RH134666 Marker Search Result - Rat Genome Database
Submit Data |  Help |  Video Tutorials |  News |  Publications |  FTP Download |  REST API |  Citing RGD |  Contact   
Search RGD Grant Resources Citing RGD About Us Contact Us
Genes QTLs Strains Markers Genome Information Ontologies Cell Lines References FTP Download Submit Data
OntoMate (Literature Search) JBrowse (Genome Browser) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) RatMine GViewer (Genome Viewer) Overgo Probe Designer ACP Haplotyper Genome Scanner
Aging & Age-Related Disease Cancer Cardiovascular Disease COVID-19 Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease
Find Models   new Genetic Models Autism Models PhenoMiner (Quantitative Phenotypes) Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes GERRC (Gene Editing Rat Resource Center) Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive
Pathways
Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Poster Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources

Marker: RH134666

Symbol: RH134666
Also known as:
RGD ID: 5032617
Expected Size: 213 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
Rnor_6.01134,764,797 - 34,765,009NCBIRnor6.0
Rnor_6.0315,968,500 - 15,968,712NCBIRnor6.0
Rnor_5.01138,356,026 - 38,356,238UniSTSRnor5.0
Rnor_5.0321,270,085 - 21,270,297UniSTSRnor5.0
RGSC_v3.4315,866,669 - 15,866,881UniSTSRGSC3.4
Celera1134,636,004 - 34,636,216UniSTS
Celera314,695,293 - 14,695,505UniSTS
Cytogenetic Map11q11UniSTS
Is Marker For: Genes:   Vps26c   LOC100910450  


Annotation


References - curated
1. RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer ATTATGGCCCACACTTTGGGTA
Reverse Primer ACAAAGCAGGTCCTGACTGACA
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
1306879Vps26cVPS26 endosomal protein sorting factor C113476405334792446Rat



QTLs in Region (Rnor_6.0)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
631679Cm10Cardiac mass QTL 107.340.0001heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)3125786001Rat
70202Alc19Alcohol consumption QTL 192.5drinking behavior trait (VT:0001422)ethanol intake volume to total fluid intake volume ratio (CMO:0001591)3128136884Rat
631545Bp85Blood pressure QTL 853.1arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)3128500807Rat
61468Bp15Blood pressure QTL 154.4blood pressure trait (VT:0000183)diastolic blood pressure (CMO:0000005)3128500807Rat
61468Bp15Blood pressure QTL 154.4blood pressure trait (VT:0000183)systolic blood pressure (CMO:0000004)3128500807Rat
61468Bp15Blood pressure QTL 154.4blood pressure trait (VT:0000183)pulse pressure (CMO:0000292)3128500807Rat
631831Alc8Alcohol consumption QTL 82.7consumption behavior trait (VT:0002069)calculated ethanol drink intake rate (CMO:0001615)3132972944Rat
4889966Bss95Bone structure and strength QTL 954.4tibia area (VT:1000281)tibia-fibula cross-sectional area (CMO:0001718)3137891710Rat
2312664Scl62Serum cholesterol level QTL 620.05blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)3139773425Rat
2290452Scl56Serum cholesterol level QTL 562.26blood cholesterol amount (VT:0000180)plasma total cholesterol level (CMO:0000585)3195176874Rat
1298526Arunc3Aerobic running capacity QTL 32.2exercise endurance trait (VT:0002332)maximum distance run on treadmill (CMO:0001406)3263142133477544Rat
10401810Kidm53Kidney mass QTL 53kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)3263142148562146Rat
70203Gcr2Gastric cancer resistance QTL 22.6stomach morphology trait (VT:0000470)stomach tumor susceptibility score (CMO:0002043)3328592928136884Rat
1358357Srcrtb1Stress Responsive Cort Basal QTL 16.360.002blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)3328592928136884Rat
8693641Alc30Alcohol consumption QTL 3020.739drinking behavior trait (VT:0001422)calculated ethanol drink intake rate (CMO:0001615)3565463925105730Rat
1558654Bw56Body weight QTL 564.50.0000171body mass (VT:0001259)body weight (CMO:0000012)3600074834394365Rat
6893355Bw101Body weight QTL 1010.40.38body mass (VT:0001259)body weight (CMO:0000012)3600074834394365Rat
6893363Bw105Body weight QTL 1052.60.0036body mass (VT:0001259)body weight (CMO:0000012)3600074834394365Rat
70191BpQTLcluster4Blood pressure QTL cluster 43arterial blood pressure trait (VT:2000000)absolute change in mean arterial blood pressure (CMO:0000533)3600074851687917Rat
70191BpQTLcluster4Blood pressure QTL cluster 43arterial blood pressure trait (VT:2000000)absolute change in systolic blood pressure (CMO:0000607)3600074851687917Rat
1558647Cm46Cardiac mass QTL 465.40.0000055heart mass (VT:0007028)heart wet weight (CMO:0000069)3600086634394121Rat
1558650Cm48Cardiac mass QTL 4840.0001heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)3600086634394121Rat
1558657Cm43Cardiac mass QTL 436.60.0000000293heart mass (VT:0007028)heart wet weight (CMO:0000069)3600086634394121Rat
1358905Hrtrt17Heart rate QTL 175.90.000014heart pumping trait (VT:2000009)heart rate (CMO:0000002)31009408193415837Rat
2298542Neuinf11Neuroinflammation QTL 113.9nervous system integrity trait (VT:0010566)spinal cord complement component 1, q subcomponent, B chain mRNA level (CMO:0002126)31011931879772001Rat
1358885Bp251Blood pressure QTL 2513.8arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)310639528127023997Rat
1358888Bp264Blood pressure QTL 2644.43arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)310639528127023997Rat
634306Bp140Blood pressure QTL 1403.30.0013arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)31312691436600143Rat
634306Bp140Blood pressure QTL 1403.30.0013arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)31312691436600143Rat
634306Bp140Blood pressure QTL 1403.30.0013arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)31312691436600143Rat
634306Bp140Blood pressure QTL 1403.30.0013arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)31312691436600143Rat
634306Bp140Blood pressure QTL 1403.30.0013arterial blood pressure trait (VT:2000000)heart rate (CMO:0000002)31312691436600143Rat
634306Bp140Blood pressure QTL 1403.30.0013arterial blood pressure trait (VT:2000000)heart rate (CMO:0000002)31312691436600143Rat
634306Bp140Blood pressure QTL 1403.30.0013arterial blood pressure trait (VT:2000000)body weight (CMO:0000012)31312691436600143Rat
634306Bp140Blood pressure QTL 1403.30.0013arterial blood pressure trait (VT:2000000)body weight (CMO:0000012)31312691436600143Rat
631568Bp92Blood pressure QTL 922.20.005arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)31312691441510346Rat
2325840Bp345Blood pressure QTL 3450.001arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)31409041129084626Rat
731172Bp151Blood pressure QTL 1510.04arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)31409041148562146Rat
12879849Bw180Body weight QTL 1800.037body mass (VT:0001259)body weight (CMO:0000012)31409041148562146Rat
12879850Cm91Cardiac mass QTL 910.001heart mass (VT:0007028)heart wet weight to body weight ratio (CMO:0002408)31409041148562146Rat
12879851Cm92Cardiac mass QTL 920.001heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)31409041148562146Rat
12879852Cm93Cardiac mass QTL 930.001heart right ventricle mass (VT:0007033)heart right ventricle weight to body weight ratio (CMO:0000914)31409041148562146Rat
12879853Am5Aortic mass QTL 50.001aorta mass (VT:0002845)aorta weight to aorta length to body weight ratio (CMO:0002722)31409041148562146Rat
12879854Kidm63Kidney mass QTL 630.001kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)31409041148562146Rat
1300147Bp187Blood pressure QTL 1873.67arterial blood pressure trait (VT:2000000)blood pressure time series experimental set point of the baroreceptor response (CMO:0002593)11172720192Rat
1558659Tescar1Testicular tumor resistance QTL 13.9testis integrity trait (VT:0010572)percentage of study population developing testis tumors during a period of time (CMO:0001261)1132503169342559Rat
1641927Alcrsp10Alcohol response QTL 10alcohol metabolism trait (VT:0015089)blood ethanol level (CMO:0000535)11935127454351274Rat
2290451Scl58Serum cholesterol level QTL 583.48blood cholesterol amount (VT:0000180)plasma total cholesterol level (CMO:0000585)111136730644444347Rat
724517Uae18Urinary albumin excretion QTL 183.7urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)111632197346583360Rat
724554Iddm17Insulin dependent diabetes mellitus QTL 170.001blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)111901627290463843Rat
10755497Bp388Blood pressure QTL 3882.76arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)111947517979734728Rat
1598811Bp291Blood pressure QTL 2911.9arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)112194422966944229Rat
1598841Memor7Memory QTL 7exploratory behavior trait (VT:0010471)total horizontal distance resulting from voluntary locomotion in an experimental apparatus (CMO:0001443)112194422966944229Rat
634341Bw121Body weight QTL 1213.56abdominal fat pad mass (VT:1000711)abdominal fat pad weight (CMO:0000088)112204314944444112Rat
10058952Gmadr6Adrenal mass QTL 62.290.0072adrenal gland mass (VT:0010420)both adrenal glands wet weight to body weight ratio (CMO:0002411)112540112970401129Rat
9590313Scort20Serum corticosterone level QTL 206.510.001blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)112572003870720038Rat
9589032Epfw10Epididymal fat weight QTL 109.290.001epididymal fat pad mass (VT:0010421)epididymal fat pad weight to body weight ratio (CMO:0000658)112572003870720038Rat
8694376Bw156Body weight QTL 1562.250.001body lean mass (VT:0010483)lean tissue morphological measurement (CMO:0002184)112572003870720038Rat
8694424Bw162Body weight QTL 1623.80.001body lean mass (VT:0010483)lean tissue morphological measurement (CMO:0002184)112572003870720038Rat
724563Uae10Urinary albumin excretion QTL 106urine albumin amount (VT:0002871)urine albumin level (CMO:0000130)112831466586994795Rat
1300130Rf20Renal function QTL 204.44kidney glomerulus integrity trait (VT:0010546)kidney glomerulus diameter (CMO:0001166)113043533963186373Rat
1300110Stl7Serum triglyceride level QTL 74.64blood triglyceride amount (VT:0002644)plasma triglyceride level (CMO:0000548)113043533986714631Rat
2298551Neuinf10Neuroinflammation QTL 103.7nervous system integrity trait (VT:0010566)spinal cord beta-2 microglobulin mRNA level (CMO:0002125)113215552082443118Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 100910450 UniSTS
  360703 UniSTS
UniSTS 217945 UniSTS