 collagen autoantibody titer (CMO:0001281)4125884464168047091Rat
1582237Kidm34Kidney mass QTL 3440.0001kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)4146942075168998263Rat
1331759Hrtrt13Heart rate QTL 133.54628heart pumping trait (VT:2000009)heart rate (CMO:0000002)4108876717169215811Rat
70192BpQTLcluster5Blood pressure QTL cluster 54.183arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)461708341113100992Rat
70192BpQTLcluster5Blood pressure QTL cluster 54.183arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)461708341113100992Rat
70192BpQTLcluster5Blood pressure QTL cluster 54.183arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)461708341113100992Rat
70192BpQTLcluster5Blood pressure QTL cluster 54.183arterial blood pressure trait (VT:2000000)percent change in mean arterial blood pressure (CMO:0002035)461708341113100992Rat
70192BpQTLcluster5Blood pressure QTL cluster 54.183arterial blood pressure trait (VT:2000000)percent change in systolic blood pressure (CMO:0000747)461708341113100992Rat
70192BpQTLcluster5Blood pressure QTL cluster 54.183arterial blood pressure trait (VT:2000000)absolute change in pulse pressure (CMO:0001882)461708341113100992Rat
70192BpQTLcluster5Blood pressure QTL cluster 54.183arterial blood pressure trait (VT:2000000)absolute change in mean arterial blood pressure (CMO:0000533)461708341113100992Rat
634335Anxrr16Anxiety related response QTL 167.22locomotor behavior trait (VT:0001392)number of entries into a discrete space in an experimental apparatus (CMO:0000960)494893247168046938Rat
70201Gcr1Gastric cancer resistance QTL 12.7stomach morphology trait (VT:0000470)stomach tumor susceptibility score (CMO:0002043)4119705414146087100Rat
2303168Bp330Blood pressure QTL 3304.250.017arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)43043231145254791Rat
10401796Kidm48Kidney mass QTL 48kidney mass (VT:0002707)both kidneys wet weight (CMO:0000085)4146497452184226339Rat
8655961Kidm43Kidney mass QTL 4318kidney mass (VT:0002707)both kidneys wet weight (CMO:0000085)43427793299067150Rat
6478684Anxrr30Anxiety related response QTL 300.00087defecation behavior trait (VT:0010462)defecation rate (CMO:0000998)463812687108812687Rat
12798527Anxrr58Anxiety related response QTL 584.110.05locomotor behavior trait (VT:0001392)distance moved per unit of time into, out of or within a discrete space in an experimental apparatus (CMO:0001493)4120318422146087100Rat
1549839Bw52Body weight QTL 520.0001body mass (VT:0001259)body weight gain (CMO:0000420)460439127113416139Rat
12798525Anxrr57Anxiety related response QTL 573.210.05locomotor behavior trait (VT:0001392)amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)4146086918168047091Rat
2300179Bmd50Bone mineral density QTL 505.90.0001femur mineral mass (VT:0010011)volumetric bone mineral density (CMO:0001553)461975371106975371Rat
12798520Anxrr55Anxiety related response QTL 554.450.01locomotor behavior trait (VT:0001392)number of rearing movements with lid-pushing in an experimental apparatus (CMO:0002715)429549895112807890Rat
12798519Anxrr54Anxiety related response QTL 542.540.05locomotor behavior trait (VT:0001392)distance moved per unit of time into, out of or within a discrete space in an experimental apparatus (CMO:0001493)4112807675157807675Rat
2293659Bmd35Bone mineral density QTL 354.50.0001femur strength trait (VT:0010010)femoral neck ultimate force (CMO:0001703)4136908430182878540Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 83807 UniSTS
UniSTS 219028 UniSTS