D13Ertd614e Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: D13Ertd614e

Symbol: D13Ertd614e
Also known as:
RGD ID: 5032469
Expected Size: 227 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.24137,093,946 - 137,094,173 (+)MAPPERmRatBN7.2
mRatBN7.2410,607,331 - 10,607,558 (-)MAPPERmRatBN7.2
mRatBN7.24137,093,946 - 137,094,173 (-)MAPPERmRatBN7.2
mRatBN7.2410,607,331 - 10,607,558 (+)MAPPERmRatBN7.2
Rnor_6.047,135,332 - 7,135,558NCBIRnor6.0
Rnor_6.04136,226,847 - 136,227,073NCBIRnor6.0
Rnor_5.047,147,849 - 7,148,075UniSTSRnor5.0
Rnor_5.04200,700,304 - 200,700,530UniSTSRnor5.0
RGSC_v3.445,986,794 - 5,987,020UniSTSRGSC3.4
RGSC_v3.44139,793,998 - 139,794,224UniSTSRGSC3.4
Celera46,223,283 - 6,223,509UniSTS
Cytogenetic Map4q41UniSTS
Cytogenetic Map4q11UniSTS
Is Marker For: Genes:   Abcf2   RGD1563492   LOC500277  


Annotation


References - curated
1. RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer CATAGATCTACACTGTTAAATAATTAT
Reverse Primer GTTACCTTGCCCTGAAAG
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
1304942Abcf2ATP binding cassette subfamily F member 241059480210607606Rat
1564789Iqca1lIQ motif containing with AAA domain 1 like41061667710628300Rat
1562922Asb10ankyrin repeat and SOCS box-containing 1041063031810644270Rat
621864Gbx1gastrulation brain homeobox 141064595710672486Rat
1310751Agap3ArfGAP with GTPase domain, ankyrin repeat and PH domain 341067406410724848Rat
735120Tmub1transmembrane and ubiquitin-like domain containing 141072949410732060Rat
1311601FastkFas-activated serine/threonine kinase41073227310736332Rat
3711Slc4a2solute carrier family 4 member 241073641910754407Rat
70514Cdk5cyclin-dependent kinase 541075468210760110Rat
708578Asic3acid sensing ion channel subunit 341076050910764987Rat
1307655Abcb8ATP binding cassette subfamily B member 841076620610783598Rat
1560887Atg9bautophagy related 9B41078493410793832Rat
40958365LOC120102208uncharacterized LOC12010220841078763010789628Rat
3186Nos3nitric oxide synthase 341079383410814170Rat
621414Kcnh2potassium voltage-gated channel subfamily H member 241082683410859009Rat
11470826LOC108350647uncharacterized LOC10835064741091070610925138Rat
7679531LOC102554730uncharacterized LOC10255473041091702110923618Rat
1560934Nupl2nucleoporin like 241098555411002591Rat
1305564Klhl7kelch-like family member 741100636611055399Rat
1562906Fam126afamily with sequence similarity 126, member A41113222411239120Rat
41185982LOC120102209SUMO-conjugating enzyme UBC9-like41116255311163825Rat
40988581LOC120102210uncharacterized LOC12010221041117714311207140Rat
7653780LOC102555004uncharacterized LOC10255500441126005011268070Rat
6502346LOC100909675uncharacterized LOC10090967541128760511291820Rat
41215821LOC120102742small nucleolar RNA SNORD9341129011611290186Rat
1591393Tomm7translocase of outer mitochondrial membrane 741130512211311963Rat
1560433Rint1RAD50 interactor 141131941611355773Rat
1307054Pus7pseudouridine synthase 741136016911401139Rat
41232405LOC120102743small nucleolar RNA SNORD9341143996711440037Rat
1305107Srpk2SRSF protein kinase 241146468411655993Rat
1309641Kmt2elysine methyltransferase 2E41165781111727373Rat
41106171LOC120102473uncharacterized LOC12010247341176510411771452Rat
40993653LOC120102618U7 small nuclear RNA41178827611788340Rat
2320473LOC100361290zinc finger, CCHC domain containing 10-like41182543311828119Rat
9159670LOC103692025uncharacterized LOC10369202541183620012379126Rat
9400372LOC103692026macrophage migration inhibitory factor pseudogene41196694511973092Rat
41244972LOC120102766U2 spliceosomal RNA41237540312375483Rat
40977562LOC120102619U7 small nuclear RNA41244095712441013Rat
41392212LOC120102614U7 small nuclear RNA41247725012477311Rat
1561088Orc5origin recognition complex, subunit 541254800712612611Rat
41354020LOC120102148uncharacterized LOC12010214841264090312643798Rat
41018004LOC120102692small nucleolar RNA SNORA1741272068412720803Rat
3553Relnreelin41273617713162956Rat
41142588LOC12010221140S ribosomal protein S2-like41290067712909075Rat
9334471LOC103692036transcription elongation factor B polypeptide 2 pseudogene41311186113117780Rat
7532340LOC102555727quinone oxidoreductase-like protein 1-like41319824313199451Rat
69334Slc26a5solute carrier family 26 member 541321026013249289Rat
3428Psmc2proteasome 26S subunit, ATPase 241325585113270102Rat
620524Dnajc2DnaJ heat shock protein family (Hsp40) member C241327023913297438Rat
41053492LOC120102645small nucleolar RNA SNORA4841328075513280901Rat
621297Pmpcbpeptidase, mitochondrial processing subunit beta41329758313310363Rat
1587329LOC362306hypothetical LOC36230641332548013328608Rat
735197NapepldN-acyl phosphatidylethanolamine phospholipase D41336053213398815Rat
1305915Armc10armadillo repeat containing 1041339900413414594Rat
1642425Fbxl13F-box and leucine-rich repeat protein 1341341488013607079Rat
41107235LOC120102659small nucleolar RNA SNORA1741349698613497113Rat
1560165Lrrc17leucine rich repeat containing 1741350142813531845Rat
1562135Fam185afamily with sequence similarity 185, member A41354202213662967Rat
41018904LOC120102739small nucleolar RNA SNORD8641355582413555909Rat
1559535Ccdc146coiled-coil domain containing 14641366276613811619Rat
620170Fgl2fibrinogen-like 241371056613716207Rat
41335650LOC120102212uncharacterized LOC12010221241375544713761134Rat
1563271Gsapgamma-secretase activating protein41381304613907875Rat
41237841LOC120102457neuroepithelial cell-transforming gene 1 protein-like41395581813973331Rat
41193151LOC120102737small nucleolar RNA SNORA4041398103313981157Rat
7666239LOC102556034uncharacterized LOC10255603441401221314020864Rat
620894Ptpn12protein tyrosine phosphatase, non-receptor type 1241402099714092931Rat
41353109LOC120102213uncharacterized LOC12010221341410059914110132Rat
1308748Rsbn1lround spermatid basic protein 1-like41413807614203972Rat
9685233AptrAlu-mediated CDKN1A/p21 transcriptional regulator41413827514139577Rat
1308939Tmem60transmembrane protein 6041421002914214884Rat
1310593Phtf2putative homeodomain transcription factor 241421519014330513Rat
41146128LOC120102214translation initiation factor IF-2-like41421539514217004Rat
7714606LOC102556088uncharacterized LOC10255608841436851614382349Rat
621855Magi2membrane associated guanylate kinase, WW and PDZ domain containing 241438832215870036Rat
41061536LOC120102478uncharacterized LOC12010247841439387614398745Rat
40992258LOC120102477uncharacterized LOC12010247741458890314591674Rat
41096115LOC12010247460S ribosomal protein L28-like41481578414816098Rat
41012632LOC120102678small nucleolar RNA SNORA1741494878714948916Rat
11420335LOC108350830thymosin beta-10 pseudogene41529919815299866Rat
9417558LOC103692037lamin-B2-like41545728615601866Rat
41303880LOC120102604U6 spliceosomal RNA41558013915580245Rat
41216683NEWGENE_40926764transfer RNA proline (anticodon AGG)41570415715704231Rat
41135223LOC120102723U1 spliceosomal RNA41571845515718559Rat
41065937LOC120102475uncharacterized LOC12010247541580920515825962Rat
9148086LOC103692030uncharacterized LOC10369203041583559015851119Rat
41161253LOC120102476uncharacterized LOC12010247641584694315848437Rat
7681325LOC102547160uncharacterized LOC10254716041587049715898907Rat
2318988LOC100365492hypothetical LOC10036549241588530715888072Rat
41076500LOC120102698small nucleolar RNA SNORA1741628895316289069Rat
6497775LOC100910631DNA-(apurinic or apyrimidinic site) lyase-like41644519516446152Rat
1588841LOC688447hypothetical protein LOC68844741674611716746660Rat
2713Gnai1G protein subunit alpha i141681394116898111Rat
727817Gnat3G protein subunit alpha transducin 341716250017212283Rat
41284761NEWGENE_40934091transfer RNA alanine (anticodon AGC)41719001717190091Rat
2301Cd36CD36 molecule41731734317410084Rat
1565355RGD1565355similar to fatty acid translocase/CD3641742474917465808Rat
41249586LOC120093085platelet glycoprotein 4-like41748783717514900Rat
1309343Sema3csemaphorin 3C41758321217747234Rat
41391017LOC120102215uncharacterized LOC12010221541768857917739337Rat
1563537RGD1563537similar to ribosomal protein S941782268017823238Rat
7549033LOC102551002uncharacterized LOC10255100241796565718047911Rat
41145508LOC120102685small nucleolar RNA SNORA1741807329818073422Rat
2322730LOC100360119dimethyladenosine transferase 1, mitochondrial-like41819251718200323Rat
41273869LOC120102458igE-binding protein-like41836860218404854Rat
7747752LOC102551166cadherin EGF LAG seven-pass G-type receptor 2-like41842787718525060Rat
2794Hgfhepatocyte growth factor41867373618745582Rat
9414363LOC103692033uncharacterized LOC10369203341874450218757594Rat
2247Cacna2d1calcium voltage-gated channel auxiliary subunit alpha2delta 141895061119374969Rat
2322535LOC100360215hypothetical LOC10036021541940646319432154Rat
40929882LOC120102654small nucleolar RNA SNORA4841944411319444260Rat
69406Pclopiccolo (presynaptic cytomatrix protein)41969143920050015Rat
11466909LOC108350655uncharacterized LOC10835065542023314320255059Rat
1310973Sema3esemaphorin 3E42029753420555287Rat
41344080LOC1201025525S ribosomal RNA42051960120519719Rat
7646743LOC102552661uncharacterized LOC10255266142062555220630241Rat
40969825LOC120102459NEDD4-binding protein 1-like42071351420714914Rat
41257705LOC120102460NEDD4-binding protein 1-like42074919220750556Rat
41285801LOC120102461NEDD4-binding protein 1-like42075642420757551Rat
41096301LOC120102462NEDD4-binding protein 1-like42076368920765077Rat
1584092LOC688874similar to NEDD4-binding protein 1 (N4BP1)42080623020807323Rat
40989850LOC120102149NEDD4-binding protein 1-like42081451720815902Rat
41113357LOC120102150NEDD4-binding protein 1-like42082177720823162Rat
1583001LOC688906similar to splicing factor, arginine/serine-rich 2, interacting protein42087234120886738Rat
41165648LOC120102463NEDD4-binding protein 1-like42088708520888188Rat
41240105LOC120102151NEDD4-binding protein 1-like42092961620931001Rat
41199734LOC120102216protein SCAF11-like42102395521027327Rat
7550011LOC102552749MLV-related proviral Env polyprotein-like42105194121053799Rat
41115840LOC120102217uncharacterized LOC12010221742115968721181773Rat
3657Sema3asemaphorin 3A42128239821754834Rat
41320971LOC120102218uncharacterized LOC12010221842209288522119273Rat
727939Sema3dsemaphorin 3D42231676922505930Rat
40955874LOC120102571U6 spliceosomal RNA42296828522968392Rat
41054814LOC120102464MLV-related proviral Env polyprotein-like42298847722990225Rat
41303418LOC120102627small nucleolar RNA SNORA3142308406723084203Rat
1561882LOC287992hypothetical LOC28799242345689423501158Rat
7624497LOC102553320uncharacterized LOC10255332042359296423661292Rat
1562636RGD1562636similar to protein phosphatase 1, regulatory (inhibitor) subunit 3B42376587423768883Rat
1564798RGD1564798similar to RIKEN cDNA 1300007B1242389715723898281Rat
6492128LOC10091160740S ribosomal protein S6-like42409335324096338Rat
9197484LOC103692044mitochondrial import inner membrane translocase subunit Tim8 A pseudogene42428942924289895Rat
2744Grm3glutamate metabotropic receptor 342436485424643972Rat
1563349Elapor2endosome-lysosome associated apoptosis and autophagy regulator family member 242461316324805729Rat
2325362Mir879microRNA 87942472445524724530Rat
11462374LOC108350658uncharacterized LOC10835065842477957124794265Rat
7536117LOC102555663uncharacterized LOC10255566342480591224807670Rat
70966Dmtf1cyclin D binding myb-like transcription factor 142490993724950786Rat
1562351Tmem243transmembrane protein 24342495079124968642Rat
41334218LOC120102603U6 spliceosomal RNA42495272424952824Rat
11367620LOC108350659uncharacterized LOC10835065942495687624966778Rat
41118809LOC120102219uncharacterized LOC12010221942499381825003812Rat
41212670LOC120102465eukaryotic translation initiation factor 3 subunit K-like42501206425012685Rat
70908Crotcarnitine O-octanoyltransferase42506827025133111Rat
620248Abcb4ATP binding cassette subfamily B member 442515099825209489Rat
41286244LOC120102221uncharacterized LOC12010222142517166925175960Rat
41047811LOC120102220uncharacterized protein C11orf98 homolog42517472725175091Rat
3318Abcb1bATP-binding cassette, subfamily B (MDR/TAP), member 1B42524276125325194Rat
41222673LOC120102222uncharacterized LOC12010222242524540025250299Rat
619951Abcb1aATP binding cassette subfamily B member 1A42535746725529941Rat
1587590Rundc3bRUN domain containing 3B42546254325599477Rat
1308774Slc25a40solute carrier family 25, member 4042562000725676422Rat
1305854Dbf4DBF4 zinc finger42567657025701152Rat
1585016Adam22ADAM metallopeptidase domain 2242571605525970932Rat
41165065NEWGENE_40926764transfer RNA proline (anticodon AGG)42578050525780585Rat
41303543LOC120102223uncharacterized LOC12010222342582169625835920Rat
1584485Srisorcin42597349325997879Rat
1560331Steap4STEAP4 metalloreductase42607718226099859Rat
41240640LOC120102760U2 spliceosomal RNA42637529726375438Rat
41340251LOC120102152ran-specific GTPase-activating protein-like42646895426472445Rat
1589640Zfp804bzinc finger protein 804B42660851027144717Rat
41129509LOC120102767U2 spliceosomal RNA42661716926617247Rat
41258698LOC120102775U4 spliceosomal RNA42661813426618285Rat
1564345Tex47testis expressed 4742664409826647393Rat
1589639LOC499995similar to CD2-associated protein42719800627200492Rat
7734714LOC102549955uncharacterized LOC10254995542721068227262917Rat
41114928LOC120102153RNA-binding protein EWS-like42752623327528198Rat
1589637LOC499997similar to Proteasome activator complex subunit 2 (Proteasome activator 28-beta subunit) (PA28beta) (PA28b) (Activator of multicatalytic protease subunit 2) (11S regulator complex beta subunit) (REG-beta)42772478627725601Rat
2323949LOC100362829proteasome subunit alpha type-2-like42783744727838144Rat
1561754RGD1561754similar to high mobility group protein homolog HMG442789164327892122Rat
41392109LOC120102745U1 spliceosomal RNA42794600627946166Rat
1311543Steap1STEAP family member 142827697228287484Rat
1307050Steap2STEAP2 metalloreductase42834776928368177Rat
41233092LOC120102224uncharacterized LOC12010222442837771928379631Rat
6496360Cfap69cilia and flagella associated protein 6942837960428452562Rat
41220038Fam237bfamily with sequence similarity 237 member B42845740228458728Rat
1305878Gtpbp10GTP binding protein 1042847685728494375Rat
1561053Cldn12claudin 1242852265928533647Rat
9118001Pttg1ip2PTTG1IP family member 242856106328585400Rat
11517003LOC108350663uncharacterized LOC10835066342856196828575524Rat
1305544Cdk14cyclin-dependent kinase 1442866668829258865Rat
40946680LOC12010244340S ribosomal protein S15a-like42882455328832585Rat
7573585LOC102549548uncharacterized LOC10254954842906776129096268Rat
41027801LOC120102734U1 spliceosomal RNA42915731229157442Rat
61916Fzd1frizzled class receptor 142931030329314701Rat
41019115LOC120102226uncharacterized LOC12010222642933283229340185Rat
41390098LOC120102572U6 spliceosomal RNA42944279329442899Rat
41107770LOC120102227uncharacterized LOC12010222742958142329591564Rat
2324789LOC100359664mitochondrial transcription termination factor-like42988661129887781Rat
2323518LOC100359722mitochondrial transcription termination factor-like42991257629913741Rat
11390963LOC108351144uncharacterized LOC10835114442992256529975375Rat
9319274LOC103692071disks large homolog 5-like42997932029986368Rat
2481Cyp51cytochrome P450, family 5143003695630055410Rat
620833Akap9A-kinase anchoring protein 943005673830192716Rat
621318Mterf1mitochondrial transcription termination factor 143022634530233402Rat
1562785Lrrd1leucine-rich repeats and death domain containing 143026314730293119Rat
1305929Krit1KRIT1, ankyrin repeat containing43029920330333366Rat
1597088Ankib1ankyrin repeat and IBR domain containing 143033367830457781Rat
40945863LOC12010222860S ribosomal protein L7-like43038981130390201Rat
7727723LOC102550083dead end protein homolog 1-like43041499030418462Rat
1306626Tmbim7transmembrane BAX inhibitor motif containing 743046665130499565Rat
1562004Gatad1GATA zinc finger domain containing 143050753030519109Rat
1559939Pex1peroxisomal biogenesis factor 143051995030558953Rat
1310794Rbm48RNA binding motif protein 4843055906330569409Rat
1588445LOC500007similar to EF hand calcium binding domain 143056904530589503Rat
1306302Fam133bfamily with sequence similarity 133, member B43058964630616291Rat
621121Cdk6cyclin-dependent kinase 643063765030829688Rat
41033620LOC120102229uncharacterized LOC12010222943082950730936497Rat
11356515LOC108350668uncharacterized LOC10835066843090631330909925Rat
1562992RGD1562992similar to heterogeneous nuclear ribonucleoprotein A2/B143093491530936057Rat
1560872RGD1560872similar to interferon induced transmembrane protein 2 (1-8D)43096084530961278Rat
1565361RGD1565361similar to male-enhanced antigen-243108092331085695Rat
6494620LOC100911141zinc finger CCCH-type antiviral protein 1-like43108849231090178Rat
2323113LOC100359932hypothetical LOC10035993243114616431148432Rat
1563091Samd9sterile alpha motif domain containing 943116463931184325Rat
7747029LOC102553788uncharacterized LOC10255378843120032731216722Rat
9213284LOC103692066sterile alpha motif domain-containing protein 9-like43126795031333461Rat
41041657LOC120102230sterile alpha motif domain-containing protein 9-like43132004031333472Rat
1562531Samd9lsterile alpha motif domain containing 9-like43136205431376412Rat
1305697Hepacam2HEPACAM family member 243144619531480859Rat
1304751Vps50VPS50 subunit of EARP/GARPII complex43148442431585617Rat
621001Calcrcalcitonin receptor43166127031736392Rat
2314881Mir653microRNA 65343169271431692810Rat
2314886Mir489microRNA 48943169335531693460Rat
628629Tfpi2tissue factor pathway inhibitor 243198178631986707Rat
1595475Gngt1G protein subunit gamma transducin 143200626732009252Rat
621515Gng11G protein subunit gamma 1143202300332028443Rat
11407309LOC108350669uncharacterized LOC10835066943205605032112584Rat
2203Bet1Bet1 golgi vesicular membrane trafficking protein43211623232126592Rat
7661902LOC102557375uncharacterized LOC10255737543245489832457445Rat
1561836Scand3-ps2SCAN domain containing 3, pseudogene 243251175332512295Rat
621351Col1a2collagen type I alpha 2 chain43256393832598868Rat
7572472LOC102552043uncharacterized LOC10255204343264282332644911Rat
1596912Casd1CAS1 domain containing 143265888832739224Rat
1303201Sgcesarcoglycan, epsilon43277147732842238Rat
1595574Peg10paternally expressed 1043284239432855641Rat
40975034LOC120102559U4 spliceosomal RNA43292226032922342Rat
1559912RGD1559912similar to cytoskeleton associated protein 243295899232961061Rat
632280Ppp1r9aprotein phosphatase 1, regulatory subunit 9A43297050133292360Rat
620062Pon1paraoxonase 143329473733325759Rat
1302965Pon3paraoxonase 343335698333383681Rat
1309954Pon2paraoxonase 243338970233425186Rat
1563114Asb4ankyrin repeat and SOCS box-containing 443350699233544630Rat
1591728LOC680472similar to Villin-143357586133580483Rat
7584396LOC102552448uncharacterized LOC10255244843358265233589860Rat
69061Pdk4pyruvate dehydrogenase kinase 443359179633601798Rat
11435887LOC10835085260S ribosomal protein L29 pseudogene43366405033666091Rat
2512Dync1i1dynein cytoplasmic 1 intermediate chain 143385259734166159Rat
1565889Slc25a13solute carrier family 25 member 1343417922434361912Rat
41148263LOC120102562U6 spliceosomal RNA43421018434210290Rat
9376829LOC103692067protein LLP homolog pseudogene43429933134305057Rat
11431277LOC10835067160S ribosomal protein L31 pseudogene43430256234310161Rat
7657264LOC102554854uncharacterized LOC10255485443441491134438788Rat
9229365LOC103692052uncharacterized LOC10369205243443911634447138Rat
41375555LOC120102231uncharacterized LOC12010223143459265234594248Rat
41305886LOC120102232aldo-keto reductase family 1 member C2-like43460852234616239Rat
1590628Sem1SEM1 26S proteasome subunit43467184834692005Rat
41211262LOC120102776U4 spliceosomal RNA43469280334692885Rat
1566237RGD1566237similar to 60S ribosomal protein L3543487396834874422Rat
6488535LOC100912227uncharacterized LOC10091222743494327134993044Rat
1561539Dlx6distal-less homeobox 643498426434989926Rat
2506Dlx5distal-less homeobox 543499913935003504Rat
1305143Sdhaf3succinate dehydrogenase complex assembly factor 343514313135160416Rat
1589400LOC680676hypothetical protein LOC68067643527172035272156Rat
11453897LOC108350853uncharacterized LOC10835085343529687035304056Rat
3807Tac1tachykinin, precursor 143567918335687180Rat
41397044LOC120102466protein SET-like43574428035747371Rat
41202184LOC120102233uncharacterized LOC12010223343578016035783088Rat
2162Asnsasparagine synthetase (glutamine-hydrolyzing)43578499535803474Rat
9388809LOC103695208DNA-directed RNA polymerases I and III subunit RPAC2-like43592757835928571Rat
621105C1galt1core 1 synthase, glycoprotein-N-acetylgalactosamine 3-beta-galactosyltransferase, 143593074335966102Rat
40976402LOC120102629small nucleolar RNA SNORA3/SNORA45 family43596972735969848Rat
7526246LOC102550307uncharacterized LOC10255030743601868036040591Rat
1564680Col28a1collagen type XXVIII alpha 1 chain43606998036223128Rat
1308432Miosmeiosis regulator for oocyte development43626341936289546Rat
1306810Rpa3replication protein A343630464936307755Rat
1563612Glcci1glucocorticoid induced 143630795636635614Rat
621465Ica1islet cell autoantigen 143665647536804705Rat
7715339LOC102550643uncharacterized LOC10255064343678088436787735Rat
3218Nxph1neurexophilin 143699806837311135Rat
41319059LOC120102653small nucleolar RNA SNORA4843748469037484833Rat
1585861LOC680928similar to TGF beta-inducible nuclear protein 143756118837561974Rat
1565400RGD1565400similar to actin 3 - fruit fly (Drosophila melanogaster) (fragments)43762082037622087Rat
3600Rps4x-ps9ribosomal protein S4, X-linked, pseudogene 943775837337759289Rat
1560448LOC500028hypothetical protein LOC50002843791783737918511Rat
2322347LOC100360305hypothetical LOC10036030543801322738013802Rat
11516558LOC10835085540S ribosomal protein S23 pseudogene43826319438263628Rat
1585825LOC680964similar to high mobility group nucleosomal binding domain 143860485638606026Rat
40971411LOC120102154uncharacterized LOC12010215443864163538646263Rat
41248065LOC120102234uncharacterized LOC12010223443890194838907419Rat
2322154LOC100360402hypothetical LOC10036040243919157039192321Rat
1562387RGD1562387similar to GTP-binding protein NGB43939107939425066Rat
7596691LOC102547989uncharacterized LOC10254798943959860439678420Rat
40982246LOC120102694small nucleolar RNA SNORA1743973394139734060Rat
1584730LOC681013similar to Stathmin (Phosphoprotein p19) (pp19) (Oncoprotein 18) (Op18) (Leukemia-associated phosphoprotein p18) (pp17) (Prosolin) (Metablastin) (Protein Pr22)43976968439770132Rat
1584719Ndufa4NDUFA4, mitochondrial complex associated44000221640009384Rat
1563764Phf14PHD finger protein 1444000969140195870Rat
41002968LOC120102235uncharacterized LOC12010223544011938740123944Rat
41122445LOC120102236uncharacterized LOC12010223644016991540171995Rat
41140158LOC120102687small nucleolar RNA SNORA1744030905740309173Rat
1566201Thsd7athrombospondin type 1 domain containing 7A44046112440899345Rat
7641224LOC102548177uncharacterized LOC10254817744068219240683121Rat
9330178LOC10369207460 kDa heat shock protein, mitochondrial pseudogene44072136940732042Rat
11363596LOC108350856uncharacterized LOC10835085644093701340945223Rat
1587202LOC502730similar to Pyruvate kinase isozymes M1/M2 (Pyruvate kinase muscle isozyme)44115613841277227Rat
1303037Tmem106btransmembrane protein 106B44132812541347315Rat
1561223Vwdevon Willebrand factor D and EGF domains44145357341525421Rat
1583532LOC681159similar to Glucosamine 6-phosphate N-acetyltransferase (Phosphoglucosamine transacetylase) (Phosphoglucosamine acetylase) (EMeg32 protein)44154887241549774Rat
1564521Tas2r7ltaste receptor type 2 member 7-like44156953641570447Rat
41291133LOC120102511uncharacterized LOC12010251144160833041656692Rat
7609534LOC102548489uncharacterized LOC10254848944169446041701116Rat
6493676LOC100911252peptidyl-prolyl cis-trans isomerase A-like44182887341829619Rat
1307778Tmem168transmembrane protein 16844183062341858763Rat
41264909LOC120102634small nucleolar RNA SNORA4444186943541869561Rat
7545679LOC102548706LYR motif-containing protein 4-like44187003941878699Rat
1588441Bmt2base methyltransferase of 25S rRNA 2 homolog44188163041945472Rat
1564656LOC500035hypothetical protein LOC50003544197006441978344Rat
41065803LOC120102155uncharacterized LOC12010215544198883241995216Rat
71011Gpr85G protein-coupled receptor 8544210013842109584Rat
2322826LOC100363521hypothetical LOC10036352144214169642143340Rat
41374934LOC120102237fatty acid-binding protein, heart-like44218552542189209Rat
2323857LOC100359436rCG25051-like44223615742358953Rat
41230048LOC120102706small nucleolar RNA SNORA1744239883242398962Rat
1597981LOC681293similar to heterogeneous nuclear ribonucleoprotein A344246088042461983Rat
41017590LOC120102597U6 spliceosomal RNA44272163142721733Rat
1561312Ppp1r3aprotein phosphatase 1, regulatory subunit 3A44293735342980195Rat
1559697Foxp2forkhead box P244313382743712442Rat
1585845Rbmxl1bRNA binding motif protein, X-linked-like 1B44395626543957973Rat
1309532MdficMyoD family inhibitor domain containing44397231044052162Rat
41011912LOC120102753U2 spliceosomal RNA44418613544186318Rat
41113285LOC12010215660S ribosomal protein L21-like44449843144506388Rat
1562178RGD1562178similar to Adenylate kinase 244496660644967403Rat
3846Tfectranscription factor EC44510612945180236Rat
41270777LOC120102238uncharacterized LOC12010223844525441545365272Rat
1566346Testestin LIM domain protein44536530445403829Rat
7512277LOC102550644uncharacterized LOC10255064444546330045616095Rat
620348Cav2caveolin 244561676645624144Rat
41113020LOC120102239uncharacterized LOC12010223944563428745636852Rat
2280Cav1caveolin 144564062445673708Rat
9112364LOC103692063uncharacterized LOC10369206344568273545711751Rat
7671121LOC102550745uncharacterized LOC10255074544571182445736550Rat
3082MetMET proto-oncogene, receptor tyrosine kinase44579045645898139Rat
7696844LOC102551271uncharacterized LOC10255127144595179445956024Rat
41348167LOC120102240uncharacterized LOC12010224044597227945977980Rat
1549770Capza2capping actin protein of muscle Z-line subunit alpha 244597814246014032Rat
1303148ST7suppression of tumorigenicity 744604165546289745Rat
41017039LOC12010244460S ribosomal protein L23a-like44614691746153007Rat
621346Wnt2Wnt family member 244632840846374673Rat
621579Asz1ankyrin repeat, SAM and basic leucine zipper domain containing 144640048546456085Rat
2332CftrCF transmembrane conductance regulator44656126946728759Rat
41373703LOC120102563U6 spliceosomal RNA44675272146752827Rat
628691Cttnbp2cortactin binding protein 244680097546964681Rat
41325296LOC120102241uncharacterized LOC12010224144690628746931844Rat
1566227RGD1566227similar to RIKEN cDNA 2610101N1044700588447008963Rat
1308442Lsm8LSM8 homolog, U6 small nuclear RNA associated44730625947312125Rat
1564660Ankrd7ankyrin repeat domain 744731227047336754Rat
1597712LOC685171similar to protein disulfide isomerase-associated 644760658247607800Rat
11453204LOC108350673uncharacterized LOC10835067344874646548832870Rat
1588440LOC500044similar to 60S ribosomal protein L7a44899400148996804Rat
41283447LOC120102623small nucleolar RNA SNORA7244956519549565318Rat
2321181LOC100364378hypothetical LOC10036437844963262849633166Rat
7531073LOC102556178uncharacterized LOC10255617844977514649777251Rat
68393Kcnd2potassium voltage-gated channel subfamily D member 244977581250277746Rat
41223455LOC120102479uncharacterized LOC12010247944981092649845924Rat
9383752LOC10369208160S ribosomal protein L3 pseudogene44999112250003764Rat
9374544LOC103692082protein SDA1 homolog45000501450017758Rat
1311102Tspan12tetraspanin 1245031376850389246Rat
41368653LOC120102242cytochrome c oxidase subunit 6C-2-like45039472250401254Rat
1310556Ing3inhibitor of growth family, member 345047795450505168Rat
1563491Cped1cadherin-like and PC-esterase domain containing 145051671250789651Rat
41385577LOC120102243uncharacterized LOC12010224345071201250723386Rat
1562253Wnt16Wnt family member 1645082096850831380Rat
735193Fam3cFAM3 metabolism regulating signaling molecule C45083992950887276Rat
40966555LOC12010251240S ribosomal protein S2-like45118082051181483Rat
1595049LOC685399similar to tumor protein, translationally-controlled 145119572651196520Rat
2323280LOC100359863hypothetical LOC10035986345122310151296237Rat
3455Ptprz1protein tyrosine phosphatase, receptor type Z145139731651595220Rat
1310811Aassaminoadipate-semialdehyde synthase45160646151663136Rat
1593790LOC685467similar to 40S ribosomal protein S345168221851683038Rat
9348766LOC10369208460S ribosomal protein L27 pseudogene45174224651742683Rat
1560480Fezf1Fez family zinc finger 145176275151766078Rat
1559440Cadps2calcium dependent secretion activator 245178041552309641Rat
1596695Rnf133ring finger protein 13345214058452143357Rat
1595417Rnf148ring finger protein 14845214579852152508Rat
11494192LOC108350675uncharacterized LOC10835067545230586952306706Rat
41187450LOC12010215760S ribosomal protein L21-like45238660952387084Rat
620735Tas2r118taste receptor, type 2, member 11845244920852450107Rat
61919Slc13a1solute carrier family 13 member 145256917952647126Rat
41390060LOC120102445thyroid hormone receptor-associated protein 3-like45261899952623801Rat
1591364LOC685649similar to inosine monophosphate dehydrogenase 245273881252740348Rat
4145674IqubIQ motif and ubiquitin domain containing45293176852993795Rat
3155Ndufa5NADH:ubiquinone oxidoreductase subunit A545299732753005685Rat
11519975LOC108350676uncharacterized LOC10835067645301133153070210Rat
727860Asb15ankyrin repeat and SOCS box containing 1545302155353050846Rat
1592092Lmod2leiomodin 245306742853075124Rat
735144WaslWASP like actin nucleation promoting factor45308353653132061Rat
41004839LOC120102244uncharacterized LOC12010224445314025853147391Rat
41046683LOC120102245thymosin beta-10-like45316672153167501Rat
1564219Hyal6hyaluronoglucosaminidase 645323811853250783Rat
1303194Hyal4hyaluronidase 445325617953274819Rat
620547Spam1sperm adhesion molecule 145330274553312913Rat
1566275Hyal5hyaluronoglucosaminidase 545334110553412280Rat
41007128LOC120102673small nucleolar RNA SNORA1745338598353386111Rat
1590212Tmem229atransmembrane protein 229A45344028953445327Rat
40982331LOC120102560U4 spliceosomal RNA45344725653447395Rat
41116076LOC120102770small nucleolar RNA U345347260253472711Rat
41340465LOC120102695small nucleolar RNA SNORA1745369658653696709Rat
1590185LOC685783similar to suppressor of variegation 3-9 homolog 245377885553779842Rat
619848Gpr37G protein-coupled receptor 3745413886054160927Rat
1562696Pot1protection of telomeres 145420533054263137Rat
41278566LOC120102621U7 small nuclear RNA45424986854249928Rat
41203940LOC120102612U7 small nuclear RNA45424994254250003Rat
40965413LOC120102246uncharacterized LOC12010224645426329454267934Rat
41126584LOC120102570U6 spliceosomal RNA45430365054303756Rat
11449079LOC108350678uncharacterized LOC10835067845431932854357983Rat
41236019LOC120102247uncharacterized LOC12010224745443222054444023Rat
1588991LOC685895similar to Thymidine kinase, cytosolic45476723154775827Rat
41096447LOC120102705small nucleolar RNA SNORA1745488282354882955Rat
2320107LOC100361458hypothetical LOC10036145845491521154915991Rat
40973663LOC120102749U1 spliceosomal RNA45500375355003908Rat
41167571LOC120102158uncharacterized LOC12010215845547681655492390Rat
41153446LOC120102756U2 spliceosomal RNA45579655355796713Rat
619858Grm8glutamate metabotropic receptor 845580576256731690Rat
41002790LOC120102608small nucleolar RNA SNORA73 family45625815156258354Rat
40972881LOC120102759U2 spliceosomal RNA45645195256452095Rat
2314878Mir592microRNA 59245650528056505375Rat
1560157Zfp800zinc finger protein 80045679832656849766Rat
41034677LOC120102248uncharacterized LOC12010224845680319656805686Rat
1587791LOC685984similar to H3 histone, family 3B45684980056862528Rat
40930852LOC120102657U1 spliceosomal RNA45695629256956455Rat
2319954Gcc1GRIP and coiled-coil domain containing 145703081757042682Rat
621278Arf5ADP-ribosylation factor 545703852157041447Rat
1303047Fscn3fascin actin-bundling protein 345704279757052224Rat
620433Pax4paired box 445705845357065995Rat
631340Snd1staphylococcal nuclease and tudor domain containing 145709520557494501Rat
628724LipogeninLipogenin45735629857357553Rat
1560026Lrrc4leucine rich repeat containing 445743351857437114Rat
41397929LOC120102250uncharacterized LOC12010225045758550557626664Rat
41403537LOC120102249metalloproteinase inhibitor 1-like45760435257606480Rat
2325456Mir129-1microRNA 129-145762429557624366Rat
3000Lepleptin45766112757675262Rat
1311336Rbm28RNA binding motif protein 2845772222357761935Rat
1559885Prrt4proline-rich transmembrane protein 445776605457777087Rat
1311108Impdh1inosine monophosphate dehydrogenase 145780184257817434Rat
41279683LOC120102707small nucleolar RNA SNORA1745783546757835618Rat
2319900Hilpdahypoxia inducible lipid droplet-associated45787107657875206Rat
1561814Fam71f2family with sequence similarity 71, member F245788001957890824Rat
9389926LOC103692085uncharacterized LOC10369208545788614857889290Rat
1564147Fam71f1family with sequence similarity 71, member F145791518457938593Rat
620383Calucalumenin45794908657976589Rat
621033Opn1swopsin 1, short wave sensitive45797731757980457Rat
11403251Trnap-agg6transfer RNA proline (anticodon AGG) 645798962657989697Rat
1564459Ccdc136coiled-coil domain containing 13645799782558027598Rat
1308807Flncfilamin C45803408858061882Rat
621552Atp6v1fATPase H+ transporting V1 subunit F45806766658070628Rat
9472094Atp6v1fnbATP6V1F neighbor45807076958073496Rat
1561119Kcpkielin cysteine rich BMP regulator45808285658118170Rat
1310447Irf5interferon regulatory factor 545812757758140665Rat
1308938Tnpo3transportin 345814295458220365Rat
7563828LOC102552812uncharacterized LOC10255281245827229058276271Rat
41373976LOC120102480small nuclear ribonucleoprotein G-like45830406958304945Rat
1560915Tspan33tetraspanin 3345830537858330013Rat
41285462LOC120102481uncharacterized LOC12010248145830681058311531Rat
3726Smosmoothened, frizzled class receptor45834410158372828Rat
41009975LOC120102483uncharacterized LOC12010248345837333558381144Rat
1564895Ahcyl2adenosylhomocysteinase-like 245838129058531061Rat
41086513LOC12010248260S ribosomal protein L19-like45841579258423285Rat
1588437Strip2striatin interacting protein 245853603458578279Rat
7590867LOC102552990phosphoglycerate kinase 1-like45857843058580694Rat
9298384Smkr1small lysine-rich protein 145859536358609149Rat
41058543LOC120102484uncharacterized LOC12010248445863484558638314Rat
1304603Nrf1nuclear respiratory factor 145866493258772328Rat
4888616Mir182microRNA 18245878481858784879Rat
2325582Mir96microRNA 9645878841158788516Rat
2325560Mir183microRNA 18345878861458788723Rat
4888613Mir3553microRNA 355345878861758788722Rat
2319288Ube2hubiquitin-conjugating enzyme E2H45883467458930156Rat
620408N5DNA binding protein N545890039858902597Rat
41334655LOC120102640small nucleolar RNA SNORA3245895139358951489Rat
1561099Zc3hc1zinc finger, C3HC-type containing 145898998959011925Rat
1309792Klhdc10kelch domain containing 1045902130059079118Rat
11503662LOC108350685uncharacterized LOC10835068545908451759086860Rat
1309682Tmem209transmembrane protein 20945910165659128687Rat
1559502Ssmem1serine-rich single-pass membrane protein 145912873059139029Rat
1305563Cpa2carboxypeptidase A245916035759183677Rat
41176579LOC120102251uncharacterized LOC12010225145916618959197472Rat
1563619Cpa4carboxypeptidase A445918828459212255Rat
7689603LOC102553416uncharacterized LOC10255341645920892859229667Rat
1303098Cpa5carboxypeptidase A545922975459249503Rat
2388Cpa1carboxypeptidase A145925741759263544Rat
1562034Cep41centrosomal protein 4145927121859312343Rat
1594589Mestmesoderm specific transcript45935444559364919Rat
1566215Copg2COPI coat complex subunit gamma 245936608659501591Rat
41028632LOC120102252uncharacterized LOC12010225245937459359381533Rat
1584118Tsga13testis specific, 1345950177359522925Rat
9267310LOC103692110interferon-induced transmembrane protein 2 pseudogene45954898259549845Rat
1306012Klf14Kruppel-like factor 1445955401159556933Rat
40958069LOC120102485uncharacterized LOC12010248545964749359762806Rat
4888604Mir3556amicroRNA 3556a45965059659650713Rat
2325393Mir29amicroRNA 29a45965060859650695Rat
4888577Mir3587microRNA 358745965096059651022Rat
2325591Mir29b1microRNA 29b-145965098759651067Rat
40935195Trnad-auctransfer RNA aspartic acid (anticodon AUC)45978748459787557Rat
620076Mkln1muskelin 145981591260124047Rat
41397436LOC120102487uncharacterized LOC12010248745983240159845825Rat
41196392LOC120102488uncharacterized LOC12010248845987710159880952Rat
41038068LOC120102486uncharacterized LOC12010248645996954160002431Rat
11406136LOC108350834uncharacterized LOC10835083445997441259990317Rat
9410961LOC103695207peptidyl-prolyl cis-trans isomerase D-like46007650560077634Rat
621878Podxlpodocalyxin-like46013512460181829Rat
7632355LOC102548336developmental pluripotency-associated protein 4-like46014565860148378Rat
1561636RGD1561636similar to 60S ribosomal protein L3846029635860296687Rat
1586093LOC366309similar to suppressor of initiator codon mutations, related sequence 146048509460485620Rat
9159197LOC103692092transcription factor BTF3 pseudogene46050383260506706Rat
7643646LOC102549088uncharacterized LOC10254908846061944960651830Rat
1597444LOC689042hypothetical protein LOC68904246064592160652324Rat
11485345LOC108350687uncharacterized LOC10835068746069840160709474Rat
1308074Plxna4plexin A446072024661162206Rat
11439332LOC108350688uncharacterized LOC10835068846073321760817304Rat
1563055RGD1563055similar to transcription elongation factor B (SIII), polypeptide 246133418761334902Rat
1310325Chchd3coiled-coil-helix-coiled-coil-helix domain containing 346136035261616850Rat
1565435RGD1565435similar to Hmgb1 protein46180596461806669Rat
621791Exoc4exocyst complex component 446180770662584316Rat
41082831LOC120102446FAD-linked sulfhydryl oxidase ALR-like46209998762100799Rat
1594818LOC689234similar to catechol-O-methyltransferase domain containing 146261638962632132Rat
1308226Lrgukleucine-rich repeats and guanylate kinase domain containing46264722262770268Rat
1308985Slc35b4solute carrier family 35 member B446277699362799013Rat
1594775LOC689277hypothetical protein LOC68927746287878162879361Rat
2092Akr1b1aldo-keto reductase family 1 member B46293203362946126Rat
708475Akr1b8aldo-keto reductase family 1, member B846299724163009815Rat
1308277Akr1b10aldo-keto reductase family 1 member B1046303845963060336Rat
620257Akr1b7aldo-keto reductase family 1, member B746305356063100934Rat
6497379LOC100910662myosin light polypeptide 6-like46306171263063832Rat
735018Bpgmbisphosphoglycerate mutase46313973063168581Rat
40970919LOC120102253uncharacterized LOC12010225346320022963204908Rat
2256Cald1caldesmon 146326578163446936Rat
41095347LOC120102254uncharacterized LOC12010225446336104963362181Rat
11450777LOC108350691uncharacterized LOC10835069146344516263448456Rat
1561995Agbl3AGBL carboxypeptidase 346344878963535538Rat
1549759Tmem140transmembrane protein 14046353647763547478Rat
1563238Cyrencell cycle regulator of NHEJ46354731163553394Rat
1306697Wdr91WD repeat domain 9146355436463591733Rat
1562852Stra8stimulated by retinoic acid 846360144363624777Rat
1565367RGD1565367similar to Solute carrier family 23, member 2 (Sodium-dependent vitamin C transporter 2)46363129263679687Rat
9074622LOC103692099uncharacterized LOC10369209946364549963654542Rat
1310318Cnot4CCR4-NOT transcription complex, subunit 446371277063814355Rat
7739309LOC102553126uncharacterized LOC10255312646381374863829271Rat
1309413Nup205nucleoporin 20546385493463920852Rat
41196132LOC12010225560S ribosomal protein L38-like46392236963936867Rat
1591053Stmp1short transmembrane mitochondrial protein 146392752363937355Rat
1359715Slc13a4solute carrier family 13 member 446394336963988852Rat
1308013Fam180afamily with sequence similarity 180, member A46399286764008047Rat
2319013LOC100365467hypothetical LOC10036546746409466264097040Rat
619806Mtpnmyotrophin46415927364186686Rat
41021819LOC120102764U2 spliceosomal RNA46456265364562792Rat
41309461LOC120102671small nucleolar RNA SNORA1746458071464580842Rat
1588434LOC500081hypothetical LOC50008146481823964819039Rat
7733981LOC102554507uncharacterized LOC10255450746500661265016735Rat
41195642LOC120102763U2 spliceosomal RNA46500716565007263Rat
620023Chrm2cholinergic receptor, muscarinic 246501540865149104Rat
2325414Mir490microRNA 49046504754865047631Rat
3444Ptnpleiotrophin46529373165375572Rat
735049Dgkidiacylglycerol kinase, iota46541087865872733Rat
1306040Creb3l2cAMP responsive element binding protein 3-like 246590757066112078Rat
620752Akr1d1aldo-keto reductase family 1, member D146615424666187505Rat
41237666LOC120102513high mobility group protein B1-like46649212666492794Rat
1560596Trim24tripartite motif-containing 2446666486466717244Rat
1566053SvoplSVOP like46669755066751699Rat
1305055Atp6v0a4ATPase H+ transporting V0 subunit a446676015966842110Rat
1588740Tmem213transmembrane protein 21346682495866831070Rat
1306271RGD1306271similar to KIAA1549 protein46684067466968407Rat
1309236Zc3hav1lzinc finger CCCH-type containing, antiviral 1 like46699419267003207Rat
628694Zc3hav1zinc finger CCCH-type containing, antiviral 146701215167062406Rat
1561363Ttc26tetratricopeptide repeat domain 2646709062267154707Rat
11448653LOC108350693high mobility group protein B1 pseudogene46709136867092710Rat
1310722Ubn2ubinuclein 246716527867251562Rat
41072194LOC12010248960S ribosomal protein L23-like46725589767260205Rat
11451624Trnar-ccu2transfer RNA arginine (anticodon CCU) 246727344867273520Rat
1559476Fmc1formation of mitochondrial complex V assembly factor 146727410467282140Rat
1308651Luc7l2LUC7-like 2 pre-mRNA splicing factor46728759367347986Rat
9320161LOC103692107small nuclear ribonucleoprotein E pseudogene46732695167328859Rat
41372108LOC120102490insulin-induced gene 1 protein-like46733039967331371Rat
1587495Klrg2killer cell lectin like receptor G246736021667374867Rat
1565373Clec2lC-type lectin domain family 2, member L46739211867414539Rat
1309349Hipk2homeodomain interacting protein kinase 246743932767619223Rat
3826Tbxas1thromboxane A synthase 146766496367837096Rat
41142180LOC120102680small nucleolar RNA SNORA1746776730567767435Rat
1308628Parp12poly (ADP-ribose) polymerase family, member 1246782654867885356Rat
1592650Kdm7alysine demethylase 7A46789940767974264Rat
41219357LOC120102491uncharacterized LOC12010249146798822168026091Rat
41161250LOC120102577U6 spliceosomal RNA46803216868032274Rat
1583604Chmp4bl1chromatin modifying protein 4B-like 146804974268050791Rat
1310346Slc37a3solute carrier family 37, member 346810931468153590Rat
1565263Rab19RAB19, member RAS oncogene family46815715968166889Rat
1303251Mkrn1makorin ring finger protein 146817590968197216Rat
40962184LOC120102609small nucleolar RNA SNORA7146819917868199301Rat
1306142Dennd2aDENN domain containing 2A46823301668332235Rat
7643066LOC102554568serine/arginine-rich splicing factor 3-like46834229268343400Rat
1311058Adck2aarF domain containing kinase 246834885368362725Rat
7626918LOC102554668uncharacterized LOC10255466846836299068367488Rat
1308130Ndufb2NADH:ubiquinone oxidoreductase subunit B246836752668374609Rat
619908BrafB-Raf proto-oncogene, serine/threonine kinase46837548468510652Rat
41225554LOC12010225660S ribosomal protein L26-like46839090368395785Rat
7666339LOC102555403ferritin heavy chain-like46843185768436899Rat
1309217Mrps33mitochondrial ribosomal protein S3346859672968605547Rat
40994299LOC120102257uncharacterized LOC12010225746861471568622669Rat
9116769LOC103692103uncharacterized LOC10369210346862670668655436Rat
1585938Tmem178btransmembrane protein 178B46865942569035690Rat
7574135LOC102555151uncharacterized LOC10255515146892487368939499Rat
1562046Agkacylglycerol kinase46911485069193989Rat
1563986Dennd11DENN domain containing 1146919716169266013Rat
1587197Wee2WEE2 oocyte meiosis inhibiting kinase46923904369261576Rat
3760Ssbp1single stranded DNA binding protein 146926602469276135Rat
1560602Tas2r137taste receptor, type 2, member 13746927927669286935Rat
1561194Tas2r108taste receptor, type 2, member 10846928766769288581Rat
1311823Prss37serine protease 3746932297769334555Rat
1333433Olr798-psolfactory receptor pseudogene 79846936072369361664Rat
1332737Olr799olfactory receptor 79946940160669402550Rat
1584755Clec5aC-type lectin domain containing 5A46940712569416872Rat
1560649Tas2r138taste receptor, type 2, member 13846942834469429339Rat
9369725LOC103690059maltase-glucoamylase, intestinal-like46944162669602068Rat
1308368Mgammaltase-glucoamylase46962402469715782Rat
1564286Moxd2monooxygenase, DBH-like 246972469369733188Rat
1303054Prss58serine protease 5846975265169757306Rat
1302947Prss59protease, serine 5946976420669785111Rat
1563848LOC312273Trypsin V-A46979766169803606Rat
708585LOC286960preprotrypsinogen IV46981510769826206Rat
6496223LOC100910843polymerase delta-interacting protein 2-like46985626469857478Rat
708437Prss3bprotease, serine, 3B46987181069875518Rat
6493911LOC100911271uncharacterized LOC10091127147003688070038079Rat
1311446Prss3serine protease 347020308870206562Rat
41142645LOC120102514cell division control protein 42 homolog47020715770207873Rat
1560283Try5trypsin 547021376070217034Rat
1359400Try10trypsin 1047024431470247819Rat
3418Prss2protease, serine, 247027830470283385Rat
1598148LOC679922similar to protease, serine, 347031769070320752Rat
7618053LOC102554637anionic trypsin-2-like47033167370335768Rat
1597830LOC683849similar to Anionic trypsin II precursor (Pretrypsinogen II)47034433870348069Rat
3417Prss1serine protease 147036458970367792Rat
41021783LOC120102259uncharacterized LOC12010225947042230970428425Rat
41226242LOC120102568U6 spliceosomal RNA47044930770449413Rat
1306163Ephb6Eph receptor B647049197370507230Rat
69335Trpv6transient receptor potential cation channel, subfamily V, member 647050734770523013Rat
620636Trpv5transient receptor potential cation channel, subfamily V, member 547053643270562743Rat
1595510Llcfc1LLLL and CFNLAS motif containing 147056620670567592Rat
1565470KelKell metallo-endopeptidase (Kell blood group)47056824170585666Rat
2323329LOC100359812hypothetical LOC10035981247060065270601022Rat
1562066RGD1562066similar to odorant receptor ORZ647067126670672635Rat
2323279LOC100359864hypothetical LOC10035986447075251370753615Rat
70946Pipprolactin induced protein47078762770791921Rat
620869Sval2seminal vesicle antigen-like 247080936670813330Rat
620867Sval1seminal vesicle antigen-like 147084522870856192Rat
1595436Tas2r139taste receptor, type 2, member 13947098528070986239Rat
1562314Tas2r144taste receptor, type 2, member 14447108618271087141Rat
735188Gstk1glutathione S-transferase kappa 147111897971123298Rat
2321500LOC100360758peroxiredoxin-1-like47114152971143722Rat
1594187Tmem139transmembrane protein 13947114707271149151Rat
69274Casp2caspase 247114963271167388Rat
41054799LOC120102741small nucleolar RNA SNORD8847116051571160603Rat
2360Clcn1chloride voltage-gated channel 147117194971201483Rat
1560653Fam131bfamily with sequence similarity 131, member B47120103771210292Rat
41384154LOC120102260uncharacterized LOC12010226047120915971219286Rat
620698Zyxzyxin47123676771246553Rat
1304680Epha1Eph receptor A147124640971260920Rat
41267017LOC120102261uncharacterized LOC12010226147126100871284951Rat
1566290Tas2r143taste receptor, type 2, member 14347128785771288741Rat
1561078Tas2r135taste receptor, type 2, member 13547129291271293877Rat
727853Tas2r126taste receptor, type 2, member 12647133382171334747Rat
1334194Olr801olfactory receptor 80147136649071367431Rat
1333188Olr802olfactory receptor 80247137786971378810Rat
1333811Olr803olfactory receptor 80347138952671390464Rat
1333381Olr804olfactory receptor 80447145036371451316Rat
1359405Fam115efamily with sequence similarity 115, member E47151027871524582Rat
1591778Tcaf2cTRPM8 channel associated factor 2C47155370071567820Rat
1565474Tcaf1TRPM8 channel-associated factor 147158967471639309Rat
1334371Olr805-psolfactory receptor pseudogene 80547166247171662682Rat
11498065LOC10835080840S ribosomal protein S23 pseudogene47167471371675154Rat
1332594Olr806olfactory receptor 80647168893671689889Rat
1333677Olr807olfactory receptor 80747170732671708276Rat
1333950Olr808olfactory receptor 80847174019371741149Rat
41357395LOC120102713small nucleolar RNA SNORA1747175492771755060Rat
1333504Olr809olfactory receptor 80947175974771760682Rat
1333975Olr810olfactory receptor 81047177536871776300Rat
41399876LOC120102605U6 spliceosomal RNA47179492871795029Rat
1333367Olr811olfactory receptor 81147179998271800917Rat
41055517LOC120102159uncharacterized LOC12010215947185448371905362Rat
1334415Olr812olfactory receptor 81247185608471857016Rat
1332716Olr813olfactory receptor 81347187857871879519Rat
1333772Olr814-psolfactory receptor pseudogene 81447189871971899655Rat
1333327Olr815-psolfactory receptor pseudogene 81547190616971906509Rat
1333098Olr816olfactory receptor 81647194234371943275Rat
1587195Olr437olfactory receptor 43747196511871966047Rat
1334209Olr818olfactory receptor 81847197902671979958Rat
40956713LOC120102160uncharacterized LOC12010216047198640571989140Rat
1332872Olr819olfactory receptor 81947201281972013760Rat
11419404LOC108350809glyceraldehyde-3-phosphate dehydrogenase pseudogene47201417272015171Rat
1333011Olr820olfactory receptor 82047203190972032871Rat
1334159Olr821olfactory receptor 82147204632872047290Rat
7517929LOC102548553uncharacterized LOC10254855347208172272088278Rat
620718Arhgef5Rho guanine nucleotide exchange factor 547208720572112316Rat
1563929NoboxNOBOX oogenesis homeobox47212893172134436Rat
1589408Tpk1thiamin pyrophosphokinase 147217013472557707Rat
11481974LOC108350700uncharacterized LOC10835070047224919372293064Rat
41181679LOC120102665small nucleolar RNA SNORA1747278134972781478Rat
1587194LOC502761similar to suppression of tumorigenicity 1347393531073937677Rat
41128409LOC120102161uncharacterized LOC12010216147406270374072374Rat
1307076Cntnap2contactin associated protein 247410945576366434Rat
41075400NEWGENE_40933816transfer RNA valine (anticodon AAC)47472882274728894Rat
7558071LOC102549191uncharacterized LOC10254919147501451575018378Rat
9287263LOC103692120uncharacterized LOC10369212047521592875218753Rat
40926761LOC120102681small nucleolar RNA SNORA1747557598075576108Rat
7580004LOC102549132uncharacterized LOC10254913247591043575915630Rat
7613801LOC102553884uncharacterized LOC10255388447633415976429716Rat
2322482LOC100360269hypothetical LOC10036026947649790576498598Rat
1308157Cul1cullin 147655195276625830Rat
1595860Ezh2enhancer of zeste 2 polycomb repressive complex 2 subunit47662439976687362Rat
41101884LOC120102262uncharacterized LOC12010226247676728476777220Rat
619835Pdia4protein disulfide isomerase family A, member 447680319876822245Rat
2293500Zfp786zinc finger protein 78647682238376840943Rat
1562129Zfp398zinc finger protein 39847684967276881075Rat
1306278Zfp282zinc finger protein 28247688492476911370Rat
1307836Zfp212Zinc finger protein 21247692363876936076Rat
1304879Zfp956zinc finger protein 95647694323976967238Rat
9367833LOC103692140ATP synthase subunit delta, mitochondrial pseudogene47694416876946742Rat
11410744Trnac-gca1transfer RNA cysteine (anticodon GCA) 147698021376980284Rat
1566056Zfp777zinc finger protein 77747701636377044008Rat
1306209Zfp746zinc finger protein 74647705500877078968Rat
11470191Trnac-gca2transfer RNA cysteine (anticodon GCA) 247712214477122215Rat
11469937Trnac-gca3transfer RNA cysteine (anticodon GCA) 347712755777127628Rat
11368266Trnac-gca4transfer RNA cysteine (anticodon GCA) 447712852177128592Rat
11383953Trnac-gca5transfer RNA cysteine (anticodon GCA) 547713610077136171Rat
11445921Trnac-gca6transfer RNA cysteine (anticodon GCA) 647713711577137186Rat
11466918Trnac-gca7transfer RNA cysteine (anticodon GCA) 747714011377140184Rat
11391872Trnac-gca9transfer RNA cysteine (anticodon GCA) 947716356377163634Rat
11491518Trnac-gca10transfer RNA cysteine (anticodon GCA) 1047717826077178331Rat
11515722Trnac-gca11transfer RNA cysteine (anticodon GCA) 1147718033477180405Rat
11490908Trnac-gca12transfer RNA cysteine (anticodon GCA) 1247718288577182956Rat
11462536Trnac-gca13transfer RNA cysteine (anticodon GCA) 1347719026477190335Rat
11424934LOC108350703uncharacterized LOC10835070347719590077341432Rat
11380450Trnac-gca39transfer RNA cysteine (anticodon GCA) 3947720206277202133Rat
11365902Trnac-gca14transfer RNA cysteine (anticodon GCA) 1447720364177203712Rat
11442637Trnac-gca15transfer RNA cysteine (anticodon GCA) 1547720984077209911Rat
11515107Trnac-gca16transfer RNA cysteine (anticodon GCA) 1647723254277232613Rat
11368396Trnac-gca17transfer RNA cysteine (anticodon GCA) 1747723542477235495Rat
11517337Trnac-gca18transfer RNA cysteine (anticodon GCA) 1847723641577236486Rat
1583518LOC681173similar to mitochondrial ribosomal protein L1747725297477253783Rat
11448279Trnac-gca19transfer RNA cysteine (anticodon GCA) 1947726528277265353Rat
11497862Trnac-gca20transfer RNA cysteine (anticodon GCA) 2047726629777266368Rat
11415393Trnac-gca21transfer RNA cysteine (anticodon GCA) 2147727232077272391Rat
11400791Trnac-gca22transfer RNA cysteine (anticodon GCA) 2247727333277273403Rat
11453373Trnac-gca23transfer RNA cysteine (anticodon GCA) 2347727609477276165Rat
1564070Fgfr1-ps1fibroblast growth factor receptor 1, pseudogene 147727960477282022Rat
11397796Trnac-gca24transfer RNA cysteine (anticodon GCA) 2447728288577282956Rat
11420199Trnac-gca25transfer RNA cysteine (anticodon GCA) 2547728386677283937Rat
11386332Trnac-gca26transfer RNA cysteine (anticodon GCA) 2647729489477294965Rat
11390635Trnac-gca27transfer RNA cysteine (anticodon GCA) 2747729587377295944Rat
11467847Trnac-gca28transfer RNA cysteine (anticodon GCA) 2847730766177307732Rat
1306967Krba1KRAB-A domain containing 147734165477363075Rat
1561603Zfp467zinc finger protein 46747738575277394709Rat
1549716SspoSCO-spondin47739491577450526Rat
41321371LOC120102263uncharacterized LOC12010226347744562977451151Rat
1598054Zfp862zinc finger protein 86247745293077481981Rat
1303238Atp6v0e2ATPase, H+ transporting V0 subunit e247748486877488016Rat
1561800Lrrc61leucine rich repeat containing 6147750385777523909Rat
1309874Rarres2retinoic acid receptor responder 247752254977525733Rat
2323359LOC100363281hypothetical LOC10036328147753819177545808Rat
1549707Repin1replication initiator 147754872277554242Rat
1304910Zfp775zinc finger protein 77547755703777575296Rat
1559747RGD1559747similar to Zinc finger and SCAN domain containing protein 2 (Zinc finger protein 29)47757987777585815Rat
1564570Gimap8GTPase, IMAP family member 847760010477611593Rat
1597980LOC681294similar to phasmid Socket Absent PSA-4, homolog of SWI2/SNF2-related matrix-associated actin-dependent regulator of chromatin, required for an asymmetric cell division (170.6 kD) (psa-4)47762142377622617Rat
1549762Gimap9GTPase, IMAP family member 947762655377629386Rat
628765Gimap4GTPase, IMAP family member 447763640177643315Rat
1305041Gimap6GTPase, IMAP family member 647765370377659112Rat
1565750Gimap7GTPase, IMAP family member 747767052277674692Rat
1306777Gimap1GTPase, IMAP family member 147768758177691468Rat
628871Gimap5GTPase, IMAP family member 547769341777701025Rat
41023422LOC120102264uncharacterized LOC12010226447769389877696051Rat
708403Tmem176btransmembrane protein 176B47776692877774740Rat
1310725Tmem176atransmembrane protein 176A47777494077778620Rat
41166541LOC120102515uncharacterized LOC12010251547778078477793017Rat
61296Aoc1amine oxidase, copper containing 147781226077831846Rat
1587193LOC502765similar to disabled homolog 2 (Drosophila) interacting protein47784161377844707Rat
11436055LOC108350705amiloride-sensitive amine oxidase [copper-containing]-like47787153177873395Rat
735023Doxl1diamine oxidase-like protein 147787942877883044Rat
40942986LOC120102699small nucleolar RNA SNORA1747788726377887385Rat
735130Doxl2diamine oxidase-like protein 247793455177938333Rat
2323010LOC100363435hypothetical LOC10036343547794799777948862Rat
708424Svs1seminal vesicle secretory protein 147795547877960376Rat
7661434LOC102546557uncharacterized LOC10254655747799003977994867Rat
71008Gpnmbglycoprotein nmb47801024778031491Rat
1306936Malsu1mitochondrial assembly of ribosomal large subunit 147805109078059913Rat
1306512Igf2bp3insulin-like growth factor 2 mRNA binding protein 347806049478195007Rat
1562563Tra2atransformer 2 alpha homolog47822083878239737Rat
1583234Gemin7l1gem (nuclear organelle) associated protein 7-like 147826989578270697Rat
41148600LOC120102265uncharacterized LOC12010226547827987078287108Rat
41214177LOC120102162prothymosin alpha-like47829254878293734Rat
1561171Ccdc126coiled-coil domain containing 12647829762578318655Rat
6497475LOC100910678coiled-coil domain-containing protein 72-like47833066378331163Rat
11412043LOC10835085860S ribosomal protein L17 pseudogene47833370478336111Rat
1563175Fam221afamily with sequence similarity 221, member A47833729678358918Rat
1563352RGD1563352similar to ribosomal protein S1147836759778368077Rat
1564384Stk31serine threonine kinase 3147837069178467599Rat
41158599LOC120102266uncharacterized LOC12010226647850726778513680Rat
41201656LOC120102267uncharacterized LOC12010226747851382078519021Rat
6485532LOC10091280114-3-3 protein theta-like47855544378556936Rat
1564712RGD1564712RGD156471247865228978679549Rat
3197Npyneuropeptide Y47888129478888495Rat
7571074LOC102555694uncharacterized LOC10255569447903911779041508Rat
41298329LOC120102516basic proline-rich protein-like47916687779179773Rat
1311833Pals2protein associated with LIN7 2, MAGUK p55 family member47917348879257542Rat
727871Gsdmegasdermin E47925879979321129Rat
1564287Osbpl3oxysterol binding protein-like 347934658379523523Rat
41162112LOC120102268uncharacterized LOC12010226847952343879529558Rat
2319409LOC100365265hypothetical LOC10036526547957764879578130Rat
41061164LOC120102676small nucleolar RNA SNORA1747962350279623632Rat
1565415RGD1565415similar to ribosomal protein L27a47963353979634311Rat
2451Cycscytochrome c, somatic47965189479653994Rat
7624339LOC102546410uncharacterized LOC10254641047965417279689329Rat
1563788LOC500124similar to RIKEN cDNA 4921507P0747966337579688282Rat
61815Npvfneuropeptide VF precursor47971252079716236Rat
11401676LOC108350707uncharacterized LOC10835070747979076779795915Rat
1593814LOC685443similar to Serine/threonine-protein kinase 6 (Aurora-A) (ratAurA)47981143179812875Rat
2319193LOC100365386hypothetical LOC10036538647985997579860338Rat
7508808LOC102546824uncharacterized LOC10254682447999538680054736Rat
41052635LOC120102269uncharacterized LOC12010226948011040280114314Rat
41083837LOC120102163uncharacterized LOC12010216348018866680191301Rat
1592878LOC681658similar to CCAAT displacement protein isoform b48026982180271956Rat
9685082Mir148amicroRNA 148a48033376280333858Rat
7657543LOC102549423uncharacterized LOC10254942348041680780427041Rat
41399556LOC120102270uncharacterized LOC12010227048047185780479206Rat
1307730Nfe2l3NFE2 like bZIP transcription factor 348050675680534629Rat
1310403Hnrnpa2b1heterogeneous nuclear ribonucleoprotein A2/B148053465980545297Rat
1549705Cbx3chromobox 348054545080559284Rat
1561341RGD1561341similar to Translocase of outer mitochondrial membrane 20 homolog48060334280603836Rat
1305782Snx10sorting nexin 1048061264880677005Rat
41025668LOC120102271MICOS complex subunit MIC13-like48062378580625489Rat
41106900LOC120102272uncharacterized LOC12010227248063104480644379Rat
41093189LOC120102273uncharacterized LOC12010227348082463680828739Rat
41305549LOC120102274uncharacterized LOC12010227448082881280830571Rat
41108658LOC120102517uncharacterized LOC12010251748089814280924068Rat
620159Skap2src kinase associated phosphoprotein 248094883281100900Rat
7570592LOC102550087uncharacterized LOC10255008748110093781144318Rat
41173484LOC12010216460S ribosomal protein L21-like48117475881175534Rat
11420575LOC10835086060S ribosomal protein L31 pseudogene48119187681192258Rat
41099928LOC120102275uncharacterized LOC12010227548119303681208800Rat
11414885Hoxa1homeobox A148125581481258504Rat
7716070Hotairm1Hoxa transcript antisense RNA, myeloid-specific 148125879381262291Rat
1561431Hoxa3homeobox A348126924381313218Rat
7620814LOC102546856uncharacterized LOC10254685648127531381293064Rat
40941309LOC120102276uncharacterized LOC12010227648128008781281256Rat
2814Hoxa4homeo box A448128967781291685Rat
10398773Hoxaas3Hoxa cluster antisense RNA 348130125481313958Rat
620609Hoxa5homeo box A548130234181306234Rat
1590236Hoxa6homeobox A648130491881313184Rat
1587253Hoxa7homeobox A748131573081317629Rat
1310001Hoxa9homeobox A948132323581329344Rat
2314882Mir196bmicroRNA 196b48133048781330571Rat
6491746LOC100911668homeobox protein Hox-A10-like48133159181341241Rat
1564605Hoxa11homeobox A1148134252781346189Rat
1564419Hoxa11-asHOXA11 antisense RNA48134641681350190Rat
1562483Hoxa13homeo box A1348135895681361091Rat
41113909LOC120102165NADH dehydrogenase [ubiquinone] 1 beta subcomplex subunit 4-like48147423881474752Rat
40974159LOC120102277uncharacterized LOC12010227748157824081580768Rat
41226461LOC120102278uncharacterized LOC12010227848161340681619082Rat
708399Hibadh3-hydroxyisobutyrate dehydrogenase48164918081747244Rat
1593850LOC685406LRRGT0006248168222481688735Rat
1595057LOC685391LRRGT0006348169291681699598Rat
41150076LOC120102279uncharacterized LOC12010227948170440281727173Rat
708579Tax1bp1Tax1 binding protein 148182199181877906Rat
1589007Jazf1JAZF zinc finger 148187950182183241Rat
7551122LOC102548643serine/arginine-rich splicing factor 7-like48214009382142214Rat
11492396LOC108350711uncharacterized LOC10835071148215375582165281Rat
40973112LOC120102280uncharacterized LOC12010228048225601382264460Rat
41294070LOC120102518creatine kinase U-type, mitochondrial-like48228467082319694Rat
41301986LOC120102651small nucleolar RNA SNORA4848229639982296539Rat
41028316LOC120102281uncharacterized LOC12010228148232552182347057Rat
1566107Creb5cAMP responsive element binding protein 548239309182794320Rat
1310827TrilTLR4 interactor with leucine-rich repeats48292232782927172Rat
41074832LOC120102667small nucleolar RNA SNORA1748298003982980170Rat
1563609Cpvlcarboxypeptidase, vitellogenic-like48298142183091730Rat
620140Chn2chimerin 248314861683407711Rat
41059633LOC120102282uncharacterized LOC12010228248317836983186721Rat
41039183LOC120102283uncharacterized LOC12010228348318245483189341Rat
7593775LOC102553678uncharacterized LOC10255367848336464383376599Rat
1311589Prr15proline rich 1548343200283435582Rat
41347976LOC120102519elongation factor 1-beta-like48344887783449544Rat
708559Wipf3WAS/WASL interacting protein family, member 348355007583629929Rat
1560999Scrn1secernin 148363212583694225Rat
7685582LOC102553885uncharacterized LOC10255388548369316083711573Rat
1311705Fkbp14FKBP prolyl isomerase 1448370553183721515Rat
1563940Plekha8pleckstrin homology domain containing A848372347083774081Rat
7537419LOC102554291mitochondrial import receptor subunit TOM7 homolog48373880383743666Rat
1549700Mturnmaturin, neural progenitor differentiation regulator homolog48380752883828494Rat
6500991LOC100909941uncharacterized LOC10090994148387056083875187Rat
1306645Znrf2zinc and ring finger 248395040684032676Rat
1562269Nod1nucleotide-binding oligomerization domain containing 148406087184111668Rat
41396160LOC120102675small nucleolar RNA SNORA1748411420284114328Rat
1304876Ggctgamma-glutamyl cyclotransferase48412292184129327Rat
2325113LOC10035961360S ribosomal protein L12-like48414816584152462Rat
7703180LOC102550675uncharacterized LOC10255067548415456384170509Rat
1307856Gars1glycyl-tRNA synthetase 148417159684212609Rat
70547Crhr2corticotropin releasing hormone receptor 248422289784265924Rat
7724284LOC102550746uncharacterized LOC10255074648428875284310594Rat
1597087Inmtindolethylamine N-methyltransferase48431819784322493Rat
1562590Mindy4MINDY lysine 48 deubiquitinase 448435866084469189Rat
2141Aqp1aquaporin 148448251284494690Rat
2688Ghrhrgrowth hormone releasing hormone receptor48449815984532847Rat
7509699LOC102551107uncharacterized LOC10255110748454311884560009Rat
2038Adcyap1r1ADCYAP receptor type I48459355884642700Rat
41043092LOC120102284uncharacterized LOC12010228448480010684817508Rat
1562793Neurod6neuronal differentiation 648484665984849905Rat
1561131Itprid1ITPR interacting domain containing 148501526485172457Rat
628647Ppp1r17protein phosphatase 1, regulatory subunit 1748521359585230607Rat
68332Pde1cphosphodiesterase 1C48530085885777948Rat
40966591LOC120102285MICOS complex subunit Mic26-like48531798985318559Rat
41079727NEWGENE_40938314transfer RNA serine (anticodon AGA)48548230785482381Rat
41168976NEWGENE_6576114transfer RNA threonine (anticodon AGU)48552640985526483Rat
41243681LOC120102661small nucleolar RNA SNORA1748579175085791883Rat
41177763LOC120102688small nucleolar RNA SNORA1748581335885813483Rat
1565107RGD1565107similar to 40S ribosomal protein SA (p40) (34/67 kDa laminin receptor)48586753285868460Rat
1308655Lsm5LSM5 homolog, U6 small nuclear RNA and mRNA degradation associated48595107385954289Rat
1564615Avl9AVL9 cell migration associated48596149386008347Rat
1310317Kbtbd2kelch repeat and BTB domain containing 248602794786050266Rat
1549757Fkbp9FKBP prolyl isomerase 948610625686156723Rat
1312013Nt5c3a5'-nucleotidase, cytosolic IIIA48616164286204671Rat
41297101LOC120102286uncharacterized LOC12010228648618482886206190Rat
1585226LOC688782similar to Heterogeneous nuclear ribonucleoprotein A1 (Helix-destabilizing protein) (Single-strand binding protein) (hnRNP core protein A1) (HDP-1) (Topoisomerase-inhibitor suppressed)48621647386218622Rat
1585214Vom1r65vomeronasal 1 receptor 6548623591286245705Rat
11356528LOC108350861glyceraldehyde-3-phosphate dehydrogenase pseudogene48625213086253132Rat
1549708Vom1r67vomeronasal 1 receptor 6748626771986268663Rat
1549744Vom1r66vomeronasal 1 receptor 6648628841586289326Rat
2316407Vom1r-ps69vomeronasal 1 receptor pseudogene 6948632957886330574Rat
1584130Vom1r-ps70vomeronasal 1 receptor pseudogene 7048634301886343928Rat
1549721Vom1r68vomeronasal 1 receptor 6848638056786381478Rat
1549722Vom1r69vomeronasal 1 receptor 6948639457186395479Rat
2323070Selenot-ps1selenoprotein T, pseudogene 148639863886399185Rat
1549710Vom1r70vomeronasal 1 receptor 7048644777886449039Rat
1549777Vom1r71vomeronasal 1 receptor 7148653684786538197Rat
1549709Vom1r72vomeronasal 1 receptor 7248662671886627617Rat
41345109LOC120102166heat shock protein HSP 90-alpha-like48663089386631975Rat
1549715Vom1r73vomeronasal 1 receptor 7348668476586685682Rat
1582950Vom1r-ps71vomeronasal 1 receptor pseudogene 7148671349186714388Rat
6487873LOC100912229tubulin gamma-1 chain-like48671611286717437Rat
1549695Vom1r74vomeronasal 1 receptor 7448674378186744692Rat
11405111Vom1r75vomeronasal 1 receptor 7548675662486757556Rat
1549714Vom1r76vomeronasal 1 receptor 7648678181586782714Rat
1597453LOC689033hypothetical protein LOC68903348679106886796467Rat
1359218Vom1r77vomeronasal 1 receptor 7748680140086802317Rat
9351699LOC10369489440S ribosomal protein S6 pseudogene48681994286820686Rat
9290612LOC10369214440S ribosomal protein S6 pseudogene48684360986845120Rat
1549704Vom1r78vomeronasal 1 receptor 7848687204986872966Rat
1359257Vom1r79vomeronasal 1 receptor 7948691076686912251Rat
1549747Vom1r80vomeronasal 1 receptor 8048695493286955833Rat
1587250LOC500147similar to tubulin, gamma 148695738286958820Rat
1549765Vom1r81vomeronasal 1 receptor 8148697716786978099Rat
1596167Vom1r-ps72vomeronasal 1 receptor pseudogene 7248701153087012437Rat
1549746Vom1r82vomeronasal 1 receptor 8248704874187049637Rat
1560845Vom1r-ps73vomeronasal 1 receptor pseudogene 7348706579587066329Rat
1549731Vom1r83vomeronasal 1 receptor 8348711393687114844Rat
1549753Vom1r84vomeronasal 1 receptor 8448713607487136982Rat
1549732Vom1r85vomeronasal 1 receptor 8548716095987161867Rat
1549696Vom1r86vomeronasal 1 receptor 8648719852587199433Rat
1587190Vom1r-ps74vomeronasal 1 receptor pseudogene 7448723150487232398Rat
1549756Vom1r87vomeronasal 1 receptor 8748725550387256755Rat
1596849Vom1r-ps111vomeronasal 1 receptor pseudogene 11148730700087307908Rat
1549699Vom1r88vomeronasal 1 receptor 8848734693387347826Rat
1306494Vopp1VOPP1 WW domain binding protein48736367887432747Rat
1310809Lancl2LanC like 248744182187483707Rat
1565524PyurfPIGY upstream open reading frame48750185987505494Rat
1561739Herc6HECT and RLD domain containing E3 ubiquitin protein ligase family member 648752447087566895Rat
1563162LOC500148similar to 40S ribosomal protein S7 (S8)48759277387602036Rat
1308501Ppm1kprotein phosphatase, Mg2+/Mn2+ dependent, 1K48761219887638993Rat
631345Abcg2ATP binding cassette subfamily G member 248767624187802757Rat
41258840LOC120102567U6 spliceosomal RNA48784604487846150Rat
1587249LOC500149similar to peptidylprolyl isomerase D48785508187856880Rat
41250383LOC120102287uncharacterized LOC12010228748794191487952110Rat
1307803Herc3HECT and RLD domain containing E3 ubiquitin protein ligase 348795220288042492Rat
1584123Nap1l5nucleosome assembly protein 1-like 548802267088024988Rat
1309807Fam13afamily with sequence similarity 13, member A48805652188155782Rat
41392412LOC120102697small nucleolar RNA SNORA1748824063988240769Rat
1593482LOC689382hypothetical protein LOC68938248826755188268264Rat
1559612Tigd2tigger transposable element derived 248841436688417458Rat
2322105LOC100360451hypothetical LOC10036045148855134588555553Rat
1565690Gprin3GPRIN family member 348856370888657603Rat
11451272LOC108350862uncharacterized LOC10835086248876271388780061Rat
41312835LOC120102520uncharacterized LOC12010252048894704088947688Rat
41381715LOC120102288uncharacterized LOC12010228848944218589475598Rat
3729Sncasynuclein alpha48969642089797240Rat
1591097LOC689530similar to Alpha-enolase (2-phospho-D-glycerate hydro-lyase) (Non-neural enolase) (NNE) (Enolase 1)48987254889873844Rat
1587248Mmrn1multimerin 148987540889950814Rat
2321912LOC100360545protein phosphatase 6, catalytic subunit48997047089997261Rat
41044388LOC120102751U2 spliceosomal RNA49015113790151328Rat
1565731Ccser1coiled-coil serine-rich protein 149015387391391441Rat
41195085LOC120102492uncharacterized LOC12010249249081616490869483Rat
11450417LOC108350840uncharacterized LOC10835084049087966590931441Rat
11440908LOC108350839high mobility group protein B1-like49130690291309095Rat
40994091LOC120102521multifunctional protein ADE2-like49164710291648078Rat
41059287LOC120102620U7 small nuclear RNA49171696791717031Rat
620960Hint1-ps1histidine triad nucleotide binding protein 1, pseudogene 149210099492101568Rat
9264819Tshr-ps1thyroid stimulating hormone receptor, pseudogene 149214265692143138Rat
68368Grid2glutamate ionotropic receptor delta type subunit 249241501993892472Rat
41193354LOC120102493uncharacterized LOC12010249349329282193299590Rat
40926323LOC120102600U6 spliceosomal RNA49362423893624344Rat
41104383LOC120102494uncharacterized LOC12010249449389284393911169Rat
1565171Atoh1atonal bHLH transcription factor 149391206893914163Rat
41221465LOC120102615U7 small nuclear RNA49406097694061038Rat
40929032LOC120102616U7 small nuclear RNA49406112494061185Rat
1588783LOC689705hypothetical protein LOC68970549406540194065784Rat
41255876LOC120102647small nucleolar RNA SNORA4849414489094145033Rat
1587189LOC502786similar to non-POU domain containing, octamer-binding49415739794158751Rat
1309640Smarcad1SWI/SNF-related, matrix-associated actin-dependent regulator of chromatin, subfamily a, containing DEAD/H box 1`49431144194379184Rat
69251Hpgdshematopoietic prostaglandin D synthase49436842694397931Rat
41269840LOC1201022897,8-dihydro-8-oxoguanine triphosphatase-like49438167994382041Rat
9386529LOC10369215114-3-3 protein theta pseudogene49449111694491862Rat
1560028RGD1560028similar to RIKEN cDNA C130060K24 gene49467837094757034Rat
1588732Tnip3TNFAIP3 interacting protein 349486725894908780Rat
1311080Ndnfneuron-derived neurotrophic factor49494474994987414Rat
40991721LOC120102726small nucleolar RNA SNORA1749499311894993219Rat
41386173NEWGENE_40940579transfer RNA leucine (anticodon AAG)49503448895034569Rat
1588700Prdm5PR/SET domain 549507573695237921Rat
735071RSA-14-44RSA-14-44 protein49525165795253029Rat
41323200LOC120102581U6 spliceosomal RNA49528482095284926Rat
1307592Lin28clin-28 homolog C (C. elegans)49541756695420497Rat
1587188LOC502787similar to eukaryotic translation initiation factor 4, gamma 1 isoform a49559026595592593Rat
1587548LOC689832similar to 60S ribosomal protein L7a49563296895633283Rat
1564699RGD1564699similar to High mobility group protein 1 (HMG-1)49574279595743265Rat
41361057LOC12010229060S ribosomal protein L21-like49578372795784432Rat
41328136LOC120102650small nucleolar RNA SNORA4849582653795826676Rat
1310889Mad2l1mitotic arrest deficient 2 like 149590669295918885Rat
1359215Vom1r89vomeronasal 1 receptor 8949594262695943550Rat
621516Gng12G protein subunit gamma 1249601111896134767Rat
41081979LOC120102712U1 spliceosomal RNA49614656196146710Rat
2654Gadd45agrowth arrest and DNA-damage-inducible, alpha49615478996157091Rat
6488311LOC100912188uncharacterized LOC10091218849615649096204457Rat
619907Serbp1Serpine1 mRNA binding protein 149640158796421816Rat
41196388LOC120102291uncharacterized LOC12010229149641626996417217Rat
620026Il12rb2interleukin 12 receptor subunit beta 249642461596515327Rat
41121586LOC120102292uncharacterized LOC12010229249643512196439487Rat
1586368Il23rinterleukin 23 receptor49658056896672540Rat
1359498Tacstd2tumor-associated calcium signal transducer 249670795096709650Rat
41113583LOC120102728small nucleolar RNA SNORA1749681038496810504Rat
41316092LOC120102682small nucleolar RNA SNORA1749685191196852043Rat
41337280LOC120102727small nucleolar RNA SNORA1749688594096886060Rat
11362919LOC108353269Ig kappa chain V-II region 26-10-like49696857496969477Rat
41059548LOC120102691small nucleolar RNA SNORA1749698993796990067Rat
41107960LOC120102702small nucleolar RNA SNORA1749700031297000443Rat
41251011LOC120102700small nucleolar RNA SNORA1749709688597097017Rat
9438141LOC103690610Ig kappa chain V-V region L6-like49711573297119085Rat
41170451LOC120102696small nucleolar RNA SNORA1749713082197130958Rat
41215295LOC120102732small nucleolar RNA SNORA1749715488097155000Rat
41112623LOC120102736small nucleolar RNA SNORA1749717502897175121Rat
40942068LOC120102704small nucleolar RNA SNORA1749722965597229787Rat
9102747LOC103692159Ig kappa chain V-V region L6-like49734899497349801Rat
40977765LOC120102731small nucleolar RNA SNORA1749748051797480618Rat
11364654LOC108350814Ig kappa chain V-V region L6-like49749492997495415Rat
9439280LOC103692161uncharacterized LOC10369216149757291097573408Rat
40936449LOC120102716small nucleolar RNA SNORA1749757666097576791Rat
2322825LOC100363522hypothetical protein LOC10036352249780939697810460Rat
9330732LOC103690609NADH dehydrogenase [ubiquinone] 1 beta subcomplex subunit 3 pseudogene49782873997829070Rat
11052016LOC102551948Ig kappa chain V-II region RPMI 6410-like49791651997917533Rat
41045910LOC120102715small nucleolar RNA SNORA1749796989597970021Rat
6495277LOC100911032uncharacterized LOC10091103249800125798002145Rat
41327009LOC120102729small nucleolar RNA SNORA1749800423498004360Rat
1561722RGD1561722similar to immunoglobulin light chain49813078798131675Rat
41094682LOC120102721small nucleolar RNA SNORA1749813375998133886Rat
41353377LOC120102733small nucleolar RNA SNORA1749823881598238917Rat
41169229LOC120102722small nucleolar RNA SNORA1749826317398263300Rat
41125163LOC120102717small nucleolar RNA SNORA1749849391198494037Rat
41253364LOC120102725small nucleolar RNA SNORA1749858397298584104Rat
11051993LOC102557466Ig kappa chain V-II region 26-10-like49858862498589555Rat
41263518LOC120102530immunoglobulin kappa variable 1-9-like49887513898875778Rat
41365694LOC120102297immunoglobulin kappa variable 1D-33-like49896141998965084Rat
41075263LOC120102531immunoglobulin kappa variable 1-9-like49901452399015161Rat
41277236LOC120102585U6 spliceosomal RNA49914578099145884Rat
41180823LOC120102592U6 spliceosomal RNA49916978599169889Rat
41205249LOC120102578U6 spliceosomal RNA49920039799200501Rat
41120707LOC120102598U6 spliceosomal RNA49921932699219429Rat
40974521LOC120102579U6 spliceosomal RNA49925367099253774Rat
41114178LOC120102583U6 spliceosomal RNA49926872299268826Rat
41108878LOC120102533Ig kappa chain V-V region K2-like49928277299285103Rat
41107864LOC120102589U6 spliceosomal RNA49929007299290176Rat
41033320LOC120102595U6 spliceosomal RNA49930944099309544Rat
41049106LOC120102534Ig kappa chain V-V region K2-like49932280799323306Rat
40946187LOC120102535immunoglobulin kappa variable 1-39-like49934046699340968Rat
40961802LOC120102590U6 spliceosomal RNA49934623299346336Rat
41270403LOC120093116immunoglobulin kappa variable 1-5-like49936335399363814Rat
2320855LOC100364505hypothetical LOC10036450549936447499369594Rat
2323358LOC100363282Igk protein-like49938974799390292Rat
40952956LOC120102536actin-related protein 2/3 complex subunit 5-like49942323999424376Rat
41362761LOC120102298immunoglobulin kappa variable 1D-33-like49953181099532249Rat
11051991LOC102551297Ig kappa chain V-II region 26-10-like49976417199765272Rat
2321092LOC100360968mCG142527-like49994200399942688Rat
2320327LOC100361338hypothetical LOC1003613384100209006100209643Rat
7521956LOC102553480zinc finger protein 120-like4100210123100220831Rat
2319569LOC100361705rCG64259-like4100487837100488968Rat
1561547LOC500180similar to IG KAPPA CHAIN V-V REGION K2 PRECURSOR4100511688100512362Rat
11383082LOC102556911Ig kappa chain V-V region L7-like4100736032100736741Rat
41136119LOC120102301uncharacterized LOC1201023014100744447100787990Rat
11458713LOC103691773Ig kappa chain V-V region K2-like4100774851100775585Rat
11051990LOC102556862Ig kappa chain V-III region MOPC 63-like4100900754100901355Rat
11051998LOC102554848Ig kappa chain V-V region L7-like4101003409101004411Rat
41349965LOC120102541immunoglobulin kappa variable 1D-33-like4101040345101043988Rat
2324539LOC100362515hypothetical LOC1003625154101065901101066416Rat
1587247LOC500184similar to fibrillarin4101138821101139593Rat
11051987LOC102555123Ig kappa chain V-V region K2-like4101195589101196676Rat
1588449LOC498750similar to cDNA sequence BC0055374101258112101260037Rat
41305950LOC120102564U6 spliceosomal RNA4101286236101286342Rat
620468Igkv28immunoglobulin kappa chain variable 28 (V28)4101302903101303452Rat
1592227LOC690737similar to Eukaryotic translation initiation factor 5 (eIF-5)4101363702101365081Rat
41091703LOC120102168rRNA 2'-O-methyltransferase fibrillarin-like4101416548101417555Rat
2318882LOC100365500mCG142154-like4101432815101433399Rat
41381944LOC120102305uncharacterized LOC1201023054101437202101439905Rat
2319042LOC100365438mCG141619-like4101478715101479376Rat
1586004LOC502823similar to fibrillarin4101510664101511950Rat
11497379LOC103691800Ig kappa chain V-IV region-like4101645320101645700Rat
9252629LOC103691799Ig kappa chain V-III region MOPC 63-like4101726300101727506Rat
1586003LOC502825hypothetical LOC5028254101805860101806662Rat
11052049LOC690813Ig kappa chain V-IV region-like4101838285101839132Rat
1563231RGD1563231similar to immunoglobulin kappa-chain VK-14102208069102208647Rat
1564696RGD1564696similar to immunoglobulin light chain variable region4102304440102305139Rat
2321310LOC100360848rCG64259-like4102343796102344458Rat
1597311LOC690381similar to glycosyltransferase-like domain containing 1 isoform b4102443892102445203Rat
2320908LOC100361052rCG64257-like4102446979102447648Rat
41008980LOC120102656small nucleolar RNA SNORA484102572182102572325Rat
7706369LOC102549228histone deacetylase 2-like4102624284102625962Rat
41213638LOC120102652small nucleolar RNA SNORA484102675250102675393Rat
1311377Rpiaribose 5-phosphate isomerase A4102723712102749374Rat
41120297LOC120102574U6 spliceosomal RNA4102735624102735728Rat
41378383LOC120102307uncharacterized LOC1201023074102761831102791308Rat
41398122LOC12010254260S ribosomal protein L21-like4102797216102797569Rat
7583063LOC102549525uncharacterized LOC1025495254102802796102805439Rat
70884Eif2ak3eukaryotic translation initiation factor 2 alpha kinase 34102805495102866914Rat
41401399LOC120102543signal peptidase complex subunit 2-like4102869047102869887Rat
1562720Tex37testis expressed 374102885695102892934Rat
1561816Foxi3forkhead box I34102933487102937655Rat
41364677LOC120102648small nucleolar RNA SNORA484102978143102978286Rat
41236250LOC120102679U1 spliceosomal RNA4103011258103011413Rat
1309144Thnsl2threonine synthase-like 24103112974103132122Rat
2590Fabp1fatty acid binding protein 14103191015103194791Rat
1305105Smyd1SET and MYND domain containing 14103195330103252989Rat
7727476LOC102549052low molecular weight phosphotyrosine protein phosphatase-like4103247606103251384Rat
40934091Trnaa-agctransfer RNA alanine (anticodon AGC)4103258388103258469Rat
1306495Krcc1lysine-rich coiled-coil 14103261566103274672Rat
7647571LOC102552663uncharacterized LOC1025526634103292937103297980Rat
2317Cd8bCD8b molecule4103312596103328523Rat
1587245LOC500198similar to Tubulin alpha-3 chain (Alpha-tubulin 3)4103340394103341605Rat
2316Cd8aCD8a molecule4103365804103370041Rat
1309766Rmnd5arequired for meiotic nuclear division 5 homolog A4103375846103432890Rat
40952747NEWGENE_40938314transfer RNA serine (anticodon AGA)4103396425103396498Rat
620586Rnf103ring finger protein 1034103526456103542529Rat
708556Chmp3charged multivesicular body protein 34103576453103622566Rat
708351Kdm3alysine demethylase 3A4103630907103675073Rat
1305230Reep1receptor accessory protein 14103746004103862347Rat
1307065Mrpl35mitochondrial ribosomal protein L354103865812103876687Rat
1310684Immtinner membrane mitochondrial protein4103880482103919116Rat
1565582Ptcd3Pentatricopeptide repeat domain 34103922440103957445Rat
41156854LOC120102744small nucleolar RNA SNORD944103924328103924464Rat
620824Polr1aRNA polymerase I subunit A4103950051104014022Rat
2319759LOC100361613hypothetical LOC1003616134104043649104046004Rat
41152181LOC120102169uncharacterized LOC1201021694104098343104105838Rat
7553872LOC102556495uncharacterized LOC1025564954104131807104134481Rat
620875St3gal5ST3 beta-galactoside alpha-2,3-sialyltransferase 54104134553104192560Rat
41176189LOC120102561U6 spliceosomal RNA4104156903104157009Rat
7524413LOC102546367uncharacterized LOC1025463674104166361104168839Rat
1561512Atoh8atonal bHLH transcription factor 84104259992104292168Rat
41177686LOC120102309uncharacterized LOC1201023094104285634104289300Rat
41062867LOC120102308uncharacterized LOC1201023084104292221104321842Rat
621700Sftpbsurfactant protein B4104359303104368439Rat
1308103Usp39ubiquitin specific peptidase 394104373908104406413Rat
1587471LOC691113hypothetical protein LOC6911134104402553104408317Rat
619998Tmem150atransmembrane protein 150A4104410271104414630Rat
1359698Rnf181ring finger protein 1814104414586104421433Rat
620419Vamp5vesicle-associated membrane protein 54104423813104435059Rat
620421Vamp8vesicle-associated membrane protein 84104442383104452884Rat
68383Ggcxgamma-glutamyl carboxylase4104469737104485631Rat
619985Mat2amethionine adenosyltransferase 2A4104489877104495447Rat
11355186LOC108350864ATP synthase subunit g, mitochondrial pseudogene4104555149104555540Rat
1587427Sh2d6SH2 domain containing 64104566210104574176Rat
1311724Capgcapping actin protein, gelsolin like4104594743104611856Rat
41109258NEWGENE_40926764transfer RNA proline (anticodon AGG)4104598962104599042Rat
1306408Elmod3ELMO domain containing 34104614665104653122Rat
628802Retsatretinol saturase4104653306104662069Rat
620445Tgoln2trans-golgi network protein 24104663356104671208Rat
7699711LOC102549526uncharacterized LOC1025495264104672363104687654Rat
1311671Tcf7l1transcription factor 7 like 14104680734104846086Rat
7562795LOC102549458uncharacterized LOC1025494584104767270104769717Rat
1591490Kcmf1potassium channel modulatory factor 14104888452104950234Rat
41358316LOC120102632small nucleolar RNA SNORA36 family4104895641104895763Rat
41116383LOC120102170thymosin beta-10-like4104962532104963461Rat
41083750LOC120102310uncharacterized LOC1201023104104988896104994531Rat
62022Tmsb10thymosin, beta 104105009959105011095Rat
41323307LOC120102777U4 spliceosomal RNA4105038037105038123Rat
621797Dnah6dynein, axonemal, heavy chain 64105064123105284361Rat
7639290LOC102550335prohibitin-like4105082392105084201Rat
41389009LOC120102554U4 spliceosomal RNA4105248170105248327Rat
41141586LOC120102311uncharacterized LOC1201023114105288960105294181Rat
619821Suclg1succinate-CoA ligase GDP/ADP-forming subunit alpha4105308236105337595Rat
1334150Olr822-psolfactory receptor pseudogene 8224105479255105480121Rat
1562515RGD1562515similar to RIKEN cDNA 4931417E114105520442105521542Rat
1586033LOC500205similar to polypyrimidine tract binding protein 1 isoform b4105696627105698961Rat
11472949LOC108350866uncharacterized LOC1083508664105957318105981816Rat
1586032LOC500206similar to src homology 2 domain-containing transforming protein C14105988811105991749Rat
41373605LOC120102663small nucleolar RNA SNORA174106494538106494669Rat
41121066LOC120102312protein FAM50A-like4106608389106609566Rat
11468430Trnas-gcu6transfer RNA serine (anticodon GCU) 64106831010106831091Rat
1586002LOC502848similar to cactin CG1676-PA4106867095106868859Rat
2320685LOC100361176solute carrier family 25, member 394107360735107361799Rat
1585901LOC679688hypothetical protein LOC6796884107575688107585650Rat
41247803LOC120102720small nucleolar RNA SNORA174108118729108118852Rat
2316392Vom1r-ps76vomeronasal 1 receptor pseudogene 764108297905108298689Rat
2320349LOC100361316hypothetical LOC1003613164108405683108421146Rat
41229891LOC120102544uncharacterized LOC1201025444108434706108534978Rat
41048538LOC120102701U1 spliceosomal RNA4108539249108539412Rat
40933947LOC120102313uncharacterized LOC1201023134108573617108627858Rat
11402703LOC10835081760S ribosomal protein L27a-like4108745019108755613Rat
41291582LOC120102545nucleophosmin-like4108791940108792947Rat
41103026LOC120102546ATP synthase subunit g, mitochondrial-like4108818020108821027Rat
1584754LOC679788similar to ribosomal protein L64108858856108967329Rat
41321497LOC120102565U6 spliceosomal RNA4109168372109168478Rat
1305060Ctnna2catenin alpha 24109293978110443413Rat
1585921LRRTM1leucine rich repeat transmembrane neuronal 14109701815109718924Rat
11385872LOC108350868glyceraldehyde-3-phosphate dehydrogenase pseudogene4110616441110617544Rat
41172269LOC120102644U11 spliceosomal RNA4110662076110662209Rat
3254Reg3bregenerating family member 3 beta4110861775110865015Rat
2319874LOC100361595hypothetical LOC1003615954110867647110870075Rat
621401Reg3aregenerating islet-derived 3 alpha4110872398110875157Rat
3552Reg1aregenerating family member 1 alpha4110892451110895115Rat
7688358LOC102556035uncharacterized LOC1025560354110915998110999186Rat
3256Reg3gregenerating family member 3 gamma4110922805110927803Rat
7552576LOC102546411syntaxin-binding protein 3-like4111049442111054421Rat
7708743LOC102556090uncharacterized LOC1025560904111069839111075961Rat
41016841LOC120102668U1 spliceosomal RNA4111394809111394970Rat
41323577LOC120102314uncharacterized LOC1201023144111407391111454991Rat
41096961LOC120102643small nucleolar RNA SNORA514111475412111475543Rat
41159196LOC120102709small nucleolar RNA SNORA174111773083111773205Rat
1560707Lrrtm4leucine rich repeat transmembrane neuronal 44112545874113338713Rat
1586028LOC500220similar to L-lactate dehydrogenase A chain (LDH-A) (LDH muscle subunit) (LDH-M)4113345717113349041Rat
1595483LOC680141hypothetical protein LOC6801414113401645113402234Rat
41195793LOC120102315uncharacterized LOC1201023154113504541113533897Rat
1586001LOC502850similar to mannose-6-phosphate receptor binding protein 14113755510113756823Rat
1594207LOC680224similar to Aspartate aminotransferase, mitochondrial precursor (Transaminase A) (Glutamate oxaloacetate transaminase 2)4114189936114190548Rat
40972357LOC120102677small nucleolar RNA SNORA174114390354114390483Rat
6493044LOC100911370uncharacterized LOC1009113704114459942114463108Rat
1304792Gcfc2GC-rich sequence DNA-binding factor 24114481613114519268Rat
1587381Mrpl19mitochondrial ribosomal protein L194114521824114526053Rat
1559797Eva1aeva-1 homolog A, regulator of programmed cell death4114593773114643011Rat
7520921LOC102547617peroxiredoxin-6-like4114684131114684952Rat
3811Tacr1tachykinin receptor 14114920844115089733Rat
41166952LOC120102316uncharacterized LOC1201023164115098139115106023Rat
1307793Pole4DNA polymerase epsilon 4, accessory subunit4115165285115171097Rat
7711844LOC102547728uncharacterized LOC1025477284115172801115177968Rat
41162732LOC120102317uncharacterized LOC1201023174115217376115228513Rat
2797Hk2hexokinase 24115234509115283530Rat
1592965Rps27a-ps18ribosomal protein S27a, pseudogene 184115353266115353807Rat
3658Sema4fssemaphorin 4F4115411411115437721Rat
1563842M1apmeiosis 1 associated protein4115445910115536745Rat
1596846LOC680041similar to 40S ribosomal protein S254115473792115474236Rat
41270105LOC120102319uncharacterized LOC1201023194115515273115521277Rat
1309499Dok1docking protein 14115537453115540464Rat
1311011Loxl3lysyl oxidase-like 34115540640115556958Rat
1308906Htra2HtrA serine peptidase 24115556914115560202Rat
1591777Aup1AUP1, lipid droplet regulating VLDL assembly factor4115560274115563346Rat
1591766Dqx1DEAQ box RNA-dependent ATPase 14115563497115572598Rat
1595506Tlx2T-cell leukemia homeobox 24115573736115576097Rat
1549782Pcgf1polycomb group ring finger 14115576165115587019Rat
1561172Lbx2ladybird homeobox 24115591974115593859Rat
1561779Ccdc142coiled-coil domain containing 1424115606151115616223Rat
1306709Mrpl53mitochondrial ribosomal protein L534115615329115616219Rat
41349825LOC12010231860S ribosomal protein L23-like4115616374115621512Rat
69240Mogsmannosyl-oligosaccharide glucosidase4115621623115625026Rat
1304961Wbp1WW domain binding protein 14115625168115627567Rat
1562258Ino80bINO80 complex subunit B4115627907115631069Rat
11518313LOC108350719uncharacterized LOC1083507194115639631115642945Rat
727874Rtknrhotekin4115640801115657952Rat
1561494Wdr54WD repeat domain 544115654968115677979Rat
1566019LOC500227hypothetical gene supported by BC0794244115661617115667929Rat
62038Dctn1dynactin subunit 14115671024115703824Rat
7718040LOC102548304uncharacterized LOC1025483044115678692115692726Rat
1303009Slc4a5solute carrier family 4 member 54115710101115810330Rat
1311313Mthfd2methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2, methenyltetrahydrofolate cyclohydrolase4115811135115822663Rat
1307014Mob1aMOB kinase activator 1A4115831581115848561Rat
1305975Bola3bolA family member 34115853350115862797Rat
1590584Tet3tet methylcytosine dioxygenase 34115867412115964433Rat
7650908LOC102548361uncharacterized LOC1025483614115950040115953954Rat
1304799Dguokdeoxyguanosine kinase4115987101116014733Rat
41161074LOC120102320uncharacterized LOC1201023204116014672116016904Rat
2027Actg2actin gamma 2, smooth muscle4116021832116046475Rat
619963StambpStam binding protein4116055563116083563Rat
41018082LOC120102321uncharacterized LOC1201023214116080648116105711Rat
621062Clec4fC-type lectin domain family 4, member F4116129023116138744Rat
1565913Cd207CD207 molecule4116155229116161587Rat
41080233LOC120093095glyceraldehyde-3-phosphate dehydrogenase-like4116161930116162927Rat
9389444LOC103692184glyceraldehyde-3-phosphate dehydrogenase pseudogene4116178416116195253Rat
621133Vax2ventral anterior homeobox 24116195576116219597Rat
11488278LOC108350721uncharacterized LOC1083507214116211039116218830Rat
1310619Atp6v1b1ATPase H+ transporting V1 subunit B14116223799116242475Rat
1561200Ankrd53ankyrin repeat domain 534116245561116253018Rat
1305851Tex261testis expressed 2614116253547116260730Rat
11437638LOC10835072260S ribosomal protein L27 pseudogene4116278373116281125Rat
1305057NagkN-acetylglucosamine kinase4116281179116293870Rat
1307930Paip2bpoly(A) binding protein interacting protein 2B4116291376116323422Rat
1309746Zfp638zinc finger protein 6384116355934116479845Rat
1586000LOC502853similar to 40S ribosomal protein S15 (RIG protein)4116373761116374229Rat
41152310LOC120102555U4 spliceosomal RNA4116423166116423314Rat
41233693LOC120102633small nucleolar RNA SNORA54116471399116471527Rat
1311023Dysfdysferlin4116490877116690709Rat
11421296LOC10835086960S ribosomal protein L31 pseudogene4116921291116921723Rat
631379Cyp26b1cytochrome P450, family 26, subfamily b, polypeptide 14117041808117058628Rat
1560638Exoc6bexocyst complex component 6B4117094741117550221Rat
41340927LOC120102746small nucleolar RNA U134117499018117499122Rat
1585860LOC680929similar to serine/threonine kinase4117569008117569987Rat
41129602LOC120102669small nucleolar RNA SNORA174117587214117587345Rat
41035699LOC120102323uncharacterized LOC1201023234117614716117648792Rat
41350806LOC120102322CXXC motif containing zinc binding protein-like4117631660117632934Rat
41282493LOC120102708small nucleolar RNA SNORA174117652870117652993Rat
3753Sprsepiapterin reductase4117671948117676292Rat
41009709LOC120102711small nucleolar RNA SNORA174117685079117685209Rat
1560795RGD1560795similar to Sepiapterin reductase (SPR)4117689458117693286Rat
41359859LOC120102324uncharacterized LOC1201023244117723370117725707Rat
1564002Emx1empty spiracles homeobox 14117725148117741616Rat
628706Sfxn5sideroflexin 54117750213117869826Rat
1592069Rab11fip5RAB11 family interacting protein 54117871301117908819Rat
1584703LOC681041similar to Argininosuccinate synthase (Citrulline--aspartate ligase)4117912849117927565Rat
1562910Notonotochord homeobox4117961163117965402Rat
1309153Smyd5SMYD family member 54117969615117984082Rat
1583112Pradc1protease-associated domain containing 14117984732117989710Rat
1306422Cct7chaperonin containing TCP1 subunit 74117989232118006478Rat
1566130Fbxo41F-box protein 414118007517118039547Rat
2546Egr4early growth response 44118047869118050328Rat
1311590Alms1ALMS1, centrosome and basal body associated protein4118125581118226005Rat
9142253LOC103692181nuclease-sensitive element-binding protein 1 pseudogene4118133630118134656Rat
41200685LOC120102325uncharacterized LOC1201023254118176974118190926Rat
621607Nat8f3N-acetyltransferase 8 (GCN5-related) family member 34118241792118246010Rat
621610Nat8f5N-acetyltransferase 8 (GCN5-related) family member 54118260323118285038Rat
1586026LOC500236similar to elastin microfibril interfacer 14118262387118266491Rat
621609Nat8N-acetyltransferase 84118279521118284671Rat
2324329LOC100362629camello-like 44118303631118305781Rat
1561619Nat8f2N-acetyltransferase 8 (GCN5-related) family member 24118319984118323159Rat
7636572Nat8f4N-acetyltransferase 8 (GCN5-related) family member 44118326092118332591Rat
621606Nat8f1N-acetyltransferase 8 (GCN5-related) family member 14118336208118342923Rat
1309786TprkbTp53rk binding protein4118342910118357908Rat
621605Nat8bN-acetyltransferase 8B4118359445118364351Rat
1307038Dusp11dual specificity phosphatase 114118367673118385183Rat
7547913LOC102549328uncharacterized LOC1025493284118400294118416651Rat
41388537LOC120102326uncharacterized LOC1201023264118416642118424029Rat
1564754Figlafolliculogenesis specific bHLH transcription factor4118432517118436846Rat
2042Add2adducin 24118444594118538505Rat
3849Tgfatransforming growth factor alpha4118618043118700897Rat
11502286LOC108350725uncharacterized LOC1083507254118778620118792730Rat
1304825Fam136afamily with sequence similarity 136, member A4118805129118811046Rat
1584713Snrpgsmall nuclear ribonucleoprotein polypeptide G4118812278118819827Rat
41150073LOC120102639small nucleolar RNA SNORA2/SNORA34 family4118815877118816012Rat
628652Pcyox1prenylcysteine oxidase 14118832114118842951Rat
11508600Trnag-ccc4transfer RNA glycine (anticodon CCC) 44118852419118852489Rat
1305742Tia1TIA1 cytotoxic granule-associated RNA binding protein4118852765118883252Rat
1306746RGD1306746similar to Hypothetical protein MGC255294118887688118916808Rat
41326110LOC120102327uncharacterized LOC1201023274118919046118930645Rat
7589793LOC102554318uncharacterized LOC1025543184118942068118966369Rat
1561319Pcbp1poly(rC) binding protein 14118972698118974722Rat
1584384LOC684976hypothetical protein LOC6849764118986414118988248Rat
7667063LOC102554372uncharacterized LOC1025543724119012925119030617Rat
1560859Asprv1aspartic peptidase, retroviral-like 14119076169119078887Rat
1564525Mxd1max dimerization protein 14119097353119118080Rat
1310925Snrnp27small nuclear ribonucleoprotein U4/U6.U5 subunit 274119123676119133234Rat
1359265Gmcl1germ cell-less 1, spermatogenesis associated4119140598119179891Rat
621171Anxa4annexin A44119184378119241183Rat
41374913LOC120102638small nucleolar RNA SNORA2/SNORA34 family4119234751119234887Rat
1305520Aak1AP2 associated kinase 14119300128119451834Rat
2322888LOC100360057ribosomal protein L22-like4119350406119350886Rat
41257949LOC120102328uncharacterized LOC1201023284119415816119417839Rat
1307823Nfu1NFU1 iron-sulfur cluster scaffold4119458981119480162Rat
1549703Gfpt1glutamine fructose-6-phosphate transaminase 14119496691119546472Rat
1307144Antxr1ANTXR cell adhesion molecule 14119590770119778232Rat
40955934LOC120102329uncharacterized LOC1201023294119717819119729211Rat
1311934Gkn2gastrokine 24119778326119824366Rat
735014Gkn1gastrokine 14119790101119795389Rat
1597754Gkn3gastrokine 34119828859119833924Rat
1562986Bmp10bone morphogenetic protein 104119872066119877694Rat
1562105Arhgap25Rho GTPase activating protein 254119896844119974982Rat
708443Prokr1prokineticin receptor 14120022301120033379Rat
1565557Aplfaprataxin and PNKP like factor4120070471120122656Rat
41291607LOC120102330uncharacterized LOC1201023304120086931120112957Rat
2323785Cfap92cilia and flagella associated protein 924120126565120181575Rat
6497663LOC100910604uncharacterized LOC1009106044120187658120188705Rat
1596494Efcc1EF-hand and coiled-coil domain containing 14120188202120223464Rat
1561601Gp9glycoprotein IX (platelet)4120235539120236874Rat
1565300Rab43RAB43, member RAS oncogene family4120249878120269174Rat
1307688Isy1ISY1 splicing factor homolog4120276535120297227Rat
621807CnbpCCHC-type zinc finger, nucleic acid binding protein4120302768120311694Rat
2323735LOC100362958hypothetical LOC1003629584120318859120320679Rat
41150042LOC120102331uncharacterized LOC1201023314120353804120366389Rat
9124640LOC10369217960S ribosomal protein L34 pseudogene4120362254120362604Rat
1565292Copg1COPI coat complex subunit gamma 14120366540120392502Rat
1559800Hmces5-hydroxymethylcytosine binding, ES cell specific4120392812120415616Rat
11508794LOC108350727uncharacterized LOC1083507274120415759120430399Rat
1565596H1f10H1.10 linker histone4120440515120444705Rat
7650153LOC102552138uncharacterized LOC1025521384120450176120462899Rat
61908Rab7aRAB7A, member RAS oncogene family4120461966120510756Rat
3594Rpn1ribophorin I4120543667120565069Rat
41402798LOC120102332uncharacterized LOC1201023324120567736120572576Rat
9252280LOC103692180uncharacterized LOC1036921804120584341120590943Rat
7562079LOC102554068uncharacterized LOC1025540684120590582120622585Rat
41376499LOC120102333uncharacterized LOC1201023334120648227120658210Rat
2664Gata2GATA binding protein 24120654205120667763Rat
1561981Dnajb8DnaJ heat shock protein family (Hsp40) member B84120681918120685108Rat
1562716Tcp1-ps1t-complex protein 1, pseudogene 14120705645120707491Rat
41153665LOC120102642small nucleolar RNA SNORA294120707367120707503Rat
1560552Eefseceukaryotic elongation factor, selenocysteine-tRNA-specific4120719616120915801Rat
41383162LOC120102335uncharacterized LOC1201023354120733062120737659Rat
41309288LOC12010233460S ribosomal protein L21-like4120819893120820436Rat
68373Ruvbl1RuvB-like AAA ATPase 14120932486120967400Rat
1583218LOC685085similar to 40S ribosomal protein S254120933765120934259Rat
68321Sec61a1SEC61 translocon subunit alpha 14120973519120987871Rat
1585999Kbtbd12kelch repeat and BTB domain containing 124121014636121088701Rat
71039Mgllmonoglyceride lipase4121192187121294187Rat
41199103NEWGENE_40933816transfer RNA valine (anticodon AAC)4121218174121218246Rat
7609272LOC102554878uncharacterized LOC1025548784121271560121272968Rat
41161138LOC120102336uncharacterized LOC1201023364121277566121278416Rat
1359363Abtb1ankyrin repeat and BTB domain containing 14121299302121305667Rat
1305815Podxl2podocalyxin-like 24121306224121338070Rat
1305577Mcm2minichromosome maintenance complex component 24121346434121360962Rat
620858Tpra1transmembrane protein adipocyte associated 14121364093121375275Rat
7696532LOC102554942uncharacterized LOC1025549424121401011121454903Rat
7591615LOC102555035uncharacterized LOC1025550354121464929121479571Rat
7550029LOC102555094uncharacterized LOC1025550944121511450121516890Rat
1591392Prr20eproline rich 20E4121566632121574734Rat
41120855LOC120102337uncharacterized LOC1201023374121604758121615075Rat
41025378LOC120102338uncharacterized LOC1201023384121690045121700753Rat
41127828LOC120102339uncharacterized LOC1201023394121701048121712111Rat
41234562LOC120102340uncharacterized LOC1201023404121723881121732860Rat
1560871Plxna1plexin A14121737934121782901Rat
1304561Chchd6coiled-coil-helix-coiled-coil-helix domain containing 64121803501122024209Rat
41227538LOC120102655small nucleolar RNA SNORA484121944388121944517Rat
1308363Txnrd3thioredoxin reductase 34122072548122112493Rat
1585998LOC502860hypothetical LOC5028604122120684122121727Rat
708509Vom1r90vomeronasal 1 receptor 904122139053122148056Rat
2323419LOC100363221hypothetical LOC1003632214122141718122144244Rat
7512196LOC102547820uncharacterized LOC1025478204122166102122172598Rat
1564573Vom1r92vomeronasal 1 receptor 924122222550122225303Rat
1549740Vom1r93vomeronasal 1 receptor 934122234616122242958Rat
1359098Vom1r94vomeronasal 1 receptor 944122274165122275145Rat
1359401Vom1r95vomeronasal 1 receptor 954122285444122286388Rat
2316391Vom1r-ps77vomeronasal 1 receptor pseudogene 774122311684122312578Rat
1549781Vom1r96vomeronasal 1 receptor 964122334287122335270Rat
708391Vom1r97vomeronasal 1 receptor 974122361863122364034Rat
2316390Vom1r-ps78vomeronasal 1 receptor pseudogene 784122370207122371034Rat
1549694Vom1r98vomeronasal 1 receptor 984122375961122376993Rat
2316389Vom1r-ps79vomeronasal 1 receptor pseudogene 794122394932122395749Rat
2316388Vom1r-ps80vomeronasal 1 receptor pseudogene 804122396580122396744Rat
1589006Vom1r99vomeronasal 1 receptor 994122430887122431711Rat
1549727Vom1r100vomeronasal 1 receptor 1004122468150122471495Rat
708395Vom1r101vomeronasal 1 receptor 1014122499102122500235Rat
708384Vom1r102vomeronasal 1 receptor 1024122536742122545602Rat
2316387Vom1r-ps81vomeronasal 1 receptor pseudogene 814122586021122586924Rat
2316386Vom1r-ps82vomeronasal 1 receptor pseudogene 824122595522122596518Rat
2316385Vom1r-ps83vomeronasal 1 receptor pseudogene 834122608252122609154Rat
2316384Vom1r-ps84vomeronasal 1 receptor pseudogene 844122613355122614266Rat
2316383Vom1r-ps85vomeronasal 1 receptor pseudogene 854122625876122626474Rat
41167200LOC120102341vomeronasal type-1 receptor A144122679045122680064Rat
2316382Vom1r-ps86vomeronasal 1 receptor pseudogene 864122686949122687878Rat
2316408Vom1r103vomeronasal 1 receptor 1034122729553122730533Rat
1587829Vom1r104vomeronasal 1 receptor 1044122768885122769850Rat
1587811LOC685964hypothetical protein LOC6859644122817681122822175Rat
1562825Chst13carbohydrate sulfotransferase 134122824712122837935Rat
1587777Uroc1urocanate hydratase 14122844933122876584Rat
1561296ZxdcZXD family zinc finger C4122882389122914486Rat
1305768Cfap100cilia and flagella associated protein 1004122914693122938994Rat
70918Klf15Kruppel-like factor 154122965718122978403Rat
621294Aldh1l1aldehyde dehydrogenase 1 family, member L14123059989123106471Rat
1589573Slc41a3solute carrier family 41, member 34123109555123154766Rat
1596313Iqsec1IQ motif and Sec7 domain ArfGEF 14123168719123488300Rat
41355210LOC120102710small nucleolar RNA SNORA174123361345123361441Rat
69339Nup210nucleoporin 2104123511559123609874Rat
1311706Hdac11histone deacetylase 114123645873123667407Rat
628685Fbln2fibulin 24123704289123763857Rat
69079Wnt7aWnt family member 7A4123863108123908981Rat
2316381Vom1r-ps87vomeronasal 1 receptor pseudogene 874123930673123931299Rat
1310746Chchd4coiled-coil-helix-coiled-coil-helix domain containing 44123968264123977398Rat
1549711Tmem43transmembrane protein 434123977680123992823Rat
1305760XpcXPC complex subunit, DNA damage recognition and repair factor4123993670124020922Rat
1305971Lsm3LSM3 homolog, U6 small nuclear RNA and mRNA degradation associated4124021023124027269Rat
7539827LOC102548902uncharacterized LOC1025489024124160535124201206Rat
61912Slc6a6solute carrier family 6 member 64124195186124268880Rat
621668Grip2glutamate receptor interacting protein 24124271456124356538Rat
1305225Ccdc174coiled-coil domain containing 1744124392183124419035Rat
11410861LOC10835080140S ribosomal protein S11-like4124395855124398410Rat
1560289RGD1560289similar to chromosome 3 open reading frame 204124422033124470657Rat
7553480LOC102554857uncharacterized LOC1025548574124441221124498179Rat
1305589Fgd5FYVE, RhoGEF and PH domain containing 54124497061124594564Rat
3201Nr2c2nuclear receptor subfamily 2, group C, member 24124610216124666813Rat
41318857LOC120102342uncharacterized LOC1201023424124637670124656902Rat
1308770Mrps25mitochondrial ribosomal protein S254124668320124680086Rat
1305397Rbsnrabenosyn, RAB effector4124682228124712578Rat
9301889LOC103692187uncharacterized LOC1036921874124712546124722083Rat
3903Trhthyrotropin releasing hormone4124742111124777094Rat
1306723Prickle2prickle planar cell polarity protein 24124869552125214862Rat
1306889Adamts9ADAM metallopeptidase with thrombospondin type 1 motif, 94125290633125462988Rat
7661237LOC102554570uncharacterized LOC1025545704125334112125359366Rat
40953411LOC120102343uncharacterized LOC1201023434125386934125418673Rat
7590189LOC102555978uncharacterized LOC1025559784125459772125773012Rat
41288887LOC120102344uncharacterized LOC1201023444125657909125684813Rat
41091722LOC120102670small nucleolar RNA SNORA174125861717125861845Rat
40993191LOC120102703small nucleolar RNA SNORA174126026597126026707Rat
41156543LOC120102345uncharacterized LOC1201023454126097347126157088Rat
9070006LOC103692189uncharacterized LOC1036921894126124290126129626Rat
1586441LOC688659similar to acidic ribosomal phosphoprotein P04126179018126180835Rat
41377972LOC120102346uncharacterized LOC1201023464126183463126186067Rat
1586025Magi1membrane associated guanylate kinase, WW and PDZ domain containing 14126205667126811354Rat
41162866NEWGENE_6576114transfer RNA threonine (anticodon AGU)4126353506126353587Rat
41070385LOC120102636small nucleolar RNA SNORA444126415989126416119Rat
41132129LOC120102495gamma-aminobutyric acid receptor-associated protein-like4126518341126548868Rat
2319160LOC100361920dynein light chain 1-like4126581955126582940Rat
40930702LOC120102497uncharacterized LOC1201024974126723866126732961Rat
41081553LOC120102498uncharacterized LOC1201024984126742553126760176Rat
41306468LOC120102496uncharacterized LOC1201024964126790194126802525Rat
1585997LOC502863similar to transcription elongation factor B (SIII), polypeptide 24126816689126817049Rat
2320195LOC100364870hypothetical LOC1003648704126884577126890225Rat
41394821LOC120102171uncharacterized LOC1201021714126995970126999766Rat
2323903LOC100362876hypothetical LOC1003628764127029644127030164Rat
1308811Slc25a26solute carrier family 25 member 264127036704127131022Rat
1306788Lrig1leucine-rich repeats and immunoglobulin-like domains 14127130899127230956Rat
1590113LOC687056hypothetical protein LOC6870564127274472127275699Rat
41121964LOC120102172cytochrome c oxidase subunit 6C-2-like4127416018127417910Rat
11398915Trnal-aag2transfer RNA leucine (anticodon AAG) 24127454175127454256Rat
41018384LOC120102173proteasome subunit beta type-3-like4127536885127537501Rat
1563166Kbtbd8kelch repeat and BTB domain containing 84127675967127688785Rat
1586024LOC500263similar to heterogeneous nuclear ribonucleoprotein A34127704697127705507Rat
1583000LOC688907similar to Elongation factor 1-gamma (EF-1-gamma) (eEF-1B gamma)4127841801127847162Rat
1305008Suclg2succinate-CoA ligase GDP-forming subunit beta4128067031128337146Rat
41031424LOC120102347uncharacterized LOC1201023474128336735128342363Rat
1564292RGD1564292similar to Nucleolar protein 14128479630128481920Rat
7643253LOC102550115ribosome biogenesis regulatory protein homolog4128616299128619872Rat
7508836LOC102549269uncharacterized LOC1025492694128652499128742024Rat
1563030Tafa1TAFA chemokine like family member 14128738028129244223Rat
11081189LOC500265nucleoporin 50-like4128787567128789296Rat
40949626LOC120102500uncharacterized LOC1201025004129086996129146558Rat
41335347LOC120102596U6 spliceosomal RNA4129166306129166407Rat
41004547LOC120102499uncharacterized LOC1201024994129197518129420528Rat
1597443Tafa4TAFA chemokine like family member 44129437466129671320Rat
1359357EogtEGF domain specific O-linked N-acetylglucosamine transferase4129718897129756558Rat
620551Tmf1TATA element modulatory factor 14129759952129785705Rat
41011708LOC120102630small nucleolar RNA SNORA36 family4129770615129770745Rat
621084Uba3ubiquitin-like modifier activating enzyme 34129789526129810707Rat
708572Arl6ip5ADP-ribosylation factor like GTPase 6 interacting protein 54129810650129838628Rat
41263255LOC120102348uncharacterized LOC1201023484129815657129821673Rat
1564924Lmod3leiomodin 34129843964129858684Rat
620172Frmd4bFERM domain containing 4B4129895401130222070Rat
41178684LOC120102547protein prune homolog 2-like4130327921130328679Rat
41317950LOC120102724small nucleolar RNA SNORA174130392379130392510Rat
3092Mitfmelanocyte inducing transcription factor4130409020130621145Rat
2323009Mdfic2MyoD family inhibitor domain containing 24130845260130948054Rat
41327928LOC120102566U6 spliceosomal RNA4131099002131099108Rat
1308669Foxp1forkhead box P14131559599132155092Rat
41126171LOC120102771small nucleolar RNA U34132053395132053495Rat
7669867LOC102555037uncharacterized LOC1025550374132153125132201203Rat
1586185Eif4e3eukaryotic translation initiation factor 4E family member 34132258502132301808Rat
71067Gpr27G protein-coupled receptor 274132328364132329497Rat
1561565Ier3ip1immediate early response 3 interacting protein 14132331372132342316Rat
620280Prok2prokineticin 24132346681132361754Rat
41337025LOC120102349uncharacterized LOC1201023494132466966132473095Rat
41233243LOC120102174macrophage migration inhibitory factor-like4132485334132485702Rat
9229745LOC103692198uncharacterized LOC1036921984132521989132539049Rat
41262491LOC120102350uncharacterized LOC1201023504132559007132560324Rat
11380835LOC108350738uncharacterized LOC1083507384132797064132799375Rat
40980164LOC120102351RING1 and YY1 binding protein4132876260132929075Rat
1307077RybpRING1 and YY1 binding protein4132876361132927580Rat
41024974LOC120102352uncharacterized LOC1201023524133042414133050061Rat
41314095LOC120102353uncharacterized LOC1201023534133100432133108825Rat
41140809LOC120102666small nucleolar RNA SNORA174133135428133135559Rat
41093674LOC120102354uncharacterized LOC1201023544133142571133164384Rat
1310610Shq1SHQ1, H/ACA ribonucleoprotein assembly factor4133213357133305586Rat
41162659LOC120102355actin, cytoplasmic 2-like4133306869133313492Rat
1586482Gxylt2glucoside xylosyltransferase 24133347230133449708Rat
1307312Ppp4r2protein phosphatase 4, regulatory subunit 24133454555133495486Rat
7731047LOC102555697uncharacterized LOC1025556974133577659133647925Rat
11480110LOC108350739uncharacterized LOC1083507394133581761133598613Rat
41053760LOC120102356uncharacterized LOC1201023564133648139133660193Rat
41049156LOC120102357uncharacterized LOC1201023574133676076133686958Rat
41070524LOC120102175UPF0729 protein C18orf32 homolog4133734357133734611Rat
1592353LOC689407similar to smoothelin isoform a4133742253133744275Rat
1305250Pdzrn3PDZ domain containing RING finger 34133770736133996959Rat
41163084LOC120102358uncharacterized LOC1201023584133818078133839199Rat
41240645LOC120102176uncharacterized LOC1201021764134072462134077268Rat
11469179LOC108350740uncharacterized LOC1083507404134210738134238146Rat
41246601LOC120102177uncharacterized LOC1201021774134335166134338245Rat
1586021LOC500273similar to tubulin, alpha 8 like 34134342304134343235Rat
1592322LOC689440similar to 60S ribosomal protein L134134558719134564121Rat
3253Cntn3contactin 34134841268135214460Rat
41352693LOC120102755U2 spliceosomal RNA4134969601134969762Rat
41127226LOC120102641small Cajal body-specific RNA 164135361243135361421Rat
41361992LOC120102607U6 spliceosomal RNA4135562032135562145Rat
40943387LOC120102178uncharacterized LOC1201021784135763696135765816Rat
11484912LOC10835080760S ribosomal protein L30-like4135972768135975698Rat
41072523LOC120102179uncharacterized LOC1201021794136171929136192655Rat
620122Chl1cell adhesion molecule L1-like4136291504136505830Rat
6492017LOC10091159460S ribosomal protein L4-like4136330114136331466Rat
41313119LOC120102359uncharacterized LOC1201023594136616052136628878Rat
41102695LOC120102611U7 small nuclear RNA4136623724136623786Rat
41351198LOC120102180uncharacterized LOC1201021804136636923136641514Rat
7565639LOC102549329uncharacterized LOC1025493294136745668136762242Rat
1585995LOC502869similar to karyopherin (importin) alpha 24136818724136820326Rat
1560353RGD1560353similar to 60S ribosomal protein L134136905705136907969Rat
1586020LOC500277similar to Ras-GTPase-activating protein binding protein 1 (ATP-dependent DNA helicase VIII) (GAP SH3-domain binding protein 1) (G3BP-1) (HDH-VIII)4136952803136954495Rat
41344928LOC120102718small nucleolar RNA SNORA174137032326137032442Rat
1563492RGD1563492similar to ATP-binding cassette, sub-family F (GCN20), member 24137093916137096351Rat



QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
61351Bp33Blood pressure QTL 330.0018arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)4127716890Rat
61408Scl23Serum cholesterol level QTL 230.0005blood HDL phospholipid amount (VT:0010504)serum high density lipoprotein phospholipid level (CMO:0001567)4127716890Rat
724557Plsm1Polydactyly-luxate syndrome (PLS) morphotypes QTL 10.0003forelimb integrity trait (VT:0010562)front foot phalanges count (CMO:0001947)4127716890Rat
1641905Colcr1Colorectal carcinoma resistance QTL 14.30.0003intestine integrity trait (VT:0010554)benign colorectal tumor surface area measurement (CMO:0001799)4129494328Rat
61333Gluco16Glucose level QTL 164.30.00001adipocyte glucose uptake trait (VT:0004185)absolute change in adipocyte glucose uptake (CMO:0000873)4130372989Rat
9589097Slep11Serum leptin concentration QTL 115.090.001blood leptin amount (VT:0005667)plasma leptin level (CMO:0000781)4131934116Rat
8552903Pigfal2Plasma insulin-like growth factor 1 level QTL 27.3blood insulin-like growth factor amount (VT:0010479)plasma insulin-like growth factor 1 level (CMO:0001299)4131934116Rat
9589046Scfw2Subcutaneous fat weight QTL 25.540.001subcutaneous adipose mass (VT:1000472)abdominal subcutaneous fat pad weight (CMO:0002069)4131934116Rat
9590100Sffal4Serum free fatty acids level QTL 47.360.05blood free fatty acid amount (VT:0001553)plasma free fatty acids level (CMO:0000546)4131934116Rat
738021Hcar13Hepatocarcinoma resistance QTL 134.3liver integrity trait (VT:0010547)liver nonremodeling tumorous lesion volume to total liver volume ratio (CMO:0001464)4132584199Rat
1357341Gluco5Glucose level QTL 56.4adipocyte free fatty acid secretion trait (VT:0010465)absolute change in adipocyte free fatty acid secretion per unit volume (CMO:0001446)4133250345Rat
1357343Gluco4Glucose level QTL 40.00002adipocyte glucose uptake trait (VT:0004185)adipocyte maximal glucose uptake to basal glucose uptake ratio (CMO:0000874)4133250345Rat
61415Eae11Experimental allergic encephalomyelitis QTL 112.9nervous system integrity trait (VT:0010566)post-insult time to onset of experimental autoimmune encephalomyelitis (CMO:0001422)4139505420Rat
634323Hc2Hypercalciuria QTL 22.15urine calcium amount (VT:0002985)urine calcium excretion rate (CMO:0000763)421079645210796Rat
619616Bp79Blood pressure QTL 790.0292arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)4521460278882945Rat
2303168Bp330Blood pressure QTL 3304.250.017arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)45214602146446691Rat
2302371Stl22Serum triglyceride level QTL 225.15blood triglyceride amount (VT:0002644)serum triglyceride level (CMO:0000360)4521829457114705Rat
1358203Stl19Serum triglyceride level QTL 192.80.002blood triglyceride amount (VT:0002644)serum triglyceride level (CMO:0000360)4521829465958103Rat
1358201Gluco12Glucose level QTL121.6adipocyte glucose uptake trait (VT:0004185)adipocyte maximal glucose uptake (CMO:0000870)4521839229593287Rat
631642Stl2Serum triglyceride level QTL 23.3blood triglyceride amount (VT:0002644)serum triglyceride level (CMO:0000360)4521917856647776Rat
631209Bw2Body weight QTL24.2retroperitoneal fat pad mass (VT:0010430)retroperitoneal fat pad weight to body weight ratio (CMO:0000635)4994088544463908Rat
1300141Bp178Blood pressure QTL 178arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)41002490139524530Rat
6478724Anxrr35Anxiety related response QTL 350.00449defecation behavior trait (VT:0010462)defecation measurement (CMO:0000997)41008408955084089Rat
6478766Anxrr47Anxiety related response QTL 470.09637locomotor behavior trait (VT:0001392)number of entries into a discrete space in an experimental apparatus (CMO:0000960)41008408955084089Rat
6478769Anxrr48Anxiety related response QTL 480.02514locomotor behavior trait (VT:0001392)amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)41008408955084089Rat
8694374Bw155Body weight QTL 1553.390.001body lean mass (VT:0010483)lean tissue morphological measurement (CMO:0002184)41008408955084089Rat
9590304Scort17Serum corticosterone level QTL 174.960.001blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)41008408955084089Rat
8552906Pigfal3Plasma insulin-like growth factor 1 level QTL 3blood insulin-like growth factor amount (VT:0010479)plasma insulin-like growth factor 1 level (CMO:0001299)41008408955084089Rat
631261Tcas3Tongue tumor susceptibility QTL 36.88tongue integrity trait (VT:0010553)number of squamous cell tumors of the tongue with diameter greater than 3 mm (CMO:0001950)41081417091360527Rat
2316958Gluco58Glucose level QTL 5810blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)411320076180699135Rat
2303585Bw86Body weight QTL 864body mass (VT:0001259)body weight (CMO:0000012)41467806559678065Rat
2313401Anxrr27Anxiety related response QTL 27aggression-related behavior trait (VT:0015014)tameness/aggressiveness composite score (CMO:0002136)41793350862933508Rat
70222Eae2Experimental allergic encephalomyelitis QTL 24.3nervous system integrity trait (VT:0010566)experimental autoimmune encephalomyelitis incidence/prevalence measurement (CMO:0001046)42133334339505420Rat
1354665Stl10Serum triglyceride level QTL 103.57blood triglyceride amount (VT:0002644)serum triglyceride level (CMO:0000360)42133334344463908Rat
61412Pia2Pristane induced arthritis QTL 23.9joint integrity trait (VT:0010548)post-insult time to onset of experimental arthritis (CMO:0001450)42133334362278020Rat
8552803Bw144Body weight QTL 14416body mass (VT:0001259)change in body weight to body weight ratio (CMO:0002216)42271068534430484Rat
6909122Insul22Insulin level QTL 224.63blood insulin amount (VT:0001560)plasma insulin level (CMO:0000342)42690728575585128Rat
6909128Pancm4Pancreatic morphology QTL 411.35pancreas mass (VT:0010144)pancreas wet weight (CMO:0000626)42690728575585128Rat
8655906Rf60Renal function QTL 603.8blood creatinine amount (VT:0005328)creatinine clearance (CMO:0000765)42949419581006281Rat
12798520Anxrr55Anxiety related response QTL 554.450.01locomotor behavior trait (VT:0001392)number of rearing movements with lid-pushing in an experimental apparatus (CMO:0002715)432583980114627242Rat
11530004Niddm71Non-insulin dependent diabetes mellitus QTL 710.001blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)43258419952754138Rat
8655949Rf62Renal function QTL 6222blood urea nitrogen amount (VT:0005265)plasma urea nitrogen level (CMO:0000586)43443011944463908Rat
8552782Vie1Viral induced encephalitis QTL 126.4brain integrity trait (VT:0010579)encephalitis incidence/prevalence measurement (CMO:0002361)43443048482490359Rat
8552801Bw143Body weight QTL 1437.3body mass (VT:0001259)change in body weight to body weight ratio (CMO:0002216)43443048482490359Rat
8552809Vie5Viral induced encephalitis QTL 525.3brain integrity trait (VT:0010579)encephalitis incidence/prevalence measurement (CMO:0002361)43443048482490359Rat
8655961Kidm43Kidney mass QTL 4318kidney mass (VT:0002707)both kidneys wet weight (CMO:0000085)436303261103194984Rat
4889511Gluco61Glucose level QTL 614.70.001blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)43717795040869000Rat
2290374Gluco32Glucose level QTL 326.27blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)43717795044463908Rat
1300156Bp179Blood pressure QTL 1792.85arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)43846577439524530Rat
1358352Srcrt3Stress Responsive Cort QTL 32.29blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)438465774146803430Rat
61475Aia2Adjuvant induced arthritis QTL 25.8joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)43950527573892441Rat
1331807Rf31Renal function QTL 312.988urine potassium amount (VT:0010539)urine potassium level (CMO:0000128)43952426474726312Rat
1300139Hrtrt6Heart rate QTL 62.85heart pumping trait (VT:2000009)heart rate (CMO:0000002)439524264116179656Rat
61445Strs3Sensitivity to stroke QTL 33cerebrum integrity trait (VT:0010549)post-insult time to onset of cerebrovascular lesion (CMO:0002343)44043338885433388Rat
8694439Bw168Body weight QTL 1689.570.001retroperitoneal fat pad mass (VT:0010430)retroperitoneal fat pad weight to body weight ratio (CMO:0000635)44043341485433414Rat
6893678Bw108Body weight QTL 1082.60.006body mass (VT:0001259)body weight (CMO:0000012)44345797688457976Rat
1576305Emca6Estrogen-induced mammary cancer QTL 65.8mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)444463720155883716Rat
1354612Foco1Food consumption QTL 18.87eating behavior trait (VT:0001431)food intake rate (CMO:0000427)444463908148090542Rat
1354660Salc1Saline consumption QTL 111.26drinking behavior trait (VT:0001422)saline drink intake rate (CMO:0001627)444463908148090542Rat
2312567Glom19Glomerulus QTL 191.90.006kidney glomerulus morphology trait (VT:0005325)index of glomerular damage (CMO:0001135)445456990146803430Rat
10450818Scl76Serum cholesterol level QTL 763.60.01blood VLDL cholesterol amount (VT:0005144)blood high density lipoprotein cholesterol level (CMO:0000052)44917811657114705Rat
10450821Scl77Serum cholesterol level QTL 774.10.01blood VLDL cholesterol amount (VT:0005144)blood high density lipoprotein cholesterol level (CMO:0000052)44917811657114705Rat
10450825Scl78Serum cholesterol level QTL 783.70.01blood VLDL cholesterol amount (VT:0005144)blood low density lipoprotein cholesterol level (CMO:0000053)44917811657114705Rat
1298082Stresp4Stress response QTL 4blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)450119848146803430Rat
4889969Bss96Bone structure and strength QTL 964.9tibia size trait (VT:0100001)tibia cortical bone volume (CMO:0001725)45664777678882945Rat
4889972Bss97Bone structure and strength QTL 975.6tibia size trait (VT:0100001)tibia total bone volume (CMO:0001724)45664777678882945Rat
5685009Bmd86Bone mineral density QTL 863.7tibia mineral mass (VT:1000283)bone mineral density (CMO:0001226)45664777678882945Rat
5685012Bmd87Bone mineral density QTL 875.1tibia mineral mass (VT:1000283)bone mineral content (CMO:0001554)45664777678882945Rat
70200Alc18Alcohol consumption QTL 189.2drinking behavior trait (VT:0001422)ethanol intake volume to total fluid intake volume ratio (CMO:0001591)456647873149491524Rat
1641833Alc21Alcohol consumption QTL 218.60.0001drinking behavior trait (VT:0001422)ethanol drink intake rate (CMO:0001407)456698790126192555Rat
631546Bp86Blood pressure QTL 863.2arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)45711443291360801Rat
634311Sach7Saccharin preference QTL 7taste sensitivity trait (VT:0001986)saccharin intake volume to total fluid intake volume ratio (CMO:0001601)457114432102114432Rat
61336Bp21Blood pressure QTL 214.6arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)45711470578881294Rat
1358363Sradr3Stress Responsive Adrenal Weight QTL 36.19adrenal gland mass (VT:0010420)both adrenal glands wet weight (CMO:0000164)457486946102486946Rat
1558651Swd3Spike wave discharge measurement QTL 34.620.000024brain electrophysiology trait (VT:0010557)brain spike-and-wave discharge frequency (CMO:0001742)45843213392991462Rat
631671Iddm11Insulin dependent diabetes mellitus QTL 113.60.0012blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)45863587778886137Rat
738009Sach4Saccharine consumption QTL 44.90.000016consumption behavior trait (VT:0002069)saccharin intake volume to total fluid intake volume ratio (CMO:0001601)459948935154902892Rat
738016Alc16Alcohol consumption QTL 163.60.00015consumption behavior trait (VT:0002069)ethanol drink intake rate to body weight ratio (CMO:0001616)459948935154902892Rat
738031Alc14Alcohol consumption QTL 147.60.00003consumption behavior trait (VT:0002069)ethanol drink intake rate to body weight ratio (CMO:0001616)459948935154902892Rat
1578657Bss12Bone structure and strength QTL 128.9femur morphology trait (VT:0000559)femoral neck cross-sectional area (CMO:0001697)460220938105220938Rat
1578658Bss13Bone structure and strength QTL 138femur strength trait (VT:0010010)femoral neck polar moment of inertia (CMO:0001670)460220938105220938Rat
2300179Bmd50Bone mineral density QTL 505.90.0001femur mineral mass (VT:0010011)volumetric bone mineral density (CMO:0001553)460928534105928534Rat
1549843Bw53Body weight QTL 530.0001body mass (VT:0001259)body weight gain (CMO:0000420)461697658103194791Rat
1549839Bw52Body weight QTL 520.0001body mass (VT:0001259)body weight gain (CMO:0000420)461697658115089733Rat
61418Pia5Pristane induced arthritis QTL 54.5joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)462277855128289560Rat
6478743Anxrr40Anxiety related response QTL 400.83076defecation behavior trait (VT:0010462)defecation rate (CMO:0000998)462753847107753847Rat
6478772Anxrr49Anxiety related response QTL 490.15488defecation behavior trait (VT:0010462)defecation rate (CMO:0000998)462753847107753847Rat
6478684Anxrr30Anxiety related response QTL 300.00087defecation behavior trait (VT:0010462)defecation rate (CMO:0000998)462753847107753847Rat
631651Bp124Blood pressure QTL 1243arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)462879517107879517Rat
7394826Bw126Body weight QTL 1260.002body mass (VT:0001259)body weight gain (CMO:0000420)46293326987483707Rat
8552807Vie4Viral induced encephalitis QTL 47.3brain integrity trait (VT:0010579)encephalitis incidence/prevalence measurement (CMO:0002361)46293350882490359Rat
70192BpQTLcluster5Blood pressure QTL cluster 54.183arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)462933508114921294Rat
70192BpQTLcluster5Blood pressure QTL cluster 54.183arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)462933508114921294Rat
70192BpQTLcluster5Blood pressure QTL cluster 54.183arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)462933508114921294Rat
70192BpQTLcluster5Blood pressure QTL cluster 54.183arterial blood pressure trait (VT:2000000)percent change in mean arterial blood pressure (CMO:0002035)462933508114921294Rat
70192BpQTLcluster5Blood pressure QTL cluster 54.183arterial blood pressure trait (VT:2000000)percent change in systolic blood pressure (CMO:0000747)462933508114921294Rat
70192BpQTLcluster5Blood pressure QTL cluster 54.183arterial blood pressure trait (VT:2000000)absolute change in pulse pressure (CMO:0001882)462933508114921294Rat
70192BpQTLcluster5Blood pressure QTL cluster 54.183arterial blood pressure trait (VT:2000000)absolute change in mean arterial blood pressure (CMO:0000533)462933508114921294Rat
631674Iddm14Insulin dependent diabetes mellitus QTL 14blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)464528739157573521Rat
2312569Pur19Proteinuria QTL 193.40.001total urine protein amount (VT:0000032)urine total protein excretion rate (CMO:0000756)46588210796130297Rat
2317577Eae24Experimental allergic encephalomyelitis QTL 24nervous system integrity trait (VT:0010566)post-insult time to onset of experimental autoimmune encephalomyelitis (CMO:0001422)46699318572752834Rat
2317577Eae24Experimental allergic encephalomyelitis QTL 24nervous system integrity trait (VT:0010566)percentage of study population developing experimental autoimmune encephalomyelitis during a period of time (CMO:0001047)46699318572752834Rat
2317577Eae24Experimental allergic encephalomyelitis QTL 24nervous system integrity trait (VT:0010566)experimental autoimmune encephalomyelitis severity score (CMO:0001419)46699318572752834Rat
2306547Iddm38Insulin dependent diabetes mellitus QTL 38blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)46738666970362197Rat
61330Eau1Experimental allergic uveoretinitis QTL 10.0003uvea integrity trait (VT:0010551)experimental autoimmune uveitis score (CMO:0001504)470362013132642728Rat
634344Hcar7Hepatocarcinoma resistance QTL 77.8liver integrity trait (VT:0010547)liver tumorous lesion area to total liver area ratio (CMO:0001075)470808386115808386Rat
634344Hcar7Hepatocarcinoma resistance QTL 77.8liver integrity trait (VT:0010547)liver tumorous lesion number (CMO:0001068)470808386115808386Rat
631646Stl4Serum triglyceride level QTL 46.50.0001blood triglyceride amount (VT:0002644)plasma triglyceride level (CMO:0000548)473169846132642728Rat
724522Bp146Blood pressure QTL 1462.20.0021arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)473630210118630210Rat
2302051Pia28Pristane induced arthritis QTL 285.30.001blood autoantibody amount (VT:0003725)serum immunoglobulin G-type rheumatoid factor level relative to an arbitrary reference serum (CMO:0002112)473630210118630210Rat
70167Bw22Body weight QTL 223.1body mass (VT:0001259)body weight (CMO:0000012)476647384117676292Rat
1357342Bw40Body weight QTL 400.001body mass (VT:0001259)body weight (CMO:0000012)476647384117676292Rat
2306545Iddm39Insulin dependent diabetes mellitus QTL 39blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)47735672177687411Rat
631662Hcar2Hepatocarcinoma resistance QTL 23.10.0003liver integrity trait (VT:0010547)volume of individual liver tumorous lesion (CMO:0001078)478878504123878504Rat
631556Bp135Blood pressure QTL 1350.017arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)478881294117676292Rat
2317586Eae25Experimental allergic encephalomyelitis QTL 259.300000190734863nervous system integrity trait (VT:0010566)experimental autoimmune encephalomyelitis severity score (CMO:0001419)47888281783007655Rat
2317586Eae25Experimental allergic encephalomyelitis QTL 259.300000190734863nervous system integrity trait (VT:0010566)percentage of study population developing experimental autoimmune encephalomyelitis during a period of time (CMO:0001047)47888281783007655Rat
2317586Eae25Experimental allergic encephalomyelitis QTL 259.300000190734863nervous system integrity trait (VT:0010566)post-insult time to onset of experimental autoimmune encephalomyelitis (CMO:0001422)47888281783007655Rat
2317586Eae25Experimental allergic encephalomyelitis QTL 259.300000190734863nervous system integrity trait (VT:0010566)experimental autoimmune encephalomyelitis duration (CMO:0001424)47888281783007655Rat
61364Iddm2Insulin dependent diabetes mellitus QTL 2blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)478885890102684881Rat
738015Pia9Pristane induced arthritis QTL 94.50.048joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)480694870125694870Rat
2306899Bp338Blood pressure QTL 3380.071arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)481006124120102625Rat
1641919Alc22Alcohol consumption QTL 220.0005drinking behavior trait (VT:0001422)ethanol drink intake rate (CMO:0001407)481192555126192555Rat
70177Xhs1X-ray hypersensitivity QTL 125.1intestine integrity trait (VT:0010554)post-insult time to onset of moribundity (CMO:0001896)482798864152731274Rat
2306794Ean2Experimental allergic neuritis QTL 26.4nervous system integrity trait (VT:0010566)IFNG-secreting splenocyte count (CMO:0002122)48342841995853334Rat
1576316Ept5Estrogen-induced pituitary tumorigenesis QTL 53.8pituitary gland mass (VT:0010496)pituitary gland wet weight (CMO:0000853)483428419177635233Rat
634334Xhs3X-ray hypersensitivity QTL 310intestine integrity trait (VT:0010554)post-insult time to onset of moribundity (CMO:0001896)484728680129854654Rat
1582232Gluco25Glucose level QTL 253.60.0023blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)485253748148090731Rat
12798523Anxrr56Anxiety related response QTL 562.830.05locomotor behavior trait (VT:0001392)amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)485253748150276390Rat
1358202Gluco11Glucose level QTL 112.40.02adipocyte glucose uptake trait (VT:0004185)absolute change in adipocyte glucose uptake (CMO:0000873)485379421167139601Rat
61476Aia3Adjuvant induced arthritis QTL 33.9joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)486730991131730991Rat
1578662Bss15Bone structure and strength QTL 1519.6femur width (VT:1000666)femoral neck width (CMO:0001695)487327165132327165Rat
1578670Bss14Bone structure and strength QTL 1416.4femur morphology trait (VT:0000559)bone trabecular cross-sectional area (CMO:0002311)487327165132327165Rat
2317587Eae26Experimental allergic encephalomyelitis QTL 26nervous system integrity trait (VT:0010566)experimental autoimmune encephalomyelitis severity score (CMO:0001419)488656681103194984Rat
1578655Bmd11Bone mineral density QTL 1111femur mineral mass (VT:0010011)total volumetric bone mineral density (CMO:0001728)490850165135850165Rat
634335Anxrr16Anxiety related response QTL 167.22locomotor behavior trait (VT:0001392)number of entries into a discrete space in an experimental apparatus (CMO:0000960)493308457167139447Rat
631689Scl4Serum cholesterol level QTL 41.90.008blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)495174120140174120Rat
8662350Eae35Experimental allergic encephalomyelitis QTL 356.2blood tumor necrosis factor amount (VT:0008552)inflammatory exudate tumor necrosis factor level (CMO:0001435)4100834579103761084Rat
61434Cia3Collagen induced arthritis QTL 34.8joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)4103194656148194656Rat
2317588Eae27Experimental allergic encephalomyelitis QTL 27nervous system integrity trait (VT:0010566)percentage of study population developing experimental autoimmune encephalomyelitis during a period of time (CMO:0001047)4103194805112478794Rat
2302049Pia32Pristane induced arthritis QTL 325.10.001blood autoantibody amount (VT:0003725)serum immunoglobulin G-type rheumatoid factor level relative to an arbitrary reference serum (CMO:0002112)4105789505150789505Rat
731165Uae21Urinary albumin excretion QTL 212.40.0001urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)4106649412151649412Rat
61406Scwia1Streptococcal cell wall induced arthritis QTL 12.3joint integrity trait (VT:0010548)experimental arthritis severity measurement (CMO:0001459)4106805662151805662Rat
7207480Bss105Bone structure and strength QTL 1058.1femur strength trait (VT:0010010)femur midshaft polar moment of inertia (CMO:0001669)4109827074154827074Rat
1549832Bss3Bone structure and strength QTL 311femur morphology trait (VT:0000559)femur midshaft cortical cross-sectional area (CMO:0001663)4109827074154827074Rat
737821Hcar9Hepatocarcinoma resistance QTL 93.7liver integrity trait (VT:0010547)volume of individual liver tumorous lesion (CMO:0001078)4109866907167139601Rat
1331759Hrtrt13Heart rate QTL 133.54628heart pumping trait (VT:2000009)heart rate (CMO:0000002)4110275411168266883Rat
6478760Anxrr45Anxiety related response QTL 450.06717locomotor behavior trait (VT:0001392)amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)4110870972155870972Rat
6478763Anxrr46Anxiety related response QTL 460.07428locomotor behavior trait (VT:0001392)amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)4110870972155870972Rat
12798519Anxrr54Anxiety related response QTL 542.540.05locomotor behavior trait (VT:0001392)distance moved per unit of time into, out of or within a discrete space in an experimental apparatus (CMO:0001493)4114627026159627026Rat
1300116Hrtrt5Heart rate QTL 53.76heart pumping trait (VT:2000009)heart rate (CMO:0000002)4116179486151161268Rat
724535Cm18Cardiac mass QTL 182.6heart mass (VT:0007028)calculated heart weight (CMO:0000073)4118856416163856416Rat
1331802Srn5Serum renin concentration QTL 53.045renin activity (VT:0005581)plasma renin activity level (CMO:0000116)4119428175157578333Rat
12798527Anxrr58Anxiety related response QTL 584.110.05locomotor behavior trait (VT:0001392)distance moved per unit of time into, out of or within a discrete space in an experimental apparatus (CMO:0001493)4119463257147278687Rat
70201Gcr1Gastric cancer resistance QTL 12.7stomach morphology trait (VT:0000470)stomach tumor susceptibility score (CMO:0002043)4120260281147278687Rat
2293840Kiddil9Kidney dilation QTL 92.9kidney pelvis morphology trait (VT:0004194)hydronephrosis severity score (CMO:0001208)4120926564148090731Rat
634347Hcar8Hepatocarcinoma resistance QTL 85.8liver integrity trait (VT:0010547)liver tumorous lesion area to total liver area ratio (CMO:0001075)4123143783168143783Rat
631683Bp116Blood pressure QTL 1160.0001arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)4124303370169303370Rat
6478778Anxrr51Anxiety related response QTL 510.25384locomotor behavior trait (VT:0001392)measurement of voluntary locomotion into, out of or within a discrete space in an experimental apparatus (CMO:0000957)4124778595169778595Rat
7411558Bw133Body weight QTL 13313.840.001body mass (VT:0001259)body weight gain (CMO:0000420)4125590636170590636Rat
61451Ciaa4CIA Autoantibody QTL 43.1blood autoantibody amount (VT:0003725)calculated serum anti-rat type 2 collagen autoantibody titer (CMO:0001281)4126395976167139601Rat
737978Pia23Pristane induced arthritis QTL 235.3joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)4131730738167139601Rat
631511Pia7Pristane induced arthritis QTL 74.3joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)4131730738167139601Rat
1549827Scl46Serum cholesterol level QTL 463.5blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)4132396220177396220Rat
724558Plsm2Polydactyly-luxate syndrome (PLS) morphotypes QTL 20.0003hindlimb integrity trait (VT:0010563)hind foot phalanges count (CMO:0001949)4132422778177422778Rat
61422Cia13Collagen induced arthritis QTL 134.5joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)4132642577167139601Rat
2303623Vencon2Ventilatory control QTL 23.8respiration trait (VT:0001943)minute ventilation (CMO:0000132)4135204660180204660Rat
1578674Bmd12Bone mineral density QTL 123.8femur mineral mass (VT:0010011)cortical volumetric bone mineral density (CMO:0001730)4135699135180699135Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 311959 UniSTS
  500277 UniSTS
  500278 UniSTS
UniSTS 167119 UniSTS