AU028952 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: AU028952

Symbol: AU028952
Also known as:
RGD ID: 5032036
Expected Size: 142 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.2388,472,075 - 88,472,137 (-)MAPPERmRatBN7.2
mRatBN7.232,880,653 - 2,880,704 (+)MAPPERmRatBN7.2
mRatBN7.210103,121,575 - 103,121,717 (+)MAPPERmRatBN7.2
mRatBN7.233,265,635 - 3,265,695 (-)MAPPERmRatBN7.2
mRatBN7.232,536,861 - 2,536,921 (+)MAPPERmRatBN7.2
mRatBN7.21239,811,755 - 239,811,792 (+)MAPPERmRatBN7.2
Rnor_6.010106,902,737 - 106,902,878NCBIRnor6.0
Rnor_5.010106,542,342 - 106,542,483UniSTSRnor5.0
Celera10101,681,533 - 101,681,674UniSTS


Annotation


References - curated
1. RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer ATCCACATGGTGGAAGGAGA
Reverse Primer AGGGGGCACATGTATACCAC
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
1561933BlnkB-cell linker1239753640239821113Rat
2515Dpp4dipeptidylpeptidase 434696224347043870Rat
3439Ptgs1prostaglandin-endoperoxide synthase 131958401519605589Rat
3454Ptprjprotein tyrosine phosphatase, receptor type, J37640591776561842Rat
68417Ncs1neuronal calcium sensor 131452322014568829Rat
68407Lrp2LDL receptor related protein 235418930554346769Rat
3632Scn2asodium voltage-gated channel alpha subunit 235030278150437504Rat
3635Scn3asodium voltage-gated channel alpha subunit 335014641150258119Rat
3610Rxraretinoid X receptor alpha31098983211076366Rat
71076Lhx2LIM homeobox 232211361922143909Rat
71078Lhx3LIM homeobox 3390264329035122Rat
71096Dnm1dynamin 131560478215648654Rat
68329Pde1aphosphodiesterase 1A36474514065025178Rat
3202Nr4a2nuclear receptor subfamily 4, group A, member 234168984741707036Rat
69266Entpd2ectonucleoside triphosphate diphosphohydrolase 2382135758219094Rat
69277Chrna1cholinergic receptor nicotinic alpha 1 subunit35845476358469832Rat
620004Angptl2angiopoietin-like 231651718516547024Rat
619911Gorasp2golgi reassembly stacking protein 235547444855503570Rat
70920Col5a1collagen type V alpha 1 chain31120842911356715Rat
70929Dgkzdiacylglycerol kinase zeta37790414977946114Rat
70937Mapk8ip1mitogen-activated protein kinase 8 interacting protein 137835505178372946Rat
69070Cd82Cd82 molecule37938736179431847Rat
619731Lrp4LDL receptor related protein 437742960077483593Rat
61869Grb14growth factor receptor bound protein 1434956821049683805Rat
3433Ptgdsprostaglandin D2 synthase382818998284833Rat
620052Atp5mc3ATP synthase membrane subunit c locus 335881053558813185Rat
2736Grin1glutamate ionotropic receptor NMDA type subunit 1381036808130603Rat
3785Stxbp1syntaxin binding protein 131607672516138431Rat
61996F2coagulation factor II37759619677609486Rat
3165Neurod1neuronal differentiation 136436022264363526Rat
2652Gad1glutamate decarboxylase 135536970455410335Rat
71049Hnmthistamine N-methyltransferase365918046623821Rat
71061Kynukynureninase32777864627929470Rat
69427Pdk1pyruvate dehydrogenase kinase 135670582456733040Rat
3229Odf2outer dense fiber of sperm tails 231316098113207223Rat
69364Scn1asodium voltage-gated channel alpha subunit 135095279051071804Rat
69408Lcn2lipocalin 231568068815684033Rat
2452Cyctcytochrome c, testis36129009061297158Rat
619790Rag1recombination activating 138791706187928158Rat
621221Fcnaficolin A384459048449128Rat
628852Cacna1bcalcium voltage-gated channel subunit alpha1 B373808927546104Rat
621112Kcnh7potassium voltage-gated channel subfamily H member 734732933847822122Rat
708460Ppp6cprotein phosphatase 6, catalytic subunit32292981622962123Rat
631407Slc4a10solute carrier family 4 member 1034666507646959088Rat
2958Kcnj3potassium inwardly-rectifying channel, subfamily J, member 333994489640106646Rat
620478Inpp5einositol polyphosphate-5-phosphatase E392167769229539Rat
629476Ggta1glycoprotein alpha-galactosyltransferase 131873298518824916Rat
620852Klhl41kelch-like family member 4135443429154447415Rat
620315Ppigpeptidylprolyl isomerase G35448402354512929Rat
620320Olfm1olfactomedin 131152052211558240Rat
620124Tsc1TSC complex subunit 131196954712018591Rat
621862Atf2activating transcription factor 235871832358795280Rat
2489Dbhdopamine beta-hydroxylase31048826010505245Rat
621350Fnbp1formin binding protein 131431601114386704Rat
621359Tnfaip6TNF alpha induced protein 633650225036521652Rat
708466Pnpla7patatin-like phospholipase domain containing 7377825727861504Rat
620887Wipf1WAS/WASL interacting protein family, member 135831452158416668Rat
621714Sptan1spectrin, alpha, non-erythrocytic 131324116413306047Rat
619922MaddMAP-kinase activating death domain37711433077157865Rat
621330Ambra1autophagy and beclin 1 regulator 137770093677890221Rat
620384Vegp2von Ebners gland protein 2395164579542088Rat
620078Pomt1protein-O-mannosyltransferase 131552071715538579Rat
708507Egfl7EGF-like-domain, multiple 7394046229416879Rat
727779Nek6NIMA-related kinase 632228426922356302Rat
620655Dhrs9dehydrogenase/reductase 935414783454170052Rat
621629Olr414olfactory receptor 41432041326220414197Rat
620361Galnt5polypeptide N-acetylgalactosaminyltransferase 534257362242619881Rat
620253P2rx3purinergic receptor P2X 337008085070124664Rat
621106Kcnt1potassium sodium-activated channel subfamily T member 1386829648736615Rat
61909Nr1h3nuclear receptor subfamily 1, group H, member 337715880877168907Rat
61914Tfpitissue factor pathway inhibitor36953315669582547Rat
619793Rapgef1Rap guanine nucleotide exchange factor 131289834913016234Rat
620174Dync1i2dynein cytoplasmic 1 intermediate chain 235603388256085080Rat
61922Scn7asodium voltage-gated channel alpha subunit 735133584151438308Rat
621253Fapfibroblast activation protein, alpha34713882347207671Rat
620282Golga2golgin A231558386215604279Rat
735019Fut7fucosyltransferase 7382376878242273Rat
620935Cry2cryptochrome circadian regulator 237837499578405001Rat
620139Chn1chimerin 135850982258676774Rat
628859TankTRAF family member-associated NFKB activator34611425346190270Rat
628862Rbm45RNA binding motif protein 4536130597361320950Rat
62076Ptgesprostaglandin E synthase31417789214189236Rat
2344Chrm4cholinergic receptor, muscarinic 437789342577901166Rat
619872Lcn1lipocalin 1395328609537859Rat
3533Ralgdsral guanine nucleotide dissociation stimulator31183968611880059Rat
621741Timm10translocase of inner mitochondrial membrane 1036990839769911943Rat
68350Nr5a1nuclear receptor subfamily 5, group A, member 132246478622486328Rat
621114Ttntitin36165243261924912Rat
621125Sardhsarcosine dehydrogenase31051055310575342Rat
621135Pdclphosducin-like32111016521119763Rat
621143Ssrp1structure specific recognition protein 137012437170134481Rat
621159Il1rninterleukin 1 receptor antagonist371115677127451Rat
619738Ddit4l2DNA-damage-inducible transcript 4-like 235449813654498496Rat
61939Nckap1NCK-associated protein 136541745065491769Rat
620434Pax8paired box 8371857217242363Rat
2331Celcarboxyl ester lipase31188353211891035Rat
68385Cacnb4calcium voltage-gated channel auxiliary subunit beta 433690677137169191Rat
620648Barhl1BarH-like homeobox 131224132712248649Rat
628863Tor1atorsin family 1, member A31425066714257704Rat
727807Hnrnpa3heterogeneous nuclear ribonucleoprotein A336057857460588755Rat
621222Fcnbficolin B31139377111402198Rat
619819NsmfNMDA receptor synaptonuclear signaling and neuronal migration factor378618467870615Rat
628666Slc25a25solute carrier family 25 member 2531570870215742195Rat
620673Strbpspermatid perinuclear RNA binding protein32132831021467753Rat
620527Surf1SURF1, cytochrome c oxidase assembly factor31024179310244686Rat
1303196St6galnac6ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 631589427815907502Rat
1303156Npdc1neural proliferation, differentiation and control, 1382204468226446Rat
69336Prg2proteoglycan 237006253570066102Rat
1303272Mmadhcmetabolism of cobalamin associated D33470864934726554Rat
2021Acp2acid phosphatase 2, lysosomal37717502277185180Rat
2668Gcgglucagon34711391447122929Rat
1305173Gtf3c5general transcription factor IIIC subunit 531189386711914187Rat
1305178RGD1305178similar to Hypothetical protein MGC1169031426426314272580Rat
1304833Rc3h2ring finger and CCCH-type domains 232112153121186711Rat
1304853Dlx2distal-less homeobox 235637134756373230Rat
1304868Dph7diphthamide biosynthesis 7377703857778994Rat
620843Lmx1bLIM homeobox transcription factor 1 beta31686219516940899Rat
620360Nfe2l2nuclear factor, erythroid 2-like 236059423960621785Rat
620364Agpsalkylglycerone phosphate synthase36074732360845831Rat
727897Pmpcapeptidase, mitochondrial processing subunit alpha392077319216846Rat
621327Arl5aADP-ribosylation factor like GTPase 5A33687846136903362Rat
71073Dpp7dipeptidylpeptidase 7381650918169343Rat
727797Rtn4rl2reticulon 4 receptor-like 236995455769971108Rat
735079Zmynd19zinc finger, MYND-type containing 19377580867778982Rat
620881Rab14RAB14, member RAS oncogene family31850195318523253Rat
1302949Tanc1tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 134409938744335478Rat
1302980Xirp2xin actin-binding repeat containing 235212621352213094Rat
708367Hsd17b12hydroxysteroid (17-beta) dehydrogenase 1237999004880113556Rat
621886Rapgef4Rap guanine nucleotide exchange factor 435680938857101332Rat
2514Dpm2dolichyl-phosphate mannosyltransferase subunit 2, regulatory31585595215858867Rat
621643Stk39serine threonine kinase 3935291358353179060Rat
1303005St6galnac4ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 431587223015885250Rat
1303007Rpl35ribosomal protein L3532275325522756217Rat
3187Notch1notch receptor 1392779559323531Rat
2237C5complement C531827069618361994Rat
69320Lcn5lipocalin 5384731968477208Rat
621789Acvr1cactivin A receptor type 1C34281549042892423Rat
621793Pde11aphosphodiesterase 11A36091356261297154Rat
619930Abcb11ATP binding cassette subfamily B member 1135401685454112797Rat
621877Syt13synaptotagmin 1337887720078915375Rat
2843Hspa5heat shock protein family A (Hsp70) member 531805550718059969Rat
61905Psmc3proteasome 26S subunit, ATPase 337703182577037207Rat
735212Orc4origin recognition complex, subunit 433329084433334022Rat
735214Large2LARGE xylosyl- and glucuronyltransferase 237833462778347167Rat
70911Acvr2aactivin A receptor type 2A33320496133292673Rat
620200Acvr1activin A receptor type 134297855843097892Rat
2076Ak1adenylate kinase 131591243115923045Rat
735225Serping1serpin family G member 136984272669852583Rat
620804Ssbsmall RNA binding exonuclease protection factor La35461661654626203Rat
69368Scn9asodium voltage-gated channel alpha subunit 935114514851293342Rat
621093Psmb7proteasome 20S subunit beta 732235777722417748Rat
620611Slc2a8solute carrier family 2 member 831627491816284536Rat
1304638Coq4coenzyme Q431306005413070502Rat
2255Calcrlcalcitonin receptor like receptor36942834869525910Rat
628682Gpsm1G-protein signaling modulator 1391408169167828Rat
628609Abo3histo-blood group ABO system transferase 3397439389760574Rat
735101Tubb4btubulin, beta 4B class IVb380378448040294Rat
621633Itga6integrin subunit alpha 635660451256689428Rat
1307811Spc25SPC25 component of NDC80 kinetochore complex35393001353988940Rat
1305847Spoplspeckle type BTB/POZ protein like360746816148508Rat
1306007Zbtb6zinc finger and BTB domain containing 632118916021207561Rat
1306022Nup188nucleoporin 18831355991713616313Rat
1306473Mtx2metaxin 235973020659792202Rat
1306827Agbl2AGBL carboxypeptidase 237676489376800071Rat
1307457Dusp19dual specificity phosphatase 1936553842465554465Rat
1304695Slc39a13solute carrier family 39 member 1337703941177047536Rat
1305635Il1f10interleukin 1 family member 10370725117075439Rat
1305546Anapc2anaphase promoting complex subunit 2380864348098182Rat
69073Mdkmidkine37790115677903997Rat
69398G6pc2glucose-6-phosphatase catalytic subunit 235399982154005539Rat
1305588Rag2recombination activating 238790237387910227Rat
1305594Evx2even-skipped homeobox 235955819759562267Rat
1305621Usp20ubiquitin specific peptidase 2031427273714306409Rat
1305643Ctnnd1catenin delta 136968332869734550Rat
1305109Stomstomatin31864505818667343Rat
1305740Cybrd1cytochrome b reductase 135593487455962132Rat
1307606Cd302CD302 molecule34472232444756045Rat
1305821Plpp7phospholipid phosphatase 7 (inactive)31538446115398820Rat
708374Obp2bodorant binding protein 2B385820748585258Rat
1306341Lcn9lipocalin 9386444278646782Rat
735044Galnt13polypeptide N-acetylgalactosaminyltransferase 1333890369539560683Rat
620238Abca2ATP binding cassette subfamily A member 2382445158264545Rat
1306747Lcn8lipocalin 8384679348473691Rat
621686Dab2ipDAB2 interacting protein31891529019086282Rat
1307327Pacsin3protein kinase C and casein kinase substrate in neurons 337722718777235820Rat
1307329Gle1GLE1 RNA export mediator31320931213237018Rat
1307004Fubp3far upstream element binding protein 331485552714904540Rat
1306283Ndufa8NADH:ubiquinone oxidoreductase subunit A831938606319402093Rat
1306285Vav2vav guanine nucleotide exchange factor 231058468810754128Rat
708583Mamdc4MAM domain containing 4383823878391003Rat
1307586Rpl7aribosomal protein L7a31023902610241703Rat
1307588Ehmt1euchromatic histone lysine methyltransferase 1375806807729046Rat
1305716Hat1histone acetyltransferase 135621734456265021Rat
1307166Klhl23kelch-like family member 2335458078854594530Rat
1306214Csrnp3cysteine and serine rich nuclear protein 335049837950695598Rat
1308539Kif5ckinesin family member 5C33403208234185597Rat
1307960Ube2l6ubiquitin-conjugating enzyme E2L 636987302569888042Rat
1307249Clic3chloride intracellular channel 3382714168274023Rat
1307411Rbm18RNA binding motif protein 1831946733319487171Rat
1307413Metap1dmethionyl aminopeptidase type 1D (mitochondrial)35627947156354518Rat
1305081Aif1lallograft inflammatory factor 1-like31522947615254033Rat
1306707Prkraprotein activator of interferon induced protein kinase EIF2AK236157544761594393Rat
1307447Dolpp1dolichyldiphosphatase 131366489313674312Rat
1306443Galnt3polypeptide N-acetylgalactosaminyltransferase 335074250050779266Rat
1305181Slc25a12solute carrier family 25 member 1235609808056192188Rat
1307982Ola1Obg-like ATPase 135796689658085955Rat
1310287Zbtb43zinc finger and BTB domain containing 4331674453516763854Rat
1310289Psd4pleckstrin and Sec7 domain containing 4371370697173571Rat
1308561Zbtb26zinc finger and BTB domain containing 2632119531921207925Rat
1304778Cercamcerebral endothelial cell adhesion molecule31311815013155960Rat
1307355Stkld1serine/threonine kinase-like domain containing 131026158310280850Rat
1307018Niban2niban apoptosis regulator 231617467416224293Rat
1306215PaxxPAXX, non-homologous end joining factor382747628276338Rat
1306220Rexo4REX4 homolog, 3'-5' exonuclease31028065410291003Rat
1307382Surf6surfeit 631022145010232306Rat
1307383Slc27a4solute carrier family 27 member 431307502213087943Rat
1307721Celf1CUGBP, Elav-like family member 137692459176999429Rat
1307777Rbms1RNA binding motif, single stranded interacting protein 134519582845420406Rat
1310612RabepkRab9 effector protein with kelch motifs31806129918083191Rat
1310613Itgavintegrin subunit alpha V36883852468926653Rat
1333562Olr693olfactory receptor 69337527247575273392Rat
1305930Entr1endosome associated trafficking regulator 1392009679207688Rat
1305336Ciz1CDKN1A interacting zinc finger protein 131565847915675716Rat
1304895Ddx31DEAD-box helicase 3131217282912238392Rat
1306582Ntmt1N-terminal Xaa-Pro-Lys N-methyltransferase 131409337414110565Rat
1306589Gcagrancalcin34729732047328581Rat
1305897Mrrfmitochondrial ribosome recycling factor31948712419543911Rat
1307739Morn5MORN repeat containing 531940180119429956Rat
1307198Pbx3PBX homeobox 331748869117682412Rat
1307615Rabl6RAB, member RAS oncogene family-like 6384026668428588Rat
1305159Wdr5WD repeat domain 531083696410856682Rat
1306593Zdhhc12zinc finger DHHC-type palmitoyltransferase 1231336350413366383Rat
1306599Urm1ubiquitin related modifier 131310034013117064Rat
1303119Itgb6integrin subunit beta 634504629545170532Rat
1305410Ttc17tetratricopeptide repeat domain 1738026348880374137Rat
1306005Slc38a11solute carrier family 38, member 1134998711950033615Rat
1305882Gpr107G protein-coupled receptor 10731443170414497623Rat
1305886Sh3glb2SH3 domain-containing GRB2-like endophilin B231361693613631785Rat
1306573Exosc2exosome component 231496293014973645Rat
2163Ass1argininosuccinate synthase 131474735514796909Rat
1304691Rabgap1RAB GTPase activating protein 132120801221326013Rat
708551Slc34a3solute carrier family 34 member 3380442948050034Rat
1305363Mapkap1MAPK associated protein 131771581317918387Rat
1306304Tmem203transmembrane protein 203380709048071732Rat
1306074Mymkmyomaker, myoblast fusion factor31038836110397364Rat
1305921Pkn3protein kinase N331335008213363572Rat
1311497Stam2signal transducing adaptor molecule 233718614537234810Rat
1311501Cacfd1calcium channel flower domain containing 131033588110352437Rat
1333910Olr453olfactory receptor 45337076891970769863Rat
1333913Olr672olfactory receptor 67237488967474890588Rat
1332770Olr481olfactory receptor 48137116627471167218Rat
1332777Olr563olfactory receptor 56337280375572804699Rat
1307271Epc2enhancer of polycomb homolog 233386721933967908Rat
1333233Olr501-psolfactory receptor pseudogene 50137145769571458634Rat
1333235Olr558olfactory receptor 55837270465872705578Rat
1333237Olr584olfactory receptor 58437320959873210536Rat
1333932Olr544olfactory receptor 54437232404372324981Rat
1333935Olr557olfactory receptor 55737267910172680468Rat
1333944Olr595olfactory receptor 59537332679973331195Rat
1333945Olr585-psolfactory receptor pseudogene 58537323657173236759Rat
1333948Olr552olfactory receptor 55237255658472562298Rat
1333370Olr646olfactory receptor 64637432327274324192Rat
1333400Olr472olfactory receptor 47237103476771035750Rat
1333401Olr498-psolfactory receptor pseudogene 49837141386771414658Rat
1311084RGD1311084similar to 1700113K14Rik protein31407667914087036Rat
1333797Olr458olfactory receptor 45837084332170844259Rat
1333798Olr729olfactory receptor 72937604265876043584Rat
1333823Olr516olfactory receptor 51637172888271729817Rat
1333825Olr554olfactory receptor 55437258863972589589Rat
1308635DnlzDNL-type zinc finger391699489171881Rat
1333285Olr539olfactory receptor 53937215365972154597Rat
1333286Olr719-psolfactory receptor pseudogene 71937585439975855320Rat
1333267Olr638-psolfactory receptor pseudogene 63837417433574175243Rat
1333642Olr645-psolfactory receptor pseudogene 64537430444474305364Rat
1333643Olr666olfactory receptor 66637478360574784540Rat
1333645Olr602olfactory receptor 60237343267773433615Rat
1333646Olr617-psolfactory receptor pseudogene 61737372875173729698Rat
1333650Olr664olfactory receptor 66437475100874751943Rat
1332635Olr684olfactory receptor 68437515202875152945Rat
1332636Olr466olfactory receptor 46637095665770957592Rat
1332637Olr541olfactory receptor 54137222792372228861Rat
1333420Olr610olfactory receptor 61037363691473637864Rat
1334151Olr677olfactory receptor 67737504919675050128Rat
1310201Alx4ALX homeobox 437961168279648260Rat
1312016Slc43a3solute carrier family 43, member 337000816070030324Rat
1333496Olr418olfactory receptor 41832047236220473294Rat
1333498Olr439olfactory receptor 43937044869270449621Rat
1333653Olr517olfactory receptor 51737176790871774271Rat
1333655Olr532olfactory receptor 53237208962672090591Rat
1308395Tp53i11tumor protein p53 inducible protein 1137914482479160056Rat
1308398Lrrc26leucine rich repeat containing 26381023618103687Rat
1308417Hoxd13homeo box D1335957064759573963Rat
1307272Zeb2zinc finger E-box binding homeobox 232921976529342094Rat
1307287Sh2d3cSH2 domain containing 3C31601062216046491Rat
1332834Olr660olfactory receptor 66037459880974599732Rat
1332842Olr668olfactory receptor 66837482694974827884Rat
1333914Olr410olfactory receptor 41032034653520352728Rat
1333102Olr471olfactory receptor 47137102686271027800Rat
1333103Olr417olfactory receptor 41732045646420457417Rat
1333332Olr429olfactory receptor 42932078454520785474Rat
1333333Olr425olfactory receptor 42532063997620640929Rat
1333343Olr448olfactory receptor 44837071874170719697Rat
1333346Olr546olfactory receptor 54637237599472383570Rat
1311006C1qtnf4C1q and TNF related 437685436876872991Rat
1333515Olr743-psolfactory receptor pseudogene 74337630450576305430Rat
1333493Olr733olfactory receptor 73337613119676132125Rat
1309317Slc2a6solute carrier family 2 member 631034839510355208Rat
1308019Tor4atorsin family 4, member A380042928007979Rat
1333209Olr415olfactory receptor 41532042412520425072Rat
1333442Olr396olfactory receptor 39631976523019766168Rat
1333868Olr412-psolfactory receptor pseudogene 41232039800520398768Rat
1333063Olr629olfactory receptor 62937400022474001174Rat
1333066Olr513olfactory receptor 51337164829671649231Rat
1333774Olr480olfactory receptor 48037115720771158148Rat
1333900Olr402olfactory receptor 40232004046220041400Rat
1333139Olr434olfactory receptor 43432086229720863280Rat
1333140Olr720olfactory receptor 72037587397175874900Rat
1309801Baz2bbromodomain adjacent to zinc finger domain, 2B34438428244681619Rat
1333928Olr461olfactory receptor 46137088634370887278Rat
1333159Olr438-psolfactory receptor pseudogene 43837044035970441273Rat
1333160Olr565-psolfactory receptor pseudogene 56537282908772829973Rat
1333165Olr578olfactory receptor 57837308733773088269Rat
1333082Olr413olfactory receptor 41332040964120410579Rat
1333084Olr400olfactory receptor 40031991073819911667Rat
1333086Olr463olfactory receptor 46337091749170918444Rat
1333087Olr643-psolfactory receptor pseudogene 64337427393574274872Rat
1333089Olr714olfactory receptor 71437572988075730833Rat
1333310Olr601olfactory receptor 60137341584973416802Rat
1311721NmiN-myc (and STAT) interactor33641560736439716Rat
1332629Olr407olfactory receptor 40732026967820270616Rat
1333510Olr630olfactory receptor 63037401209374013031Rat
1334169Olr467-psolfactory receptor pseudogene 46737096616070967121Rat
1334170Olr706-psolfactory receptor pseudogene 70637555549775556072Rat
1333143Olr642-psolfactory receptor pseudogene 64237426444074265208Rat
1333144Olr441olfactory receptor 44137048713670488080Rat
1309772Api5apoptosis inhibitor 538037810080403267Rat
1309777Pla2r1phospholipase A2 receptor 134488394345013793Rat
1333264Olr561olfactory receptor 56137276375072764721Rat
1332822Olr698olfactory receptor 69837540188975402836Rat
1309690Hoxd4homeo box D435961446459634042Rat
1333172Olr701olfactory receptor 70137543803475438951Rat
1332640Olr631olfactory receptor 63137402216974023089Rat
1332647Olr475olfactory receptor 47537107264771073579Rat
1332674Olr486olfactory receptor 48637127546371276422Rat
1333586Olr571-psolfactory receptor pseudogene 57137292845372929390Rat
1333587Olr553-psolfactory receptor pseudogene 55337257903172579321Rat
1332682Olr411olfactory receptor 41132038357720384518Rat
1334005Olr738-psolfactory receptor pseudogene 73837621968776220208Rat
1311592Rapsnreceptor-associated protein of the synapse37701469977024373Rat
1332942Olr583olfactory receptor 58337317972373180655Rat
1332944Olr428olfactory receptor 42832076712920768064Rat
1332947Olr731olfactory receptor 73137609911976100027Rat
621645Aplnrapelin receptor37021740770221052Rat
1359542Ubac1UBA domain containing 1388254448848055Rat
1309730Iftapintraflagellar transport associated protein38781206887906517Rat
1310457Traf2Tnf receptor-associated factor 2383419508366609Rat
1310460Fbxw2F-box and WD repeat domain containing 231808885918114387Rat
1306869Il36ainterleukin 36, alpha369968517001400Rat
1332686Olr613olfactory receptor 61337366730073668232Rat
1310821Dolkdolichol kinase31355782613559864Rat
1308313Uck1uridine-cytidine kinase 131553858015544465Rat
1332783Olr736olfactory receptor 73637617527876176207Rat
1333119Olr715olfactory receptor 71537575270975753632Rat
1333154Olr497-psolfactory receptor pseudogene 49737139611971396764Rat
1308354Ptpaprotein phosphatase 2 phosphatase activator31368974213720287Rat
1333092Olr586olfactory receptor 58637323776673238701Rat
1333754Olr741olfactory receptor 74137627454376275469Rat
1333756Olr678olfactory receptor 67837505977375060708Rat
1333758Olr590olfactory receptor 59037328841773289349Rat
1333762Olr676-psolfactory receptor pseudogene 67637501398475014915Rat
1333765Olr603-psolfactory receptor pseudogene 60337344556973445737Rat
1333690Olr580-psolfactory receptor pseudogene 58037312637173127283Rat
1332604Olr545olfactory receptor 54537236242872363393Rat
1332611Olr511-psolfactory receptor pseudogene 51137161123271612172Rat
1333624Olr446olfactory receptor 44637068276170683705Rat
1333105Olr709olfactory receptor 70937564469275645636Rat
1333097Olr398olfactory receptor 39831983877119839700Rat
1333099Olr593-psolfactory receptor pseudogene 59337331095473311855Rat
1334176Olr659olfactory receptor 65937458241774583346Rat
1334046Olr662olfactory receptor 66237466059874661530Rat
1334050Olr536olfactory receptor 53637211936772120299Rat
1332616Olr478-psolfactory receptor pseudogene 47837111945771120415Rat
1332650Olr537olfactory receptor 53737212899872129936Rat
1332655Olr721olfactory receptor 72137588253775883448Rat
1332656Olr692-psolfactory receptor pseudogene 69237526061675261359Rat
1332657Olr531olfactory receptor 53137206730572068249Rat
1332658Olr605-psolfactory receptor pseudogene 60537348570873486641Rat
1333993Olr728olfactory receptor 72837603410076035029Rat
1333999Olr696olfactory receptor 69637535855475360555Rat
1333189Olr712olfactory receptor 71237569054675691499Rat
1311355Phpt1phosphohistidine phosphatase 1383929268394325Rat
1334023Olr623olfactory receptor 62337385017773851112Rat
1334025Olr508olfactory receptor 50837155361971559885Rat
1334027Olr592olfactory receptor 59237330141873302353Rat
1310718Bbs5Bardet-Biedl syndrome 535441042954431831Rat
1333773Olr665olfactory receptor 66537477041474771984Rat
1333703Olr559olfactory receptor 55937271524172716185Rat
1333709Olr460-psolfactory receptor pseudogene 46037086908970869691Rat
1332825Olr427olfactory receptor 42732069926620700189Rat
1332829Olr493olfactory receptor 49337136744071370914Rat
1332831Olr437-psolfactory receptor pseudogene 43737043099370431653Rat
1310836Ptges2prostaglandin E synthase 231569050115697688Rat
1333623Olr462olfactory receptor 46237090759270908524Rat
1311305Golga1golgin A132276569022812637Rat
1311471Prrx2paired related homeobox 231413251114168535Rat
1333330Olr589-psolfactory receptor pseudogene 58937327391773274388Rat
1333114Olr591-psolfactory receptor pseudogene 59137329952673300139Rat
1332600Olr681olfactory receptor 68137509435475095289Rat
1303202Ns5atp4NS5A (hepatitis C virus) transactivated protein 433446571534466470Rat
727909Spaca9sperm acrosome associated 931201937612028801Rat
1310763Endogendonuclease G31344911313451715Rat
1310767Itprid2ITPR interacting domain containing 236453670764573978Rat
1333222Olr510olfactory receptor 51037159375371594685Rat
1333224Olr566olfactory receptor 56637284304272843986Rat
1333225Olr576olfactory receptor 57637305513573056061Rat
1359393Tas2r134taste receptor, type 2, member 13433607765236078641Rat
1359394Trub2TruB pseudouridine synthase family member 231304922013059836Rat
1333916Olr495olfactory receptor 49537138285471383801Rat
1311348Glt6d1glycosyltransferase 6 domain containing 1386277938638537Rat
1333572Olr538-psolfactory receptor pseudogene 53837214731272148231Rat
1333573Olr626-psolfactory receptor pseudogene 62637395630473957250Rat
1332811Olr679olfactory receptor 67937507768775078622Rat
1308367Ermnermin34262816042633816Rat
1309048Snapc4small nuclear RNA activating complex, polypeptide 4391820619200819Rat
1312042Lnpklunapark, ER junction formation factor35941887259487029Rat
1333364Olr680-psolfactory receptor pseudogene 68037508876675089617Rat
1333365Olr485olfactory receptor 48537125693971257889Rat
1333275Olr547-psolfactory receptor pseudogene 54737240158072402517Rat
1333606Olr596olfactory receptor 59637336600573366931Rat
1333607Olr732-psolfactory receptor pseudogene 73237612524576125428Rat
1332849Olr658olfactory receptor 65837456906874569997Rat
1332619Olr505olfactory receptor 50537149379171494732Rat
1332627Olr682-psolfactory receptor pseudogene 68237512811475129049Rat
1332758Olr422olfactory receptor 42232055178820552741Rat
1333349Olr529olfactory receptor 52937202516572026109Rat
1333350Olr694olfactory receptor 69437527890875279834Rat
1333354Olr650olfactory receptor 65037440063274401558Rat
1333355Olr628-psolfactory receptor pseudogene 62837398687373987754Rat
1311651Olfml2aolfactomedin-like 2A32268856222717745Rat
1308431Tor1btorsin family 1, member B31424318114249279Rat
1333410Olr528olfactory receptor 52837199756071998501Rat
1333411Olr421olfactory receptor 42132051768220518674Rat
1333415Olr651olfactory receptor 65137441582874416754Rat
1333417Olr624olfactory receptor 62437389475873897788Rat
1333418Olr399olfactory receptor 39931987183619872759Rat
1308993Marchf7membrane associated ring-CH-type finger 734468022944720172Rat
1305661Fbxw5F-box and WD repeat domain containing 5383225438327092Rat
1306912Kyat1kynurenine aminotransferase 131345959813493308Rat
1310630Uap1l1UDP-N-acetylglucosamine pyrophosphorylase 1 like 1381723358180505Rat
1308434Psmd5proteasome 26S subunit, non-ATPase 531813371518151000Rat
1332795Olr499olfactory receptor 49937143154871432489Rat
1332798Olr739-psolfactory receptor pseudogene 73937622859276228684Rat
1332799Olr695olfactory receptor 69537532084175321776Rat
1332877Olr393-psolfactory receptor pseudogene 39331964110519641968Rat
1306174Lhx6LIM homeobox 631943243919456268Rat
1310259Ssna1SS nuclear autoantigen 1380849498086417Rat
1306511Hoxd10homeo box D1035959451659597725Rat
1309797Hoxd12homeo box D1235957767759578798Rat
1308600Dipk1bdivergent protein kinase domain 1B394559149464169Rat
1308174Fignfidgetin, microtubule severing factor34863751048760772Rat
1309961Arrdc1arrestin domain containing 1377350027742195Rat
1309969Prr5lproline rich 5 like38800195188173532Rat
1308479Ndor1NADPH dependent diflavin oxidoreductase 1380626298070873Rat
1309463Slc35c1solute carrier family 35 member C137842192578429603Rat
1305239Zfp804azinc finger protein 804A36703348167267769Rat
1333962Olr724olfactory receptor 72437594726675948186Rat
1333978Olr641olfactory receptor 64137422953174230439Rat
1304977Nup214nucleoporin 21431525511115340568Rat
1309363Cdca7cell division cycle associated 735732271857333353Rat
1309368Crb2crumbs cell polarity complex component 232154213821564876Rat
1309406Ndufs3NADH:ubiquinone oxidoreductase core subunit S337687664676883824Rat
1308894Ube2e3ubiquitin-conjugating enzyme E2E 336378697663851400Rat
1311315Frzbfrizzled-related protein36533227465365208Rat
1309904Prg3proteoglycan 3, pro eosinophil major basic protein 237007197070078103Rat
1306233RGD1306233similar to hypothetical protein MGC2976131179703111801568Rat
1309292Nacc2NACC family member 2388799528946660Rat
1309314Accs1-aminocyclopropane-1-carboxylate synthase37980525479820830Rat
1309399Lamc3laminin subunit gamma 331516522015226697Rat
1309610Dapl1death associated protein-like 134396099343980940Rat
1333220Olr730-psolfactory receptor pseudogene 73037609197076092807Rat
1305459Adamtsl2ADAMTS-like 231039777410434557Rat
1332801Olr735olfactory receptor 73537616715276168081Rat
1332802Olr647-psolfactory receptor pseudogene 64737434313974344050Rat
1310887Miga2mitoguardin 231363614413658896Rat
1308188Upp2uridine phosphorylase 234327304843317417Rat
1307990Cytipcytohesin 1 interacting protein34269805842774955Rat
1307832Nelfbnegative elongation factor complex member B380108838027403Rat
1307840Pkp4plakophilin 434363236443835834Rat
1308142Chst1carbohydrate sulfotransferase 137855205978574736Rat
1305317Cntrlcentriolin31842814718500362Rat
708370Card9caspase recruitment domain family, member 9391718149180310Rat
1306676Rbm43RNA binding motif protein 4333639443136404757Rat
1306687Noxa1NADPH oxidase activator 1378954887907011Rat
1308925Brd3bromodomain containing 331077316310829675Rat
1309540RGD1309540similar to hypothetical protein MGC40841; similar to hypothetical protein MGC470737724739377416307Rat
1308742RGD1308742similar to Complement C5 precursor31840171618420064Rat
1308073Edf1endothelial differentiation-related factor 1383770588381363Rat
1308080Mtch2mitochondrial carrier 237683054976850189Rat
1309179Hoxd1homeo box D135966562959667769Rat
1309097Fibcd1fibrinogen C domain containing 131509268115126399Rat
1311372Pex16peroxisomal biogenesis factor 1637834721278352603Rat
1311373Zswim2zinc finger, SWIM-type containing 236899342269015441Rat
1332859Olr685-psolfactory receptor pseudogene 68537516476875165031Rat
1307679Clp1cleavage factor polyribonucleotide kinase subunit 136980677469818633Rat
1309162Gpr155G protein-coupled receptor 15535821642258270350Rat
1307089Ntng2netrin G231249257412551104Rat
1310234Kbtbd4kelch repeat and BTB domain containing 437688367176890799Rat
1310241Mrpl41mitochondrial ribosomal protein L41377806587781576Rat
1307846Ldlrad3low density lipoprotein receptor class A domain containing 338823952988481291Rat
1307847Il36binterleukin 36, beta370248627122489Rat
1310164Ddb2damage specific DNA binding protein 237718511477207650Rat
1310165Ptrh1peptidyl-tRNA hydrolase 1 homolog31606486716071098Rat
1309199Cir1corepressor interacting with RBPJ, CIR135815941858188719Rat
1306177Arfgap2ADP-ribosylation factor GTPase activating protein 237723630577248445Rat
1305950Mybpc3myosin binding protein C337709516577113406Rat
1308867Arpc5lactin related protein 2/3 complex, subunit 5-like32275871022767520Rat
1306068Arhgap1Rho GTPase activating protein 137762137777643400Rat
1310685Atg13autophagy related 1337764706977681028Rat
1309229Agpat21-acylglycerol-3-phosphate O-acyltransferase 2394168429428567Rat
1309238Fnbp4formin binding protein 437673301276763077Rat
1333128Olr447olfactory receptor 44737069043970691383Rat
1333129Olr488olfactory receptor 48837129446771295393Rat
1332692Olr625olfactory receptor 62537392984973930784Rat
1332695Olr530olfactory receptor 53037204670672047671Rat
1332696Olr711olfactory receptor 71137567436875675312Rat
1307706Commd9COMM domain containing 938817590988190427Rat
1307707Ext2exostosin glycosyltransferase 237966541579798077Rat
1305064Scrn3secernin 335818882058213623Rat
1310284Zer1zyg-11 related, cell cycle regulator31336968813397524Rat
1311401Prpf40apre-mRNA processing factor 40 homolog A33762558537689859Rat
1311402Psx1placenta specific homeobox 1362514956252166Rat
1332704Olr442olfactory receptor 44237049755070498497Rat
1332707Olr657olfactory receptor 65737455601774556949Rat
1332819Olr464olfactory receptor 46437093188170932834Rat
1332820Olr459olfactory receptor 45937085934570860274Rat
1332821Olr452-psolfactory receptor pseudogene 45237075714870757580Rat
1332864Olr699-psolfactory receptor pseudogene 69937541013375410569Rat
1332866Olr549-psolfactory receptor pseudogene 54937244611572446798Rat
1333603Olr704olfactory receptor 70437552691775529004Rat
1308445Asb6ankyrin repeat and SOCS box-containing 631411062814115276Rat
1307813Dnajc10DnaJ heat shock protein family (Hsp40) member C1036523203165272732Rat
1305293Fkbp7FKBP prolyl isomerase 736160938461623710Rat
1333430Olr689olfactory receptor 68937521150475212439Rat
1333437Olr518olfactory receptor 51837180971871810668Rat
1333439Olr649olfactory receptor 64937437749274378427Rat
1311727Gfi1bgrowth factor independent 1B transcriptional repressor31194023211952989Rat
1333830Olr509-psolfactory receptor pseudogene 50937156869871569399Rat
1333831Olr708-psolfactory receptor pseudogene 70837562798275628906Rat
1333833Olr722olfactory receptor 72237590550175906430Rat
1333836Olr542olfactory receptor 54237228839272289330Rat
1308887Osbpl6oxysterol binding protein-like 636134377661541170Rat
1308954Cobll1cordon-bleu WH2 repeat protein-like 134975326049915168Rat
1308229Slc43a1solute carrier family 43 member 136992058669946768Rat
1307927Dennd1aDENN domain containing 1A32156474922052057Rat
1308818Cfap210cilia and flagella associated protein 21035452045554554677Rat
1308499Sp5Sp5 transcription factor35527493155277733Rat
1309593Dlx1distal-less homeobox 135635619056360780Rat
1333244Olr600-psolfactory receptor pseudogene 60037341028073411227Rat
1333246Olr526olfactory receptor 52637193413571935100Rat
1333254Olr727olfactory receptor 72737601959176020520Rat
1333259Olr514olfactory receptor 51437166467671665617Rat
1307479Gapvd1GTPase activating protein and VPS9 domains 131796834518041888Rat
1305244Plekha3pleckstrin homology domain containing A336162343461644649Rat
1310370Tlk1tousled-like kinase 135552055955627580Rat
1310377Phyhd1phytanoyl-CoA dioxygenase domain containing 131353567013553797Rat
1310390Phf19PHD finger protein 1931817528118197289Rat
1306160Lrp1bLDL receptor related protein 1B32459430226715037Rat
1306853Traf6TNF receptor associated factor 638796351787988316Rat
1560877LOC499843LRRGT0009138746236587492138Rat
1560880Cysrt1cysteine rich tail 1380541958057846Rat
1566062Mettl5methyltransferase like 535462579054638066Rat
1563348Selenohselenoprotein H36975185069753417Rat
1563852Erich2glutamate-rich 235531099355347701Rat
1561394Map3k20mitogen-activated protein kinase kinase kinase 2035712856157289943Rat
1562935Tprntaperin380761648083642Rat
1334422Olr621olfactory receptor 62137382438673825297Rat
1560496Ifih1interferon induced with helicase C domain 134722898047275403Rat
1303144Ak8adenylate kinase 831202889512144468Rat
1334333Olr520olfactory receptor 52037189882671899752Rat
1359731Alkbh3alkB homolog 3, alpha-ketoglutarate-dependent dioxygenase37993951579972820Rat
1334377Olr718olfactory receptor 71837582016475839914Rat
1564740Nr6a1nuclear receptor subfamily 6, group A, member 132249510922683132Rat
1333782Olr582olfactory receptor 58237315708173166736Rat
1333019Olr594olfactory receptor 59437331860573319540Rat
1565512Ccdc187coiled-coil domain containing 187390701929127001Rat
1561980Surf4surfeit 431024836010261537Rat
1334339Olr655olfactory receptor 65537450192174502850Rat
1334341Olr707olfactory receptor 70737561332875614251Rat
1334350Olr543-psolfactory receptor pseudogene 54337231110372311420Rat
1565551Dcaf17DDB1 and CUL4 associated factor 1735586377655895601Rat
1563393Gtdc1glycosyltransferase-like domain containing 132876666629064305Rat
1564319RGD1564319similar to TF-1 apoptosis related protein 1936364461563646013Rat
1563584RGD1563584similar to myosin, light polypeptide 6, alkali, smooth muscle and non-muscle33683138836831996Rat
1311212Il36rninterleukin 36 receptor antagonist370444197051016Rat
1334355Olr431-psolfactory receptor pseudogene 43132081191620812126Rat
1334356Olr587olfactory receptor 58737325368373254618Rat
1562961Mbd5methyl-CpG binding domain protein 533358885433738730Rat
1563019Il36ginterleukin 36, gamma369483236954485Rat
1562745Lcn3lipocalin 3385392608542792Rat
1565084LOC499796LRRGT0001233510231235150397Rat
1563263RGD1563263similar to RIKEN cDNA 1700029I1537835430378355055Rat
1560029LOC502618ABO-family member 631871144718729488Rat
1561224RGD1561224similar to Ptbp1 protein38632246986323963Rat
1561492Tmem141transmembrane protein 141384395338441491Rat
1334323Olr742olfactory receptor 74237628657376287490Rat
1334360Olr577olfactory receptor 57737306879673069734Rat
1564019Garnl3GTPase activating Rap/RanGAP domain-like 331628871816432308Rat
1565673Ttf1transcription termination factor 131238462612409257Rat
1564440Sohlh1spermatogenesis and oogenesis specific basic helix-loop-helix 1386629958667521Rat
1565658LOC499823LRRG0011436914747769161535Rat
1561978Stpg3sperm-tail PG-rich repeat containing 3380281228030546Rat
1562762Fam166afamily with sequence similarity 166, member A380305488038370Rat
1562767Lypd6bLY6/PLAUR domain containing 6B33419910134360770Rat
1332991Olr473olfactory receptor 47337104857071049502Rat
1561057Cerklceramide kinase-like36423871464344695Rat
1561058Ier5limmediate early response 5-like31374405613745647Rat
1561059Mettl8methyltransferase like 835573145355863652Rat
1561169Ccdc148coiled-coil domain containing 14834335688543631999Rat
1311013Lrrc4cleucine rich repeat containing 4C38230524483684039Rat
1560961RGD1560961similar to RIKEN cDNA 0610038L10 gene38651072986512353Rat
1359613Creb3l1cAMP responsive element binding protein 3-like 137795258977993513Rat
1311701Smtnl1smoothelin-like 136988901069901096Rat
1333069Olr581olfactory receptor 58137314047973141417Rat
1334157Olr397olfactory receptor 39731980352919806493Rat
1560470Ajm1apical junction component 1 homolog383949428401559Rat
1561793Entpd8ectonucleoside triphosphate diphosphohydrolase 8378852777895517Rat
1333805Olr572-psolfactory receptor pseudogene 57237297296072973896Rat
1333807Olr579-psolfactory receptor pseudogene 57937312433673125261Rat
1333808Olr673olfactory receptor 67337495581974956754Rat
1332720Olr716olfactory receptor 71637577785875778811Rat
1332723Olr675olfactory receptor 67537499263574993570Rat
1332729Olr433-psolfactory receptor pseudogene 43332084156320841791Rat
1332738Olr512-psolfactory receptor pseudogene 51237162746471628353Rat
1332739Olr449-psolfactory receptor pseudogene 44937072526570725967Rat
1564854RGD1564854similar to divalent cation tolerant protein CUTA31815421918174957Rat
1334305Olr416olfactory receptor 41632044460420445539Rat
1334308Olr494-psolfactory receptor pseudogene 49437137787171378591Rat
1334309Olr556olfactory receptor 55637264813472649057Rat
1334311Olr551olfactory receptor 55137252600572526943Rat
1334313Olr450olfactory receptor 45037072796370728901Rat
1334252Olr671olfactory receptor 67137487377374874708Rat
1334112Olr519olfactory receptor 51937183985371840821Rat
1334114Olr524-psolfactory receptor pseudogene 52437189882671899752Rat
1333729Olr564-psolfactory receptor pseudogene 56437281432172815092Rat
1334261Olr644-psolfactory receptor pseudogene 64437428105674282171Rat
1334269Olr479olfactory receptor 47937113756171138502Rat
1334273Olr440olfactory receptor 44037046603970466986Rat
1303069Nup35nucleoporin 3536555520365594488Rat
1333304Olr622-psolfactory receptor pseudogene 62237383586773836743Rat
1333305Olr636olfactory receptor 63637414724574148186Rat
1560142Ypel4yippee-like 436981537369820708Rat
1333454Olr506-psolfactory receptor pseudogene 50637149861471499252Rat
1333455Olr484olfactory receptor 48437124134571242292Rat
1333456Olr648olfactory receptor 64837435255074353485Rat
1333461Olr745olfactory receptor 74537634087476341803Rat
1333467Olr401olfactory receptor 40131994606319947001Rat
1333471Olr523-psolfactory receptor pseudogene 52337187810271879049Rat
1334035Olr534-psolfactory receptor pseudogene 53437210804472108995Rat
1311134Nebnebulin33661367736811618Rat
1359465Dync2i2dynein 2 intermediate chain 231330603913322121Rat
1332745Olr470olfactory receptor 47037101756471018538Rat
1564114Cfap77cilia and flagella associated protein 7731225845312381319Rat
1564306RGD1564306similar to developmental pluripotency associated 533731594237316483Rat
1332987Olr700-psolfactory receptor pseudogene 70037543000675430958Rat
1311152Abo2histo-blood group ABO system transferase 231002426210027944Rat
1333985Olr663olfactory receptor 66337469200674694901Rat
1333986Olr489-psolfactory receptor pseudogene 48937130792671308820Rat
1333988Olr515olfactory receptor 51537170396971704934Rat
1312021Tnks1bp1tankyrase 1 binding protein 137013533570160071Rat
1311181Zfp385bzinc finger protein 385B36235518262640417Rat
1333789Olr540olfactory receptor 54037219659972197537Rat
1564133RGD1564133similar to odorant binding protein 2B385710218574555Rat
1359234Zc3h15zinc finger CCCH-type containing 1536874459168764335Rat
1309709Mvb12bmultivesicular body subunit 12B31703400217192658Rat
1311690Lrrc8aleucine rich repeat containing 8 VRAC subunit A31350957713537174Rat
1333533Olr573-psolfactory receptor pseudogene 57337299278672993439Rat
1333536Olr408olfactory receptor 40832031516220316100Rat
1333537Olr469olfactory receptor 46937099035470991277Rat
1333538Olr597olfactory receptor 59737337530273376234Rat
1333540Olr492-psolfactory receptor pseudogene 49237135931071360233Rat
1333542Olr683-psolfactory receptor pseudogene 68337514541775145825Rat
1333472Olr490olfactory receptor 49037133837571339316Rat
1333473Olr604olfactory receptor 60437346535073466307Rat
1332993Olr661olfactory receptor 66137464981874650744Rat
1332997Olr713olfactory receptor 71337570851175709455Rat
1560370Ccdc183coiled-coil domain containing 183384287848438948Rat
1311052Nup160nucleoporin 16037666578676729296Rat
1334095Olr627-psolfactory receptor pseudogene 62737396579973966710Rat
1334184Olr405-psolfactory receptor pseudogene 40532019140520192325Rat
1334185Olr667-psolfactory receptor pseudogene 66737481959174820221Rat
1334187Olr496olfactory receptor 49637139126571392206Rat
1334192Olr609olfactory receptor 60937361066273611612Rat
1359304Arhgap15Rho GTPase activating protein 1532798936828592722Rat
1562095Ppp1r1cprotein phosphatase 1, regulatory (inhibitor) subunit 1C36461670064719696Rat
1359274Phospho2phosphatase, orphan 235455482954561990Rat
1311594Adamts13ADAM metallopeptidase with thrombospondin type 1 motif, 1331029926410338464Rat
1333882Olr409olfactory receptor 40932033968420340625Rat
1333883Olr616-psolfactory receptor pseudogene 61637371019373711117Rat
1333887Olr548-psolfactory receptor pseudogene 54837243333072433690Rat
1333594Olr710olfactory receptor 71037566397375664917Rat
1333598Olr444olfactory receptor 44437067001370670957Rat
1334285Olr569olfactory receptor 56937290756372908492Rat
1303031Cratcarnitine O-acetyltransferase31367568413689282Rat
1309116Mrps2mitochondrial ribosomal protein S231180131011806341Rat
1309074C8gcomplement C8 gamma chain383204958323495Rat
1334144Olr702olfactory receptor 70237550259475503583Rat
1334145Olr435-psolfactory receptor pseudogene 43533210782932108276Rat
1334434Olr652olfactory receptor 65237443211874433047Rat
1334437Olr419olfactory receptor 41932048392120484868Rat
1334286Olr717olfactory receptor 71737579681575797765Rat
1334287Olr737olfactory receptor 73737620784376208769Rat
1559966Swi5SWI5 homologous recombination repair protein31557468715583760Rat
1334084Olr570-psolfactory receptor pseudogene 57037291437172915132Rat
1334085Olr632-psolfactory receptor pseudogene 63237403868274039256Rat
1333656Olr420olfactory receptor 42032050699520507921Rat
1333859Olr482olfactory receptor 48237117538971176333Rat
1332979Olr614olfactory receptor 61437367839273679342Rat
1334227Olr491olfactory receptor 49137135040271351340Rat
1334115Olr535olfactory receptor 53537211242472113365Rat
1334116Olr654olfactory receptor 65437447501374475942Rat
1334121Olr562olfactory receptor 56237279131972792275Rat
1334405Olr527olfactory receptor 52737197071071971657Rat
1564819Arl6ip6ADP ribosylation factor like GTPase 6 interacting protein 633768999437720358Rat
1560612Phf21aPHD finger protein 21A37815876078331903Rat
1334061Olr394-psolfactory receptor pseudogene 39431966717919668113Rat
1334069Olr686olfactory receptor 68637517655575177490Rat
1334071Olr744olfactory receptor 74437631806676318989Rat
1332907Olr436olfactory receptor 43637041889870419827Rat
1332911Olr502olfactory receptor 50237146931771470258Rat
1332916Olr395olfactory receptor 39531971224219713180Rat
1332922Olr550olfactory receptor 55037250376272504700Rat
1332926Olr476olfactory receptor 47637108197671082941Rat
1311926Med19mediator complex subunit 1936976213869772661Rat
1302986Lcn6lipocalin 6384840138489577Rat
1333685Olr503-psolfactory receptor pseudogene 50337147755671478153Rat
1333686Olr560olfactory receptor 56037273758872738568Rat
1333687Olr611olfactory receptor 61137364831973649275Rat
1334412Olr653olfactory receptor 65337445828074459209Rat
1334414Olr487-psolfactory receptor pseudogene 48737128248971283427Rat
1359607Spi1Spi-1 proto-oncogene37705974477093730Rat
1311224Fads2bfatty acid desaturase 2B37053573570575163Rat
1333049Olr567olfactory receptor 56737290049972901425Rat
1333052Olr633olfactory receptor 63337405594774056858Rat
1333053Olr634olfactory receptor 63437407239574073336Rat
1333550Olr445olfactory receptor 44537067746070678404Rat
1333552Olr456olfactory receptor 45637081788370818797Rat
1333556Olr465olfactory receptor 46537093671770937664Rat
1333558Olr457-psolfactory receptor pseudogene 45737082563770826563Rat
1333480Olr697olfactory receptor 69737538249375383416Rat
1333692Olr454olfactory receptor 45437079470670795641Rat
1333693Olr690olfactory receptor 69037523224875233183Rat
1332935Olr574-psolfactory receptor pseudogene 57437301769873018635Rat
1332937Olr598olfactory receptor 59837338303773383969Rat
1332940Olr443olfactory receptor 44337065392870654872Rat
1332941Olr691olfactory receptor 69137525400375254953Rat
1334383Olr620-psolfactory receptor pseudogene 62037379700073797929Rat
1333038Olr555olfactory receptor 55537262453372625513Rat
1333042Olr674olfactory receptor 67437496394274964877Rat
1560002Cfap157cilia and flagella associated protein 15731606652116073504Rat
1332719Olr740-psolfactory receptor pseudogene 74037624992776250844Rat
1334217Olr404olfactory receptor 40432014515820146096Rat
1334218Olr669olfactory receptor 66937484150774842442Rat
1334372Olr575olfactory receptor 57537304824573049174Rat
1334210Olr725olfactory receptor 72537599342675994358Rat
1333007Olr525-psolfactory receptor pseudogene 52537192872571929021Rat
1560121Ttc30a1tetratricopeptide repeat domain 30A136089919360901634Rat
1334426Olr455olfactory receptor 45537080336370804298Rat
1334429Olr619olfactory receptor 61937378030673781277Rat
1303089Gsngelsolin31858516618638404Rat
1332892Olr608olfactory receptor 60837360013373601113Rat
1333660Olr687olfactory receptor 68737518303175183963Rat
1333663Olr507olfactory receptor 50737151528071516221Rat
1333671Olr588olfactory receptor 58837326761673268560Rat
1564893Med22mediator complex subunit 2231023375410238836Rat
1560411Tspan18tetraspanin 1837916006079299907Rat
1332955Olr403olfactory receptor 40332006734920068272Rat
1332956Olr637olfactory receptor 63737416666974167598Rat
1333812Olr406olfactory receptor 40632021130520212240Rat
1333815Olr468olfactory receptor 46837098502370985961Rat
1333817Olr670olfactory receptor 67037486027974861214Rat
1333742Olr424olfactory receptor 42432062253120623523Rat
1332977Olr703olfactory receptor 70337547957375480520Rat
1334276Olr483olfactory receptor 48337122830571229264Rat
1334278Olr500olfactory receptor 50037145006671451019Rat
1334280Olr635olfactory receptor 63537409453374095462Rat
1334281Olr726olfactory receptor 72637601015176011112Rat
1334282Olr533olfactory receptor 53337209698172097916Rat
1332963Olr612-psolfactory receptor pseudogene 61237366298573663686Rat
1311898B3galt1Beta-1,3-galactosyltransferase 135225341352826508Rat
1334389Olr423olfactory receptor 42332060688720607873Rat
1560831RGD1560831similar to 40S ribosomal protein S335155968351560522Rat
1333746Olr639olfactory receptor 63937419514374196084Rat
1333747Olr705olfactory receptor 70537554826575549185Rat
1333748Olr734olfactory receptor 73437614045576141384Rat
1560313Myo3bmyosin IIIB35487370455226189Rat
1332951Olr607olfactory receptor 60737357743973578389Rat
1332952Olr640olfactory receptor 64037422200774222936Rat
1332967Olr477olfactory receptor 47737110738771108346Rat
1359456Tmx2thioredoxin-related transmembrane protein 236975493769762587Rat
1333682Olr606olfactory receptor 60637356548073566421Rat
1560248Fmnl2formin-like 233734879137624746Rat
1586383Gpr21G protein-coupled receptor 2132127500721279008Rat
1564343RGD1564343similar to 40S ribosomal protein S1631889902818899541Rat
1359296Wdsub1WD repeat, sterile alpha motif and U-box domain containing 134434041544370890Rat
1586409LOC688691similar to Olfactory receptor 5D1337373409173759208Rat
1566351Fam78afamily with sequence similarity 78, member A31535595815376330Rat
1584075LOC688891similar to Ras-GTPase-activating protein binding protein 2 (GAP SH3-domain binding protein 2) (G3BP-2)35936089259362560Rat
1582869LOC690241similar to transcription elongation factor B (SIII), polypeptide 232099505620995790Rat
1584720Qsox2quiescin sulfhydryl oxidase 2390349949064649Rat
1584007Harbi1harbinger transposase derived 137768143177689749Rat
1586443LOC688657similar to Olfactory receptor 5D1337369729973700236Rat
1563531Fastkd1FAST kinase domains 135444971054475624Rat
1559457Sp9Sp9 transcription factor35814682658149357Rat
1586401Prdm12PR/SET domain 1231492865114943341Rat
1582908Hoxd9homeo box D935960057559602755Rat
1583765Sp3Sp3 transcription factor35781185557857150Rat
1587799LOC685976similar to RalA binding protein 1339044133944917Rat
727920Nostrinnitric oxide synthase trafficking35390474653970995Rat
1565022Camsap1calmodulin regulated spectrin-associated protein 1387461768806072Rat
1583505LOC681186hypothetical protein LOC681186394737669477218Rat
1561726Lrrc55leucine rich repeat containing 5537026593470280689Rat
1562474Rif1replication timing regulatory factor 133655468936607961Rat
1563595Man1b1mannosidase, alpha, class 1B, member 1381438778165007Rat
1563596Ckap5cytoskeleton associated protein 537749119577593300Rat
2726Gpd2glycerol-3-phosphate dehydrogenase 234180055241937729Rat
1565946Pramel6preferentially expressed antigen in melanoma-like 637288501872888490Rat
1565957Rnf208ring finger protein 208380578088059721Rat
1565962Ly75lymphocyte antigen 7534476470244852219Rat
1564379Tmem250transmembrane protein 250389626578966349Rat
1564993Med27mediator complex subunit 2731262959312803340Rat
1565817Surf2surfeit 231024465410248502Rat
1565575Setxsenataxin31242809112480801Rat
1564974RGD1564974similar to glyceraldehyde-3-phosphate dehydrogenase363515026352602Rat
1562244Sestd1SEC14 and spectrin domain containing 136212359062220759Rat
1565767RGD1565767similar to ribosomal protein L1535569919155700292Rat
1561137RGD1561137similar to 40S ribosomal protein S1632149415521494684Rat
1564400RGD1564400similar to Eukaryotic translation initiation factor 5 (eIF-5)35356653153569302Rat
1564403Lrsam1leucine rich repeat and sterile alpha motif containing 131622336716264261Rat
1565990Pramel7preferentially expressed antigen in melanoma-like 737287076372873735Rat
1359638Cdk9cyclin-dependent kinase 931599646716001315Rat
1584015LOC690155similar to phosducin-like32087269120881151Rat
1584969Abl1ABL proto-oncogene 1, non-receptor tyrosine kinase31497985315083065Rat
1584970Bmycbrain expressed myelocytomatosis oncogene385125698513328Rat
1359111Tor2atorsin family 2, member A31604856616053198Rat
1584028LOC690140similar to olfactory receptor Olr137432083661620837548Rat
1584127LOC688839similar to GTPase activating protein testicular GAP1346135224645912Rat
1561113Bblnbublin coiled coil protein31567457715677393Rat
1561736RGD1561736similar to ribosomal protein L1032455508024555585Rat
1562587Wdr38WD repeat domain 3832275014522753441Rat
1565200Ggta1l1glycoprotein, alpha-galactosyltransferase 1-like 131868471818701674Rat
1562526Fam171bfamily with sequence similarity 171, member B36893075568986113Rat
1565257Ubr3ubiquitin protein ligase E3 component n-recognin 335464980354806779Rat
1582840LOC690273hypothetical protein LOC69027332108898921090611Rat
1561599Cers6ceramide synthase 635363063653879692Rat
1565066RGD1565066similar to 60S ribosomal protein L3838177463881774955Rat
1565106Rpl12ribosomal protein L1231626426916266645Rat
1584372LOC684988similar to ribosomal protein S1331012808410128621Rat
1564362Lcn10lipocalin 10384907818494334Rat
1564535Rnf224ring finger protein 224380503538052861Rat
1565385Cwc22CWC22 spliceosome associated protein homolog36281523062864269Rat
1564664RGD1564664similar to LOC387763 protein37992013179921523Rat
1566156LOC499742LRRG00137358314885845534Rat
1582986LOC688921similar to N-terminal acetyltransferase complex ARD1 subunit homolog A346462524647044Rat
1582986LOC688921similar to N-terminal acetyltransferase complex ARD1 subunit homolog A346457684646176Rat
1563514Spout1SPOUT domain containing methyltransferase 131345119113458919Rat
1565122Ttc21btetratricopeptide repeat domain 21B35086136750935782Rat
1593013Fsip2fibrous sheath-interacting protein 236796234568032866Rat
1589783Ptpmt1protein tyrosine phosphatase, mitochondrial 137688992276899427Rat
1589474Lcn12lipocalin 12383124048320206Rat
1589146LOC684539similar to olfactory receptor Olr49037073960270744687Rat
1592097LOC295611similar to Heterogeneous nuclear ribonucleoprotein A1 (Helix-destabilizing protein) (Single-strand RNA-binding protein) (hnRNP core protein A1) (HDP)33801837538025764Rat
1588382LOC502620similar to transcription elongation factor B (SIII), polypeptide 232101726421018340Rat
1590993LOC690840similar to ribosomal protein L3733209113732091463Rat
1592094LOC295681similar to Glyceraldehyde-3-phosphate dehydrogenase (GAPDH)36288481362893102Rat
1592950LOC680379similar to 60S ribosomal protein L3236851736168518050Rat
1590877LOC362075similar to eukaryotic translation elongation factor 1 alpha 2369229736924383Rat
1592203LOC690761similar to Fructose-bisphosphate aldolase A (Muscle-type aldolase)38677064886804751Rat
1590781LOC499841similar to heat shock protein 1, beta38483409484836215Rat
1590784Ttc30btetratricopeptide repeat domain 30B36085580960858380Rat
1592093LOC295698similar to heat shock protein 836835268868354443Rat
1590225LOC685743hypothetical protein LOC68574337272522572729783Rat
1589686LOC366097hypothetical LOC36609737004606570047832Rat
1589690LOC366085hypothetical pseudogene on chromosome 3q2436306810263070159Rat
1589691LOC366071similar to Ubiquitin-like protein FUBI35563059055631800Rat
1589692LOC366068similar to nuclease sensitive element binding protein 135389133653892682Rat
1589693Gapdh-ps1glyceraldehyde-3-phosphate dehydrogenase, pseudogene 134321236343214261Rat
1585192LOC690017similar to Elongation factor 1-gamma (EF-1-gamma) (eEF-1B gamma)37691534676916860Rat
1587713Fpgsfolylpolyglutamate synthase31597280015993592Rat
1589737Zdhhc5zinc finger DHHC-type palmitoyltransferase 536977203769800142Rat
1589738Max-ps1Max protein, pseudogene 133252095032521403Rat
1589739LOC362126similar to Voltage-dependent anion-selective channel protein 2 (VDAC-2) (mVDAC2) (mVDAC6) (Outer mitochondrial membrane protein porin 2)32321552623222603Rat
1587670Eno1-ps1enolase 1, (alpha), pseudogene 135757664357578321Rat
1587102LOC679581hypothetical protein LOC67958133467336934674656Rat
1587119Lypd6LY6/PLAUR domain containing 633448722234632887Rat
1588379LOC502623similar to Ribosome biogenesis regulatory protein homolog32093932120942374Rat
1588374LOC502637similar to prothymosin alpha35954774359548317Rat
1588377LOC502627similar to L-lactate dehydrogenase A chain (LDH-A) (LDH muscle subunit) (LDH-M)33646040936461527Rat
1561766RGD1561766similar to basic transcription factor 331962091619621457Rat
1359690Rnd3Rho family GTPase 333557192935589283Rat
1590646LOC680514similar to ras homolog gene family, member G36933052269331862Rat
1590958LOC690876similar to transcription elongation factor B (SIII), polypeptide 232100647021007502Rat
1587010LOC680873similar to Wolf-Hirschhorn syndrome candidate 237052263470525853Rat
1589699Klf5-ps1Kruppel-like factor 5, pseudogene 131978734019790302Rat
1589700LOC366006similar to ribosomal protein L28382286568229403Rat
1583266LOC685034similar to 40S ribosomal protein S7 (S8)35192430851925946Rat
1585467Hmcn2hemicentin 231458835314738320Rat
1590629Sapcd2suppressor APC domain containing 2381860898195119Rat
1584801LOC679740hypothetical protein LOC67974036305576063061070Rat
1586630LOC686066similar to 60S ribosomal protein L3831366296613663913Rat
1589694LOC366056similar to Glyceraldehyde-3-phosphate dehydrogenase (GAPDH)34196962741994850Rat
1589697LOC366036hypothetical LOC36603632303352923034161Rat
1589698LOC366027similar to NME1-NME2 protein32088106320883655Rat
1588212Obp2aodorant binding protein 2A385059908509269Rat
1588504LOC366131hypothetical LOC36613138487283384873338Rat
1588505LOC366130similar to Down syndrome critical region protein 3 homolog (Down syndrome critical region protein A homolog)38310296783141840Rat
1594532Psmd14proteasome 26S subunit, non-ATPase 1434625433846347076Rat
1594533LOC311067similar to proteasome 26S non-ATPase subunit 834545612445469819Rat
1597527Pip5kl1phosphatidylinositol-4-phosphate 5-kinase-like 131586049315869264Rat
1597535Fam102afamily with sequence similarity 102, member A31582314715854651Rat
1598075LOC679995similar to heat shock protein 8362282216231969Rat
1593188Engendoglin31593456615972618Rat
1596954LOC678730similar to Acidic leucine-rich nuclear phosphoprotein 32 family member A (Leucine-rich acidic nuclear protein)36129134161293039Rat
1596103LOC690401hypothetical protein LOC69040132242836922429945Rat
1592240LOC690724similar to heat shock protein 1, beta38591628385918458Rat
1592252LOC690712similar to adaptin-ear-binding coat-associated protein 138544977285453693Rat
1591773Tbr1T-box brain transcription factor 134635023746368397Rat
1594965LOC686683similar to olfactory receptor 7337351652273517463Rat
1594971LOC686677similar to olfactory receptor 116137351026673511198Rat
1595007LOC686641similar to olfactory receptor 116037339172173392674Rat
1592609Gtf3c4general transcription factor IIIC subunit 431215480312172795Rat
1596837Tbpl2TATA box binding protein-like 2367724196793213Rat
1593416LOC690655similar to High mobility group protein 1 (HMG-1) (High mobility group protein B1) (Amphoterin) (Heparin-binding protein p30)32766516727706078Rat
1597179LOC296593similar to Aspartate aminotransferase, mitochondrial precursor (Transaminase A) (Glutamate oxaloacetate transaminase 2)396791959680482Rat
1597180LOC296537similar to heterogeneous nuclear ribonucleoprotein K isoform a367945726795942Rat
1594720Scaisuppressor of cancer cell invasion32281328322925364Rat
1591934Klf5-ps2Kruppel-like factor 5, pseudogene 232107191521073656Rat
1591937Tbc1d13TBC1 domain family, member 1331340893513425524Rat
1591938Gbgt1globoside alpha-1,3-N-acetylgalactosaminyltransferase 1 (FORS blood group)31182613111829745Rat
1591939NrarpNotch-regulated ankyrin repeat protein379925827995136Rat
1587131Pjvkpejvakin36159464461605051Rat
1594833LOC689219similar to serine (or cysteine) proteinase inhibitor, clade B, member 1a37486199474862665Rat
1596039Accsl1-aminocyclopropane-1-carboxylate synthase-like37982646479841163Rat
1597229LOC691665similar to GTPase activating protein testicular GAP1355240375712916Rat
1593249Itga4integrin subunit alpha 436416276464235010Rat
1593250Ccdc141coiled-coil domain containing 14136194861462109968Rat
1595411LOC681413similar to stem-loop binding protein31005182710052637Rat
1597546Naif1nuclear apoptosis inducing factor 131574233715747672Rat
1588742Ttll11tubulin tyrosine ligase like1131910989119335077Rat
1590196LOC685772similar to suppression of tumorigenicity 1337274006372741653Rat
1588601Hoxd3homeo box D335963870859650282Rat
1588371LOC502653similar to myc induced nuclear antigen37911599679118672Rat
1588372LOC502650similar to Double-strand-break repair protein rad21 homolog (Pokeweed agglutinin-binding protein 29) (PW29) (SCC1 homolog)37324366573247680Rat
1595512Rprmreprimo, TP53 dependent G2 arrest mediator homolog33853958138540998Rat
1597330Prdm11PR/SET domain 1137892565479005495Rat
1591313LOC686900similar to olfactory receptor 119837453238974533315Rat
1596290Traf1TNF receptor-associated factor 131822202418242163Rat
1590104LOC687065similar to olfactory receptor Olr69537530108875302047Rat
1594334Bex4-ps1brain expressed X-linked 4, pseudogene 137476402874764725Rat
1593261LOC302022similar to nidogen 2 protein340869034097689Rat
1596705LOC681385similar to Vomeronasal secretory protein 2 precursor (Vomeronasal secretory protein II) (VNSP II) (Lipocalin-4)399143469917729Rat
1595050Ppp1r26protein phosphatase 1, regulatory subunit 2631178150411790076Rat
1598138Nxph2neurexophilin 2359861755988525Rat
1598156LOC679914similar to heterogeneous nuclear ribonucleoprotein L isoform a359387995940777Rat
1598165LOC679905similar to heat shock protein 1, beta33953186339534065Rat
1598085LOC679985similar to SGT1 protein homolog (Ecdysoneless homolog)362183606224289Rat
1598011LOC681261similar to Glutathione S-transferase P 2 (GST YF-YF) (GST-piA) (GST class-pi) (Gst P2)378302787831165Rat
1597699LOC685184similar to protein expressed in prostate, ovary, testis, and placenta 8 isoform 235328445453518848Rat
1598030LOC681242hypothetical protein LOC68124234926662949267219Rat
1596715Lcn4lipocalin 4397992459802114Rat
1595906Prrc2bproline-rich coiled-coil 2B31543335715519105Rat
1597714Fam163bfamily with sequence similarity 163, member B31043738310466458Rat
1595484LOC680140similar to H/ACA ribonucleoprotein complex subunit 4 (Dyskerin) (Nucleolar protein family A member 4) (snoRNP protein DKC1) (Nopp140-associated protein of 57 kDa) (Nucleolar protein NAP57)33875218938753825Rat
1595622LOC503388similar to ubiquitin-conjugating enzyme E2 variant 1333234733324564Rat
1596130Zbtb34zinc finger and BTB domain containing 3431670335516726065Rat
2293817Paepprogestagen associated endometrial protein385311368534430Rat
2307241AboABO, alpha 1-3-N-acetylgalactosaminyltransferase and alpha 1-3-galactosyltransferase31016208710182835Rat
2318583Znf408zinc finger protein 40837761559577621325Rat
2319335LOC100361842hypothetical LOC10036184238433888884339352Rat
2318156LOC100362432mitochondrial import inner membrane translocase subunit Tim23-like38003615780037243Rat
2318157Ttc30atetratricopeptide repeat domain 30A36090189660905350Rat
2318734LOC100362149ribosomal protein S20-like32243024722430764Rat
2318201LOC100365887rCG27063-like37352753873528482Rat
2320108LOC100361457actin, gamma 1 propeptide-like37297776472979691Rat
2319500Ralgps1Ral GEF with PH domain and SH3 binding motif 131643332316670276Rat
2318320LOC10036236640S ribosomal protein S17-like32401982024020305Rat
2318321Tmem210transmembrane protein 210381005958101643Rat
2318922Ttc16tetratricopeptide repeat domain 1631604848416064598Rat
2319534LOC100361740ribosomal RNA processing 8, methyltransferase, homolog38308598883099873Rat
2318495LOC100362290thioredoxin-like 4346457684646176Rat
2322107LOC100360449ribosomal protein L9-like395838989584606Rat
2322732LOC100360117ribosomal protein L8-like387618058762651Rat
2320625LOC100364636hypothetical LOC10036463635949876459538211Rat
2320728LOC100361132mitochondrial ribosomal protein S3635655290656553216Rat
2322918LOC100360027eukaryotic translation initiation factor 4E-like385289558529742Rat
2322350Sec16aSEC16 homolog A, endoplasmic reticulum export factor392296879264837Rat
2323086LOC100359959DEAD (Asp-Glu-Ala-Asp) box polypeptide 1833120713731210520Rat
2322483LOC100360268hypothetical LOC10036026833076880130770318Rat
2320952LOC100361008Cytochrome c oxidase subunit 5A, mitochondrial-like31380388713804503Rat
2323143LOC100359901hypothetical LOC100359901386137908614865Rat
2323145LOC100363399hypothetical LOC10036339932360318123604872Rat
2322673LOC100360176transcription factor Dp 137299230272994057Rat
2323302LOC100359840hypothetical LOC10035984035751697257520591Rat
2323331LOC100359810hypothetical LOC10035981037185894871862626Rat
2323370Btbd18BTB domain containing 1836974305769751096Rat
2320490LOC100361273hypothetical LOC10036127333789684237897073Rat
2323539LOC100359701rCG44996-like37149909571505092Rat
2324286LOC100362672oral-facial-digital syndrome 1 gene homolog34051788940522835Rat
2324332LOC100362626HIG1 domain family, member 1A38347602183476747Rat
2323737LOC100362956hypothetical LOC10036295636669966266700235Rat
4888575Mir2964microRNA 296431311862313118722Rat
2325334Mir219-2microRNA 219-231311862613118721Rat
2325335Mir181a2microRNA 181a-232261584522615961Rat
2325385Mir130amicroRNA 130a36982254269822629Rat
2325386Mir126bmicroRNA 126b394150879415159Rat
2325397Mir10bmicroRNA 10b35962843859628546Rat
2325454Mir181b2microRNA 181b-232261694822617035Rat
2324065LOC100362793ring finger protein 138-like395131119513771Rat
2325612Mir129-2microRNA 129-238020204480202140Rat
4109660Cct8-ps2chaperonin containing Tcp1, subunit 8 (theta), pseudogene 233640919636410212Rat
4888595Mir126amicroRNA 126a394150639415180Rat
4888574Mir3590microRNA 359036982254969822622Rat
2324571LOC100361645LRRGT00075-like34458106844630051Rat
6489440Hoxd8homeobox D835960786459610358Rat
6492288LOC100911508uncharacterized LOC10091150834973789049746043Rat
6492495LOC100911542E3 SUMO-protein ligase PIAS2-like37621631976229747Rat
6486084LOC100912623glyceraldehyde-3-phosphate dehydrogenase-like36919803269199409Rat
6490845LOC10091175340S ribosomal protein S7-like31774510017745785Rat
6493667LOC100911251disks large homolog 5-like32106224721072153Rat
6493893LOC100911266uncharacterized LOC100911266394646199467510Rat
6492996Brd3osBRD3 opposite strand31076981510771860Rat
6491326LOC100911723uncharacterized LOC10091172335292801152929487Rat
6487629LOC100912299zinc finger protein 532-like34253559342539695Rat
6501793LOC100909777CD99 antigen-like protein 2-like347390984752927Rat
6495960LOC100910935alpha-enolase-like36861797868618933Rat
6500051LOC100910096ribosome biogenesis protein NSA2 homolog36227736762278418Rat
6503504LOC100909421ADP/ATP translocase 2-like36922427469225221Rat
6500739Olr1258olfactory receptor 125837592887275930939Rat
6500810LOC100910012ATP synthase lipid-binding protein, mitochondrial-like37990528579908374Rat
7498952LOC102548671uncharacterized LOC10254867132943454929491656Rat
7489036Mir6216microRNA 621634475686144756938Rat
7489046Mir7578microRNA 757831077809010778171Rat
7527047LOC102552809uncharacterized LOC10255280935912311259135627Rat
7530968LOC102548992leucine-rich repeat protein SHOC-2-like34730189447305302Rat
7513228LOC102554364ubiquitin-conjugating enzyme E2 variant 1-like325620932562880Rat
7534963LOC102552899N-alpha-acetyltransferase 11-like327345402737609Rat
7502848LOC102556679uncharacterized LOC10255667933413506434137136Rat
7498194LOC102549016uncharacterized LOC10254901635626546556279458Rat
7519388LOC102548933uncharacterized LOC10254893331868483718704251Rat
7539539LOC102549766uncharacterized LOC10254976638113790181152786Rat
7519941LOC102549213uncharacterized LOC10254921331885924518864078Rat
7645726LOC102553121uncharacterized LOC10255312136441340964422066Rat
7662975LOC102557176ATP synthase F(0) complex subunit C1, mitochondrial-like37792215677933684Rat
7632280LOC102549381uncharacterized LOC102549381372740047281851Rat
7620876LOC102552327PIH1 domain-containing protein 1-like388140638816906Rat
7622113LOC102548934uncharacterized LOC10254893432999381829998722Rat
7623233LOC102554311uncharacterized LOC10255431132258587022613734Rat
7653649LOC102546816uncharacterized LOC102546816351328935137099Rat
7624465LOC102552656uncharacterized LOC10255265634140397441420166Rat
7576402LOC102554501uncharacterized LOC10255450131394938313953181Rat
7654995LOC102556236nucleoside diphosphate kinase B-like32111942321122807Rat
7625660LOC102546895uncharacterized LOC10254689537876463778790315Rat
7626419LOC102554040uncharacterized LOC10255404031854880318551679Rat
7629611LOC102550392uncharacterized LOC10255039231381381213823726Rat
7612019LOC102546819uncharacterized LOC10254681935794069557992557Rat
7593039LOC102554396uncharacterized LOC10255439636995561469957212Rat
7571468LOC102552919glyceraldehyde-3-phosphate dehydrogenase-like34070575640706713Rat
7597606LOC102553346R3H domain-containing protein 2-like33264742532683617Rat
7598318LOC102548277uncharacterized LOC10254827736880925568837978Rat
7600298LOC102548484uncharacterized LOC10254848431033579410342922Rat
7560679LOC10255585060S ribosomal protein L10-like36062407960634739Rat
7578982LOC102550017uncharacterized LOC10255001731677835916781260Rat
7579002LOC102547011uncharacterized LOC10254701131303343113040798Rat
7579074LOC102555599olfactory receptor 5L1-like37344479973445737Rat
7549589LOC102555148uncharacterized LOC10255514835646139656468036Rat
7582623Prrt1bproline rich transmembrane protein 1B31301985213028865Rat
7566091LOC102554564uncharacterized LOC10255456436054150060544208Rat
7584653LOC102549214uncharacterized LOC10254921435645262356460538Rat
7606520LOC102552170uncharacterized LOC10255217035848645558510222Rat
7554897LOC10255355240S ribosomal protein S7-like35941704159418716Rat
7554908LOC102555913uncharacterized LOC10255591334309817143101848Rat
7691310LOC102555425uncharacterized LOC10255542533472651434736258Rat
41054285LOC12010158940S ribosomal protein S7-like36951757269525563Rat
7692108LOC102550543uncharacterized LOC102550543388062048811939Rat
7692756LOC102553021uncharacterized LOC10255302136434495264382593Rat
7694271LOC102555600uncharacterized LOC10255560037664321876665885Rat
7676304LOC102553976uncharacterized LOC10255397635200823752112424Rat
7704830LOC10254785015 kDa interferon-responsive protein-like36610772666108582Rat
7704837LOC102547612uncharacterized LOC102547612394865869489575Rat
7704882LOC102555817dynein heavy chain 17, axonemal-like35769212657699221Rat
7707315LOC102546322COPII coat assembly protein sec16-like32281271922819111Rat
7725305LOC102552073uncharacterized LOC102552073394802719483554Rat
7713489LOC102551365stress response protein nst-1-like358506125851308Rat
7733574LOC102554395uncharacterized LOC10255439536037104660401138Rat
7738850LOC102546693uncharacterized LOC10254669337839610678414091Rat
7739841LOC102555754uncharacterized LOC10255575434273588542743489Rat
7741314LOC102546443NEDD4-binding protein 1-like32315047223151651Rat
7716591LOC102551618ADP-ribosylation factor 4-like34462585044630139Rat
7671946LOC102556145uncharacterized LOC10255614534325161443259310Rat
7672446LOC102551533uncharacterized LOC102551533345117664536771Rat
7674410LOC102547078myb-related transcription factor, partner of profilin-like37894486778950402Rat
7703143LOC102550940uncharacterized LOC10255094031820991118218526Rat
7679486LOC102548384alpha-endosulfine-like31021229710212906Rat
7749459LOC102554600uncharacterized LOC10255460032271624422731175Rat
7729778LOC102552685uncharacterized LOC10255268536403516264045120Rat
7730597Hoxd11homeobox D1135958484059587257Rat
7682627LOC102548789uncharacterized LOC10254878931053983710541623Rat
9093487LOC10369180540S ribosomal protein S14 pseudogene32371140923711911Rat
9094692LOC103691771uncharacterized LOC10369177131838505718387293Rat
9176020LOC103691841uncharacterized LOC10369184136791358067918933Rat
9078858LOC103695171uncharacterized LOC10369517135704225157066815Rat
9183373LOC103691820uncharacterized LOC10369182035791270257917164Rat
9190663LOC103691811dynein light chain roadblock-type 1 pseudogene34388464343885168Rat
9112027LOC103691831cation-dependent mannose-6-phosphate receptor pseudogene34627299746287040Rat
9124575LOC103691830uncharacterized LOC10369183036453035764536487Rat
9075793LOC103690391uncharacterized LOC10369039132957970029583753Rat
9209512LOC103691847uncharacterized LOC10369184737801233878013177Rat
9085992LOC103691755activated RNA polymerase II transcriptional coactivator p15 pseudogene395312509532179Rat
9224218LOC103691818uncharacterized LOC10369181835771057357714304Rat
9354787LOC103691849uncharacterized LOC10369184938769980387711037Rat
9273023Zeb2-as1ZEB2 antisense RNA 132934307829345943Rat
9234849LOC103691784uncharacterized LOC10369178433333319233534008Rat
9254480LOC103691836uncharacterized LOC10369183636510945665118974Rat
9255683LOC103691768uncharacterized LOC10369176831762428617653427Rat
9339909LOC103691762microtubule-associated proteins 1A/1B light chain 3B pseudogene31164751611656307Rat
9258213LOC103691765uncharacterized LOC10369176531550848415521544Rat
9300418LOC103691752uncharacterized LOC103691752389466738960015Rat
9300457LOC10369515260S ribosomal protein L39 pseudogene31696991316970148Rat
9343998LOC103691754uncharacterized LOC103691754393273439349005Rat
9261493LOC103691844uncharacterized LOC10369184437664746776650894Rat
9345818LOC103691823NADH dehydrogenase [ubiquinone] 1 alpha subcomplex subunit 1 pseudogene35887360558873938Rat
9265290LOC103691783transcription elongation factor B polypeptide 2 pseudogene33125526531255970Rat
9363799LOC103691814uncharacterized LOC10369181434709350047096631Rat
9422868LOC103695172uncharacterized LOC10369517235798282358004806Rat
9424697B3galt9beta-1,3-galactosyltransferase 931812086118124642Rat
9330172LOC10369182160S ribosomal protein L27 pseudogene35808095058081356Rat
9428172Rps27a-ps7ribosomal protein S27a, pseudogene 733780272737803281Rat
9389916LOC103690668uncharacterized LOC103690668332101383212261Rat
9390404LOC103691839olfactory receptor 5M3-like37106604471066988Rat
9400923LOC103691816uncharacterized LOC10369181635648552256490015Rat
9854659LOC105650978peptidylprolyl isomerase A (cyclophilin A) pseudogene33781397937814699Rat
11455941LOC10835056240S ribosomal protein S26-like37677321576773918Rat
11355973Lcn15l1lipocalin-15 like 1386160628620717Rat
11471288Trnaa-cgc1transfer RNA alanine (anticodon CGC) 134176222741762298Rat
11472940LOC108350373uncharacterized LOC10835037333825885938310242Rat
11473570LOC108350366uncharacterized LOC10835036632221469422257038Rat
11444381Trnav-aac2transfer RNA valine (anticodon AAC) 233455988934559961Rat
11362073LOC108350398uncharacterized LOC10835039835844657458448992Rat
11445349LOC108350417uncharacterized LOC10835041737846585678494535Rat
11437224LOC108350397uncharacterized LOC10835039735772031357788490Rat
11446749LOC108350379uncharacterized LOC10835037934514411645149094Rat
11450160LOC10835054860S ribosomal protein L34 pseudogene384816378482006Rat
11429097LOC108350392glyceraldehyde-3-phosphate dehydrogenase pseudogene35598325055993524Rat
11429489LOC108350370uncharacterized LOC10835037033121664431228107Rat
11373432LOC108350369uncharacterized LOC10835036932962628029676672Rat
11432617LOC108350383uncharacterized LOC10835038334782143847837682Rat
11383937LOC108350593uncharacterized LOC10835059333136701831374155Rat
11405618LOC108350340uncharacterized LOC108350340391732589189568Rat
11412302LOC108350358uncharacterized LOC10835035831936841019371814Rat
11414657LOC108350559alpha-enolase pseudogene37281684372817685Rat
11415833LOC10835035540S ribosomal protein S29 pseudogene31865282818653581Rat
11418889LOC108348196odorant-binding protein 2b-like385627738564851Rat
11418915LOC108350600H/ACA ribonucleoprotein complex subunit 3 pseudogene36865617268656369Rat
11419132LOC108350555uncharacterized LOC10835055535077966950806160Rat
11420073LOC108350364uncharacterized LOC10835036432109127421095976Rat
11422106LOC108350591glyceraldehyde-3-phosphate dehydrogenase pseudogene31349774513502170Rat
11422397LOC108350580uncharacterized LOC10835058034437592444379414Rat
11422631LOC108350582serine/arginine-rich splicing factor 3 pseudogene35818703358188641Rat
11425388LOC108350365uncharacterized LOC10835036532119941021205009Rat
11425803LOC108350352uncharacterized LOC10835035231737963817415805Rat
11426631LOC108350393uncharacterized LOC10835039335634059956364901Rat
11408567LOC108350390uncharacterized LOC10835039035439624654402640Rat
11375987LOC108350353uncharacterized LOC10835035331771249617715730Rat
11409438LOC108350561copine-8 pseudogene37512316575124523Rat
11387673LOC108348230zinc finger protein 120-like333528803356833Rat
11377311LOC108350345uncharacterized LOC10835034531240940612427689Rat
11377829Trnag-gcc1transfer RNA glycine (anticodon GCC) 134176254441762614Rat
11401035LOC108350389glucose-6-phosphatase 2-like35399846454043357Rat
11401909LOC108352563uncharacterized LOC10835256334571752245752406Rat
11402264LOC108350341uncharacterized LOC108350341393975919400344Rat
11391174LOC108352564uncharacterized LOC10835256434566369645700941Rat
11380967LOC108350412uncharacterized LOC10835041236962496769633729Rat
11404757LOC108350414uncharacterized LOC10835041437661005276616791Rat
11502263LOC108350374uncharacterized LOC10835037433993432739943737Rat
11477246LOC108350415low molecular weight phosphotyrosine protein phosphatase pseudogene37755665177560912Rat
11478124Trnap-agg5transfer RNA proline (anticodon AGG) 536902568269025755Rat
11478808LOC108350396uncharacterized LOC10835039635743095657470280Rat
11504008LOC108350601uncharacterized LOC10835060137249395372507941Rat
11504759LOC10835058860S ribosomal protein L23-like380012098002446Rat
11479749LOC108350553uncharacterized LOC10835055333385559633860220Rat
11507559LOC108350372uncharacterized LOC10835037233297332732986885Rat
11496785LOC10835055160S ribosomal protein L12 pseudogene32424981424250522Rat
11497057LOC108348105allergen Fel d 4-like386090118612151Rat
11509734LOC108350599DNA polymerase epsilon subunit 4 pseudogene36732437767324995Rat
11498171LOC108350401uncharacterized LOC10835040136027047060298941Rat
11498418LOC108350367uncharacterized LOC10835036732887037328882513Rat
11483043LOC108350387uncharacterized LOC10835038735109399351267758Rat
11514172LOC108350557uncharacterized LOC10835055735730679257322744Rat
11486579LOC108350597ubiquitin-conjugating enzyme E2 S-like35869707358699024Rat
41353490LOC120101584uncharacterized LOC12010158436260438162611643Rat
41353600LOC120101545uncharacterized LOC12010154532974202229786773Rat
41378324LOC120101504uncharacterized LOC120101504372813367292177Rat
41378879LOC120102120small nucleolar RNA U336555215365552258Rat
41086516LOC120101586uncharacterized LOC12010158636661037566633821Rat
41087157LOC120102072small nucleolar RNA SNORA1733081550330815603Rat
41110845NEWGENE_40934091transfer RNA alanine (anticodon AGC)37758347877583559Rat
41110934LOC120102084small nucleolar RNA SNORA2631476836214768482Rat
41136913LOC120101516uncharacterized LOC12010151631374721513754220Rat
41138727LOC120101579uncharacterized LOC12010157936096379660980819Rat
41167978LOC120101842rho GTPase-activating protein 20-like351251415131436Rat
41235057LOC120101530uncharacterized LOC12010153031883080318840164Rat
41248999LOC120101958U6 spliceosomal RNA393950339395140Rat
41275875LOC120101884uncharacterized LOC120101884325469392548319Rat
41276621LOC120101560uncharacterized LOC12010156035528528955292594Rat
41281990LOC120101865thioredoxin-like protein 4A342138184214009Rat
41282733LOC120102089U1 spliceosomal RNA33942831239428454Rat
41323100LOC120101561uncharacterized LOC12010156135529262955311439Rat
41381402LOC120102016small nucleolar RNA SNORA2137820850478208636Rat
41088214LOC120093150ralA-binding protein 1-like327376482767118Rat
41088371LOC120101582titin-like36177607861777691Rat
41112624LOC120101593uncharacterized LOC12010159337100253871014287Rat
41113215LOC120102083small nucleolar RNA SNORA2631082231010822430Rat
41168553LOC120101564uncharacterized LOC12010156435712938257132860Rat
41277121LOC120101483polyubiquitin-like348360435422796Rat
41283883LOC12010168260S ribosomal protein L34-like37819464178218915Rat
41357595LOC120101510uncharacterized LOC120101510390645709072157Rat
41113803LOC120101557uncharacterized LOC12010155734978621349795843Rat
41279071LOC120101882uncharacterized LOC120101882334684883480630Rat
41279617LOC120101911baculoviral IAP repeat-containing protein 5-like37756292477565335Rat
41326115LOC120101846N-alpha-acetyltransferase 11-like342122174213772Rat
41358771LOC120101434uncharacterized LOC12010143433378665333790312Rat
41358883LOC1201019685.8S ribosomal RNA330189433019095Rat
41359583LOC120101868ubiquitin-like331597833160227Rat
41385144LOC120093151ralA-binding protein 1-like350738485111429Rat
41385392LOC12010154928S ribosomal protein S21, mitochondrial-like33945908339459334Rat
41115092LOC120101890uncharacterized LOC12010189031339693513408930Rat
41206601LOC120101606uncharacterized LOC12010160638840142488413464Rat
41279871LOC120101513uncharacterized LOC12010151331086767010875205Rat
41286585LOC120093140rho GTPase-activating protein 20-like342135464245180Rat
41286650LOC120102046U1 spliceosomal RNA31565059515650750Rat
41360375LOC120101429transcription elongation factor A protein 1-like368768446880248Rat
41360871LOC120102031small nucleolar RNA SNORA48383091518309287Rat
41386871LOC1201020405S ribosomal RNA34127416641274284Rat
41387376LOC120101443E3 ubiquitin-protein ligase RBX1-like35843219458432513Rat
41092074LOC120101524mitochondrial import inner membrane translocase subunit Tim17-B-like31577667815777190Rat
41092174LOC120101450uncharacterized LOC12010145037242133472423067Rat
41092566LOC120101541uncharacterized LOC12010154132689036826909301Rat
41117082LOC120102079small nucleolar RNA SNORA4033815393638154056Rat
41209010LOC120101896elongin-B-like32099050420992516Rat
41254171LOC120101908uncharacterized LOC12010190834470164544705078Rat
41260220LOC120101542MLV-related proviral Env polyprotein-like32733382827335839Rat
41328151LOC120101536uncharacterized LOC12010153631956929119569873Rat
41362468LOC120102114U2 spliceosomal RNA36292034662920495Rat
41146528LOC120101845N-alpha-acetyltransferase 11-like350769665078819Rat
41147581LOC120101858ubiquitin-60S ribosomal protein L40-like340476694048102Rat
41174493LOC120101869uncharacterized LOC120101869344776504511656Rat
41174744LOC120101861thioredoxin-like protein 4A346806484680839Rat
41260489LOC120102022small nucleolar RNA SNORA4831685366616853809Rat
41261021LOC120102131U6 spliceosomal RNA33858576838585874Rat
41329305LOC120101445U1 small nuclear ribonucleoprotein C-like36014329360143801Rat
41329974LOC120101841nidogen-2-like326673112672013Rat
41094759LOC12010167440S ribosomal protein S14-like34387634543876799Rat
41095059LOC120101879uncharacterized LOC120101879335871943592561Rat
41120623LOC120102065small nucleolar RNA SNORA1736855210568552234Rat
41120841LOC120101583uncharacterized LOC12010158336170468761819104Rat
41148402LOC120102035small nucleolar RNA SNORA4835009309950093233Rat
41148559LOC120101598uncharacterized LOC12010159837855911578561802Rat
41148686LOC120101971U6 spliceosomal RNA31819866018198758Rat
41176411LOC120101555uncharacterized LOC12010155534775002347778195Rat
41176684LOC120102081small nucleolar RNA SNORA4032830634528306467Rat
41211519LOC120101433uncharacterized LOC12010143333174359231778599Rat
41212359LOC120101880uncharacterized LOC120101880342533724267427Rat
41261703LOC120101595uncharacterized LOC12010159537802665178031602Rat
41263037LOC120101440uncharacterized LOC12010144034209700342112153Rat
41339341LOC120102127U4 spliceosomal RNA38551434785514473Rat
41390852LOC120101956U6 spliceosomal RNA380245528024656Rat
41097145LOC120102101small nucleolar RNA U1335462478454624882Rat
41097203LOC120101870nidogen-2-like347694054795658Rat
41177880LOC120101491ubiquitin-40S ribosomal protein S27a-like33625497536261863Rat
41178028LOC120101444uncharacterized LOC12010144435890829958910812Rat
41189108LOC120101563uncharacterized LOC12010156335641797256447528Rat
41189848LOC120102020small nucleolar RNA SNORA5537056510270565233Rat
41212619LOC120102013small nucleolar RNA SNORA4437672882376728928Rat
41264059LOC120101431odorant binding protein 2B31013785110141190Rat
41264379LOC120101509uncharacterized LOC120101509388579318865742Rat
41342432LOC120093059thioredoxin-like protein 4A339449383945129Rat
41342627LOC120101485uncharacterized LOC120101485379433587945823Rat
41342810LOC120101517uncharacterized LOC12010151731394409213949236Rat
41366090LOC120102070small nucleolar RNA SNORA1736563224465632364Rat
41366759LOC120101886uncharacterized LOC120101886332646573267153Rat
41392788LOC120101479zinc finger protein 844-like337890103793945Rat
41393928LOC120102048small nucleolar RNA SNORA1732689649926896629Rat
41098018LOC120102053small nucleolar RNA SNORA1734744325747443380Rat
41098957LOC120101969U6 spliceosomal RNA35868956358689673Rat
41179729LOC120101952U6 spliceosomal RNA34643474946434854Rat
41180258LOC120101447uncharacterized LOC12010144736934391569346980Rat
41180494LOC120101850ubiquitin-conjugating enzyme E2 variant 1-like336600583660914Rat
41191940LOC120102017small nucleolar RNA SNORA43394654269465556Rat
41265603LOC120101877uncharacterized LOC120101877353766485387812Rat
41287506LOC120102039small nucleolar RNA SNORA17394667009466831Rat
41367619LOC120101974U6 spliceosomal RNA37450439974504503Rat
41368318LOC120101889SET nuclear proto-oncogene31333456413345598Rat
41368639LOC120101605uncharacterized LOC12010160538550759585531319Rat
41368742LOC120102000small nucleolar RNA SNORD6231550684715506931Rat
41101549LOC120101894elongin-B-like32102182521022305Rat
41124612LOC120101552uncharacterized LOC12010155234605991446066272Rat
41125121LOC120101855ubiquitin-60S ribosomal protein L40-like329707102971018Rat
41156540LOC120101947U6 spliceosomal RNA38133842281338524Rat
41192492LOC12010157160S ribosomal protein L19-like35872247458723687Rat
41266482LOC120101460heterogeneous nuclear ribonucleoproteins C1/C2-like35472476254732130Rat
41266536LOC120101893elongin-B-like32100233621003559Rat
41267202LOC120101857ubiquitin-like354707475471062Rat
41288477LOC120101954U6 spliceosomal RNA37243977872439879Rat
41345559LOC120101990U1 spliceosomal RNA31214941612149579Rat
41345808LOC12010156540S ribosomal protein S13-like35738340157393461Rat
41369322LOC120101851ubiquitin-conjugating enzyme E2 variant 1-like336855223686366Rat
41102312LOC12010143660S ribosomal protein L29-like33631504736315697Rat
41102588LOC120102074small nucleolar RNA SNORA1735682530756825429Rat
41126396LOC120101905uncharacterized LOC12010190532856536028568221Rat
41126518LOC120101546uncharacterized LOC12010154633134491731365067Rat
41157485LOC120101508uncharacterized LOC120101508384502298450991Rat
41157828LOC120102092small nucleolar RNA SNORA7932273807222738216Rat
41194913LOC120101939U6 spliceosomal RNA34166480541664911Rat
41217695LOC120101556uncharacterized LOC12010155634911070749143091Rat
41291098LOC120101881uncharacterized LOC120101881328781082888266Rat
41291422LOC120101683uncharacterized LOC12010168338484873584854158Rat
41346459LOC120101507uncharacterized LOC120101507383034958311242Rat
41346934LOC120101854N-alpha-acetyltransferase 11-like339452373945970Rat
41346969LOC120101938U6 spliceosomal RNA37223844172238547Rat
41347654LOC120102126U4 spliceosomal RNA32050396520504098Rat
41371499LOC120102014small nucleolar RNA SNORA42/SNORA80 family35696432756964460Rat
41397579LOC120102002small nucleolar RNA SNORD6231551051515510599Rat
41070396LOC120102075small nucleolar RNA SNORA1735049016850490295Rat
41103127LOC120101480rho GTPase-activating protein 20-like338879133899534Rat
41160298LOC120101885uncharacterized LOC120101885327863632790093Rat
41160367LOC120101912uncharacterized LOC12010191237747311277476085Rat
41184129LOC120101599uncharacterized LOC12010159937845666578462854Rat
41195488LOC120101600uncharacterized LOC12010160037874042878767369Rat
41195976LOC120101902uncharacterized LOC12010190232186943921878730Rat
41270589LOC120101439uncharacterized LOC12010143934108407641091751Rat
41347799LOC120101442uncharacterized LOC12010144235759414057602949Rat
41372376NEWGENE_40934091transfer RNA alanine (anticodon AGC)33664813836648210Rat
41399479LOC120101574uncharacterized LOC12010157435965499259656589Rat
41399625LOC120101578uncharacterized LOC12010157836064534560664056Rat
41071525LOC120101481ubiquitin-like343286824329120Rat
41071997LOC120101597uncharacterized LOC12010159737813429878153037Rat
41104184LOC120101604uncharacterized LOC12010160438131542181325756Rat
41129592LOC120101432olfactory receptor 1G1-like32080765020808705Rat
41185601LOC120101860nidogen-2-like349749154976046Rat
41185658LOC120101895elongin-B-like32102914221030159Rat
41350547LOC120101512uncharacterized LOC120101512393753009386809Rat
41374491LOC120102124U4 spliceosomal RNA32142035421420481Rat
41374742LOC120101493cyclin-dependent kinase 4-like33683868736839389Rat
41106093LOC120101591uncharacterized LOC12010159136978897869791485Rat
41106923LOC120102123U4 spliceosomal RNA34513767345137755Rat
41131100LOC120101843N-alpha-acetyltransferase 11-like346809504682052Rat
41295610LOC12010145160S ribosomal protein L9-like37305870673059260Rat
41351484LOC120101482uncharacterized LOC120101482345851314598074Rat
41401869LOC120101681olfactory receptor 4A16-like37544536175446344Rat
41402436LOC1201019795.8S ribosomal RNA330314543031606Rat
41403016LOC120102041small nucleolar RNA SNORA1735005387150054023Rat
41403109LOC120101490uncharacterized LOC12010149033374321433748338Rat
41403195LOC120102100U2 spliceosomal RNA31367251113672701Rat
41083196LOC120101673uncharacterized LOC12010167333970322739763930Rat
41083239LOC120101991U7 small nuclear RNA34982031849820381Rat
41083260LOC120101486uncharacterized LOC12010148632118503821192945Rat
41083699LOC120101961U6 spliceosomal RNA37231755172317654Rat
41107518LOC120101525uncharacterized LOC12010152531631154516314634Rat
41131733LOC120101520protein BANP-like31526483815269424Rat
41132045LOC120101569jupiter microtubule associated homolog 1-like35775455257756932Rat
41165056LOC120101544uncharacterized LOC12010154432897037628991302Rat
41165060LOC120101572uncharacterized LOC12010157235879525758799419Rat
41165151LOC12010143760S ribosomal protein L28-like33636699136367397Rat
41199509LOC120101580uncharacterized LOC12010158036126693661268645Rat
41199907LOC120101511uncharacterized LOC120101511393490259350059Rat
41199927LOC120101540WW domain-binding protein 1-like32350067223506356Rat
41200055LOC120101603uncharacterized LOC12010160337972968479741304Rat
41232171LOC120101523uncharacterized LOC12010152331569409015695381Rat
41296457LOC120101539uncharacterized LOC12010153932261895022632367Rat
41133334LOC120102086small nucleolar RNA SNORD9032116296821163078Rat
41133548LOC12010143060S ribosomal protein L23a-like370015337005484Rat
41166556LOC120102097U6atac minor spliceosomal RNA37387989073880015Rat
41200826LOC120101897elongin-B-like32099870320999415Rat
41201541LOC120101601uncharacterized LOC12010160137899942979003331Rat
41233197LOC120101887uncharacterized LOC120101887340290344032251Rat
41233961LOC12010144160S ribosomal protein L9-like35177822951778790Rat
41234114LOC120101867ubiquitin-like326074842608057Rat
40944736LOC120101573uncharacterized LOC12010157335961270659615030Rat
40971153LOC120101837ralA-binding protein 1-like356852775691464Rat
40972164LOC120102096U6atac minor spliceosomal RNA31085986810859993Rat
40947203LOC120101551uncharacterized LOC12010155134361676943622513Rat
40972215LOC120101506uncharacterized LOC120101506380414698046587Rat
41011374LOC120101900uncharacterized LOC12010190032124488021283629Rat
40949761NEWGENE_40933816transfer RNA valine (anticodon AAC)35807388858073969Rat
41340043LOC120101492T-complex protein 1 subunit theta-like33640952636410608Rat
40951440LOC120101518uncharacterized LOC12010151831428668214293265Rat
41340689LOC120101878uncharacterized LOC120101878355063675517585Rat
40952537LOC120101848N-alpha-acetyltransferase 11-like356572955657996Rat
40977097LOC120102015small nucleolar RNA SNORA2/SNORA34 family33935167439351809Rat
40977179LOC120101684alpha-enolase-like38676747386768066Rat
40977553LOC120101859nidogen-2-like329228862925448Rat
40954226LOC120101585uncharacterized LOC12010158536378325263786957Rat
41014645LOC120101526uncharacterized LOC12010152631724139317247946Rat
40927458LOC120101892uncharacterized LOC12010189231364972213672928Rat
40980311LOC120101519uncharacterized LOC12010151931512691915130446Rat
40998676LOC120101438NADH dehydrogenase [ubiquinone] 1 alpha subcomplex subunit 2-like33726176337262065Rat
40928829LOC120102032small nucleolar RNA SNORA4835940862159408764Rat
40929861LOC120102068U1 spliceosomal RNA395245879524754Rat
40930499LOC120101535uncharacterized LOC12010153531937116119375704Rat
40956857NEWGENE_40938314transfer RNA serine (anticodon AGA)33725558437255658Rat
40981107LOC120101872uncharacterized LOC120101872349785825018436Rat
40982231LOC12010148960S ribosomal protein L7a-like33276042732761372Rat
41000847LOC120101675histone deacetylase 1-like35127279351295197Rat
41001645LOC120101901uncharacterized LOC12010190132109599121099779Rat
41001697LOC12010148760S ribosomal protein L7a-like32713001727164425Rat
40959111NEWGENE_40934091transfer RNA alanine (anticodon AGC)37716137077161444Rat
40983741LOC120101983small nucleolar RNA SNORD3631024052810240609Rat
41003160LOC120101898elongin-B-like32098648820987742Rat
41003309LOC120101592uncharacterized LOC12010159236990297369907309Rat
41003777LOC120101876uncharacterized LOC120101876346771154687971Rat
40932845LOC120102107U2 spliceosomal RNA35625625256256439Rat
40933123LOC120102077small nucleolar RNA SNORA1733902117039021277Rat
40933980LOC120101875uncharacterized LOC120101875343613554402334Rat
40984830LOC120101993U7 small nuclear RNA38449983684499900Rat
41005833LOC120102134U6 spliceosomal RNA37183475771834863Rat
40935280LOC120101856ubiquitin-like330791303079819Rat
40961022LOC120101906NADH dehydrogenase [ubiquinone] 1 beta subcomplex subunit 1-like33774469037745060Rat
40962046LOC120101588uncharacterized LOC12010158836887129668874358Rat
40985490LOC120102004small nucleolar RNA SNORA64/SNORA10 family38065855380658689Rat
40986794LOC120101873uncharacterized LOC120101873329102882913209Rat
41007407LOC120102113U2 spliceosomal RNA32881327728813416Rat
40963061LOC120101909uncharacterized LOC12010190937706457177091751Rat
40987535LOC120101503uncharacterized LOC120101503368412646853409Rat
40987625LOC120101899elongin-B-like32102519421026182Rat
40939229LOC120101566uncharacterized LOC12010156635755767357573426Rat
40939483LOC120101532uncharacterized LOC12010153231886873618875078Rat
40939602LOC120101538uncharacterized LOC12010153832224525122257178Rat
40989859LOC120101871uncharacterized LOC120101871341360154175596Rat
41009763LOC12010152260S ribosomal protein L7a-like31556502015566322Rat
41010086LOC120101852ubiquitin-conjugating enzyme E2 variant 1-like333718663373111Rat
41010118LOC120101488glyceraldehyde-3-phosphate dehydrogenase-like33139154631396271Rat
40940912LOC120101484uncharacterized LOC120101484365742866575454Rat
40966033LOC120101452olfactory receptor 4A15-like37549099175491908Rat
40992206LOC120101676cofilin-1-like35435215454376010Rat
40992520LOC120101997U7 small nuclear RNA32362404923624108Rat
40992840LOC120101962U6 spliceosomal RNA33776843537768539Rat
40941630LOC120101945U6 spliceosomal RNA32155175421551860Rat
40942202LOC120101548uncharacterized LOC12010154833681641136831129Rat
40943044LOC120101883uncharacterized LOC120101883345817484583230Rat
40943048LOC120101844N-alpha-acetyltransferase 11-like344746804476243Rat
40969595LOC120101840nidogen-2-like349893104998726Rat
40970579LOC120101590uncharacterized LOC12010159036980056269809661Rat
41047996LOC120101940U6 spliceosomal RNA34466084744660953Rat
41075360LOC12010156860S ribosomal protein L9-like35777056157775849Rat
41075467LOC120101935U6 spliceosomal RNA36839178168391887Rat
41242060LOC12010155860S ribosomal protein L7a-like35089553250896545Rat
41312347LOC120101943U6 spliceosomal RNA36216149362161596Rat
41312456LOC120101478zinc finger protein 844-like337200053720676Rat
41048592LOC120101577uncharacterized LOC12010157736038444460422413Rat
41075492LOC120102027small nucleolar RNA SNORA4837030782370307964Rat
41244250LOC12010145840S ribosomal protein S11-like34987113849907924Rat
41026169LOC120101537uncharacterized LOC12010153732152771321534482Rat
41245138LOC120101946U6 spliceosomal RNA31602987916029985Rat
41245427LOC120101965U6 spliceosomal RNA35952174659521846Rat
41246102LOC120101576uncharacterized LOC12010157636020335160208211Rat
41246379LOC120101602uncharacterized LOC12010160237933748679342517Rat
41080470LOC120102080small nucleolar RNA SNORA4033152792831528053Rat
41134582LOC12010154360S ribosomal protein L7a-like32880553128806969Rat
41029701LOC120101587igE-binding protein-like36706005267060851Rat
41053147LOC120101521uncharacterized LOC12010152131541798115422253Rat
41134704LOC120101567NADH dehydrogenase [ubiquinone] 1 alpha subcomplex subunit 7-like35768210557684325Rat
41135936LOC120102116U2 spliceosomal RNA37736323077363387Rat
41248438LOC120101862thioredoxin-like protein 4A350788515079254Rat
41255400LOC120101533uncharacterized LOC12010153331890657418915565Rat
41332538LOC120101907uncharacterized LOC12010190734476111544773503Rat
41144145LOC120101874uncharacterized LOC120101874332224413224524Rat
41255595LOC120101973U6 spliceosomal RNA37717341177173516Rat
41255996LOC120101955U6 spliceosomal RNA34404418944044292Rat
41256231LOC120102130U6 spliceosomal RNA33962913339629239Rat
41256826LOC120101994U7 small nuclear RNA32362397123624033Rat
41338255LOC120102043small nucleolar RNA SNORA1738061644080616571Rat
41339187LOC120101984small nucleolar RNA SNORD3631024118710241257Rat
41151319LOC120102117U12 minor spliceosomal RNA31434586014346010Rat
41258230LOC120101550basic proline-rich protein-like34363026743632662Rat
41258419LOC120102049small nucleolar RNA SNORA1734579319345793322Rat
41056690LOC120101853ubiquitin-conjugating enzyme E2 variant 1-like337700203771038Rat
41292532NEWGENE_40934091transfer RNA alanine (anticodon AGC)31084647710846558Rat
41317518LOC120101534uncharacterized LOC12010153431924467019265072Rat
41318264LOC120101866thioredoxin-like protein 4A356580635658249Rat
41031811NEWGENE_40933693transfer RNA proline (anticodon GGG)36075870560758779Rat
41032087LOC120101977U6 spliceosomal RNA36425514664255247Rat
41032322LOC120101863thioredoxin-like protein 4A344763514476542Rat
41057891LOC120102112U2 spliceosomal RNA35269669952696861Rat
41058008LOC120101594olfactory receptor 4X2-like37636403276364961Rat
41058081LOC120101998small nucleolar RNA SNORD2431023955610239630Rat
41223310LOC120101839uncharacterized LOC120101839333995213401354Rat
41298278LOC120101446uncharacterized LOC12010144636642803366438630Rat
41299235LOC120101937U6 spliceosomal RNA37622041576220521Rat
41059769LOC120102007small nucleolar RNA SNORA6531626580116265930Rat
41223777LOC120101529uncharacterized LOC12010152931880970818826377Rat
41299961LOC120101888uncharacterized LOC120101888333107653314767Rat
41300198LOC120102034U1 spliceosomal RNA35940764159407795Rat
41300438LOC120101944U6 spliceosomal RNA35949095159491051Rat
41337030LOC120101933U6 spliceosomal RNA32155103821551144Rat
41337682LOC120102038small nucleolar RNA SNORA4832392516823925311Rat
41034676LOC120101904actin, cytoplasmic 2-like32528326925290132Rat
41225679LOC120102085small nucleolar RNA SNORD6737757338077573489Rat
41301375LOC120101575uncharacterized LOC12010157536019413760201089Rat
41302246LOC120101528spermidine synthase-like31870954818710782Rat
41302330LOC120101838rho GTPase-activating protein 20-like335985613630812Rat
41334896LOC120101531uncharacterized LOC12010153131885969018860308Rat
41035739LOC120101847N-alpha-acetyltransferase 11-like328484342849270Rat
41063319LOC120101554uncharacterized LOC12010155434707772347101724Rat
41016805LOC120101903uncharacterized LOC12010190332154038321543108Rat
41017381LOC120101964U6 spliceosomal RNA31192697611927077Rat
41039243LOC120101849CD99 antigen-like protein 2353054925375106Rat
41065835LOC120101562uncharacterized LOC12010156235550325255505088Rat
41066404LOC120102110U2 spliceosomal RNA32855995628560093Rat
41236206LOC120101570uncharacterized LOC12010157035867828058682493Rat
41304536LOC120101992U7 small nuclear RNA33142960831429669Rat
41304668LOC120101502uncharacterized LOC120101502363802076388504Rat
41040480LOC120102009small nucleolar RNA SNORA433136654831366647Rat
41041303LOC120102076small nucleolar RNA SNORA1733052038230520498Rat
41067155LOC120102058small nucleolar RNA SNORA1733699430236994428Rat
41067318LOC120101449olfactory receptor 8J3-like37120480171205748Rat
41067461LOC120101527uncharacterized LOC12010152731808304118088151Rat
41237371LOC120102119small nucleolar RNA U336259913262599217Rat
41238331LOC120101515uncharacterized LOC12010151531311797713119546Rat
41238481LOC120101514ATP synthase subunit g, mitochondrial-like31315862113160923Rat
41305975LOC120101910uncharacterized LOC12010191037734257777357711Rat
41307015LOC120101581uncharacterized LOC12010158136091477460922918Rat
41018897LOC12010155360S ribosomal protein L9-like34647779646480228Rat
41020350LOC120101435centrosomal protein of 19 kDa-like33489813134898840Rat
41043121LOC120102125U4 spliceosomal RNA34966123749661394Rat
41044605LOC120101864thioredoxin-like protein 4A327374082737599Rat
41068153LOC120101596uncharacterized LOC12010159637840986878415125Rat
41238854LOC120101477thioredoxin-like protein 4A328470522848323Rat
41239310LOC120101547fatty acid-binding protein 5-like33458594934586393Rat
41307267LOC120101448olfactory receptor 8U9-like37119176071192719Rat
41307402LOC120102067small nucleolar RNA SNORA1735209327752093408Rat
41307504LOC120101505uncharacterized LOC120101505376516497660006Rat
41021208LOC120101953U6 spliceosomal RNA36983862569838731Rat
41021698LOC120101891uncharacterized LOC12010189131353642513538891Rat
41069721LOC120101982small nucleolar RNA SNORD3631024084710240917Rat
41069797LOC120102003small nucleolar RNA SNORA7032455500324555138Rat
41073245LOC120101559dnaJ homolog subfamily C member 8-like35323761053242100Rat
41074405LOC120093106glyceraldehyde-3-phosphate dehydrogenase-like35598717755988204Rat
41241606LOC120102026small nucleolar RNA SNORA4832304743523047574Rat
41309304LOC12010167960S ribosomal protein L30-like37035037270350850Rat
41366572LOC120095340uncharacterized LOC12009534010103119236103123667Rat

Nucleotide Sequences
GenBank Nucleotide AU028952 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
2292216Bw80Body weight QTL 803.230.0019body mass (VT:0001259)body weight (CMO:0000012)1213533809243914901Rat
70211Niddm24Non-insulin dependent diabetes mellitus QTL 243.79blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)1214647894259647894Rat
631215Stl8Serum triglyceride level QTL 89.270.0001blood triglyceride amount (VT:0002644)serum triglyceride level (CMO:0000360)1225126575260522016Rat
2302040Pia35Pristane induced arthritis QTL 353.80.001blood immunoglobulin amount (VT:0002460)serum immunoglobulin G1 level (CMO:0002115)1216255568260522016Rat
2302375Bw83Body weight QTL 834.870.0002body mass (VT:0001259)body weight (CMO:0000012)1197697768242697768Rat
2302378Insul11Insulin level QTL 113.25blood insulin amount (VT:0001560)serum insulin level (CMO:0000358)1144267353251128347Rat
724531Uae5Urinary albumin excretion QTL 54urine albumin amount (VT:0002871)urine albumin level (CMO:0000130)1150700142252085212Rat
724533Rf51Renal function QTL 515.30.0002kidney plasma flow trait (VT:0005524)renal plasma flow (CMO:0001914)1218753816256448513Rat
724538Kidm1Kidney mass QTL 13.2kidney mass (VT:0002707)calculated kidney weight (CMO:0000160)1213707201252085212Rat
724552Glom2Glomerulus QTL 23.30.0001kidney glomerulus morphology trait (VT:0005325)count of superficial glomeruli directly contacting the kidney surface (CMO:0001001)1222363780260522016Rat
734767Niddm57Non-insulin dependent diabetes mellitus QTL 57body mass (VT:0001259)body weight (CMO:0000012)1224054293260122809Rat
734768Niddm59Non-insulin dependent diabetes mellitus QTL 59body mass (VT:0001259)body weight (CMO:0000012)1213843987258843987Rat
734769Niddm58Non-insulin dependent diabetes mellitus QTL 58body mass (VT:0001259)body weight (CMO:0000012)1224569538260122809Rat
1298084Thym4Thymus enlargement QTL 410.68thymus mass (VT:0004954)thymus weight to body weight ratio (CMO:0000612)1197814409242814409Rat
631658Cm7Cardiac mass QTL 75.320.0001aorta mass (VT:0002845)aorta weight (CMO:0000076)1196248093241248093Rat
631669Iddm9Insulin dependent diabetes mellitus QTL 92.80.039blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)1233190394258625266Rat
631690Scl5Serum cholesterol level QTL 52.1blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)1236125214260522016Rat
1354580Scort1Serum corticosterone level QTL 13.4blood corticosterone amount (VT:0005345)blood corticosterone level (CMO:0001172)1156677124256448636Rat
1581544Rf52Renal function QTL 520.05total urine protein amount (VT:0000032)urine protein excretion rate to body weight ratio (CMO:0001099)1232156370259647894Rat
731175Uae20Urinary albumin excretion QTL 203.50.0018urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)1221264111259647894Rat
738032Hcas5Hepatocarcinoma susceptibility QTL 53.12liver integrity trait (VT:0010547)liver tumorous lesion number (CMO:0001068)1176426412257976495Rat
631536Lnnr2Liver neoplastic nodule remodeling QTL 22.90.0005liver integrity trait (VT:0010547)liver remodeling tumorous lesion number to liver total tumorous lesion number ratio (CMO:0001705)1233948574260522016Rat
1598821Rf55Renal function QTL 556.3renal blood flow trait (VT:2000006)ratio of change in renal blood flow to change in renal perfusion pressure (CMO:0001239)1218748008257976495Rat
2300175Bmd40Bone mineral density QTL 4015.40.0001femur mineral mass (VT:0010011)bone mineral density (CMO:0001226)1201554356246554356Rat
2293655Bss36Bone structure and strength QTL 3610.660.0001femur strength trait (VT:0010010)femur ultimate force (CMO:0001675)1201554356246554356Rat
2293674Bss39Bone structure and strength QTL 397.10.0001femur strength trait (VT:0010010)femur total energy absorbed before break (CMO:0001677)1201554356246554356Rat
2293694Bss38Bone structure and strength QTL 387.050.0001femur strength trait (VT:0010010)femur stiffness (CMO:0001674)1201554356246554356Rat
2293700Bmd27Bone mineral density QTL 276.60.0001femur mineral mass (VT:0010011)trabecular volumetric bone mineral density (CMO:0001729)1224054293243747962Rat
2293701Bmd34Bone mineral density QTL 348.30.0001femur strength trait (VT:0010010)femoral neck ultimate force (CMO:0001703)1224054293243747962Rat
631836Stl31Serum triglyceride level QTL 314.640.00000487blood triglyceride amount (VT:0002644)plasma triglyceride level (CMO:0000548)1237147813260522016Rat
631837Niddm35Non-insulin dependent diabetes mellitus QTL 350.01blood insulin amount (VT:0001560)serum insulin level (CMO:0000358)1238699859259647894Rat
631843Bw116Body weight QTL 1164.10.016abdominal adipose amount (VT:1000220)abdominal fat pad weight (CMO:0000088)1224054293260122809Rat
634313Niddm43Non-insulin dependent diabetes mellitus QTL 43blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)1199050459259647894Rat
634321Hc1Hypercalciuria QTL 12.91urine calcium amount (VT:0002985)urine calcium excretion rate (CMO:0000763)1178810256240830002Rat
1357335Bw39Body weight QTL 393.3body mass (VT:0001259)body weight (CMO:0000012)1197814409242814409Rat
1357399Bw45Body weight QTL 453.05body mass (VT:0001259)body mass index (BMI) (CMO:0000105)1206329708251329708Rat
1357404Bw42Body weight QTL 424.490.0001body mass (VT:0001259)body weight (CMO:0000012)1206329708251329708Rat
1600363Hc6Hypercalciuria QTL 62.7urine calcium amount (VT:0002985)urine calcium excretion rate (CMO:0000763)1203995416244113296Rat
1600374Mcs17Mammary carcinoma susceptibility QTL 173mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)1197670404242670404Rat
1600388Niddm67Non-insulin dependent diabetes mellitus QTL 675.840.000004blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)1195804352257091168Rat
1600392Bw123Body weight QTL 1230.001body mass (VT:0001259)body weight (CMO:0000012)1223201027260522016Rat
1600395Niddm69Non-insulin dependent diabetes mellitus QTL 694.140.0002blood insulin amount (VT:0001560)plasma insulin level (CMO:0000342)1195804352257091168Rat
1600396Niddm68Non-insulin dependent diabetes mellitus QTL 684.970.0003blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)1195804352257091168Rat
1600397Edcs4Endometrial carcinoma susceptibility QTL 42.2uterus morphology trait (VT:0001120)percentage of study population developing endometrioid carcinoma during a period of time (CMO:0001759)1206081677251081677Rat
1578759Uae30Urinary albumin excretion QTL 303.30.003urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)1150700247252085048Rat
1578763Kidm29Kidney mass QTL 293.30.0001kidney mass (VT:0002707)both kidneys wet weight (CMO:0000085)1179567751260522016Rat
1578778Pur4Proteinuria QTL 43.30.003total urine protein amount (VT:0000032)urine total protein excretion rate (CMO:0000756)1150700247252085048Rat
1300108Rf8Renal function QTL 83.75renal blood flow trait (VT:2000006)absolute change in renal vascular resistance (CMO:0001900)1228581588259647894Rat
1354610Bw34Body weight QTL 344.1body mass (VT:0001259)body weight (CMO:0000012)1151162512256448636Rat
1354624Cm35Cardiac mass QTL355.7heart left ventricle mass (VT:0007031)calculated heart weight (CMO:0000073)1177227632256448636Rat
1354646Kidm18Kidney mass QTL 185.7kidney mass (VT:0002707)calculated kidney weight (CMO:0000160)1151162512256448636Rat
1354652Kidm20Kidney mass QTL 204.3kidney mass (VT:0002707)calculated kidney weight (CMO:0000160)1177227632256448636Rat
1354661Bw33Body weight QTL 335.2body mass (VT:0001259)body weight (CMO:0000012)1151162512256448636Rat
1549910Bw54Body weight QTL 540.05body mass (VT:0001259)body weight (CMO:0000012)1214647894259647894Rat
2316896Gluco57Glucose level QTL 577.2blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)1228985440245907899Rat
1549837Hcar15Hepatocarcinoma resistance QTL 150.05liver integrity trait (VT:0010547)liver tumorous lesion number (CMO:0001068)1153136852260522016Rat
1358191Ept10Estrogen-induced pituitary tumorigenesis QTL 103.8pituitary gland mass (VT:0010496)pituitary gland wet weight (CMO:0000853)1192825253243914732Rat
2292220Bp306Blood pressure QTL 3063.470.00087arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1164310393243914901Rat
1358890Bp259Blood pressure QTL 2593.06arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)1210702053260522016Rat
1358898Bp255Blood pressure QTL 2553.6arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)1191019702246062233Rat
1358916Kidm22Kidney mass QTL 223.32kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)1210702053240947965Rat
1358292Cm37Cardiac mass QTL 376.20.00000081heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)1196248093241248093Rat
61327Eae7Experimental allergic encephalomyelitis QTL 75.6body mass (VT:0001259)change in body weight (CMO:0002045)1216255568260522016Rat
61376Bp42Blood pressure QTL 4223.4arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1197814409242814409Rat
61400Niddm1Non-insulin dependent diabetes mellitus QTL 111blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)1218753689245907899Rat
8655655Arrd2Age-related retinal degeneration QTL 27.79retinal layer morphology trait (VT:0003727)percentage of study population developing retinopathy during a period of time (CMO:0002453)1183970203243914901Rat
7421630Bp362Blood pressure QTL 3620.001arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)1118608292241799120Rat
7394701Uae46Urinary albumin excretion QTL 463.60.0056urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)1201554356246554356Rat
8655855Arrd3Age-related retinal degeneration QTL 33.07lens clarity trait (VT:0001304)cataract incidence/prevalence measurement (CMO:0001585)1183970203243914901Rat
10053715Scort24Serum corticosterone level QTL 242.130.0088blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)1221414816260522016Rat
10059587Bw173Body weight QTL 1733.230.025body mass (VT:0001259)body weight (CMO:0000012)1202069611247069611Rat
70202Alc19Alcohol consumption QTL 192.5drinking behavior trait (VT:0001422)ethanol intake volume to total fluid intake volume ratio (CMO:0001591)3127494778Rat
631679Cm10Cardiac mass QTL 107.340.0001heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)3131158234Rat
631831Alc8Alcohol consumption QTL 82.7consumption behavior trait (VT:0002069)calculated ethanol drink intake rate (CMO:0001615)3133230976Rat
61468Bp15Blood pressure QTL 154.4blood pressure trait (VT:0000183)pulse pressure (CMO:0000292)3133278763Rat
61468Bp15Blood pressure QTL 154.4blood pressure trait (VT:0000183)systolic blood pressure (CMO:0000004)3133278763Rat
61468Bp15Blood pressure QTL 154.4blood pressure trait (VT:0000183)diastolic blood pressure (CMO:0000005)3133278763Rat
631545Bp85Blood pressure QTL 853.1arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)3133278763Rat
4889966Bss95Bone structure and strength QTL 954.4tibia area (VT:1000281)tibia-fibula cross-sectional area (CMO:0001718)3136847613Rat
2312664Scl62Serum cholesterol level QTL 620.05blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)3138710544Rat
631568Bp92Blood pressure QTL 922.20.005arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)3139874793Rat
2290452Scl56Serum cholesterol level QTL 562.26blood cholesterol amount (VT:0000180)plasma total cholesterol level (CMO:0000585)3191609953Rat
1358185Ept6Estrogen-induced pituitary tumorigenesis QTL 66.7pituitary gland mass (VT:0010496)pituitary gland wet weight (CMO:0000853)3653764510778823Rat
2292615Ept17Estrogen-induced pituitary tumorigenesis QTL 176.7pituitary gland mass (VT:0010496)pituitary gland wet weight (CMO:0000853)3653764510778823Rat
1298526Arunc3Aerobic running capacity QTL 32.2exercise endurance trait (VT:0002332)maximum distance run on treadmill (CMO:0001406)3822719433703538Rat
10401810Kidm53Kidney mass QTL 53kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)3822719447233430Rat
70203Gcr2Gastric cancer resistance QTL 22.6stomach morphology trait (VT:0000470)stomach tumor susceptibility score (CMO:0002043)3865816227494778Rat
1358357Srcrtb1Stress Responsive Cort Basal QTL 16.360.002blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)3865816227494778Rat
6893355Bw101Body weight QTL 1010.40.38body mass (VT:0001259)body weight (CMO:0000012)31077870430357018Rat
6893363Bw105Body weight QTL 1052.60.0036body mass (VT:0001259)body weight (CMO:0000012)31077870430357018Rat
1558654Bw56Body weight QTL 564.50.0000171body mass (VT:0001259)body weight (CMO:0000012)31077870430357018Rat
70191BpQTLcluster4Blood pressure QTL cluster 43arterial blood pressure trait (VT:2000000)absolute change in systolic blood pressure (CMO:0000607)31077870450302886Rat
70191BpQTLcluster4Blood pressure QTL cluster 43arterial blood pressure trait (VT:2000000)absolute change in mean arterial blood pressure (CMO:0000533)31077870450302886Rat
1558647Cm46Cardiac mass QTL 465.40.0000055heart mass (VT:0007028)heart wet weight (CMO:0000069)31077882330356773Rat
1558650Cm48Cardiac mass QTL 4840.0001heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)31077882330356773Rat
1558657Cm43Cardiac mass QTL 436.60.0000000293heart mass (VT:0007028)heart wet weight (CMO:0000069)31077882330356773Rat
1358905Hrtrt17Heart rate QTL 175.90.000014heart pumping trait (VT:2000009)heart rate (CMO:0000002)31086191289878372Rat
1358885Bp251Blood pressure QTL 2513.8arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)314489145121056321Rat
1358888Bp264Blood pressure QTL 2644.43arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)314489145121056321Rat
2298542Neuinf11Neuroinflammation QTL 113.9nervous system integrity trait (VT:0010566)spinal cord complement component 1, q subcomponent, B chain mRNA level (CMO:0002126)31500542276927699Rat
631676Cm8Cardiac mass QTL 87.030.0001aorta mass (VT:0002845)aorta weight (CMO:0000076)31695470861954708Rat
634306Bp140Blood pressure QTL 1403.30.0013arterial blood pressure trait (VT:2000000)body weight (CMO:0000012)31737470335528639Rat
634306Bp140Blood pressure QTL 1403.30.0013arterial blood pressure trait (VT:2000000)body weight (CMO:0000012)31737470335528639Rat
634306Bp140Blood pressure QTL 1403.30.0013arterial blood pressure trait (VT:2000000)heart rate (CMO:0000002)31737470335528639Rat
634306Bp140Blood pressure QTL 1403.30.0013arterial blood pressure trait (VT:2000000)heart rate (CMO:0000002)31737470335528639Rat
634306Bp140Blood pressure QTL 1403.30.0013arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)31737470335528639Rat
634306Bp140Blood pressure QTL 1403.30.0013arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)31737470335528639Rat
634306Bp140Blood pressure QTL 1403.30.0013arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)31737470335528639Rat
634306Bp140Blood pressure QTL 1403.30.0013arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)31737470335528639Rat
2325840Bp345Blood pressure QTL 3450.001arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)31831145428441896Rat
731172Bp151Blood pressure QTL 1510.04arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)31831145447233430Rat
12879849Bw180Body weight QTL 1800.037body mass (VT:0001259)body weight (CMO:0000012)31831145447233430Rat
12879850Cm91Cardiac mass QTL 910.001heart mass (VT:0007028)heart wet weight to body weight ratio (CMO:0002408)31831145447233430Rat
12879851Cm92Cardiac mass QTL 920.001heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)31831145447233430Rat
12879852Cm93Cardiac mass QTL 930.001heart right ventricle mass (VT:0007033)heart right ventricle weight to body weight ratio (CMO:0000914)31831145447233430Rat
12879853Am5Aortic mass QTL 50.001aorta mass (VT:0002845)aorta weight to aorta length to body weight ratio (CMO:0002722)31831145447233430Rat
12879854Kidm63Kidney mass QTL 630.001kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)31831145447233430Rat
10450804Scl70Serum cholesterol level QTL 704.70.001blood LDL cholesterol amount (VT:0000181)blood low density lipoprotein cholesterol level (CMO:0000053)32071409065714090Rat
10450794Scl69Serum cholesterol level QTL 696.30.001blood LDL cholesterol amount (VT:0000181)blood low density lipoprotein cholesterol level (CMO:0000053)32071409065714090Rat
10450806Scl71Serum cholesterol level QTL 715.80.001blood LDL cholesterol amount (VT:0000181)blood low density lipoprotein cholesterol level (CMO:0000053)32419245527494778Rat
10450811Scl73Serum cholesterol level QTL 734.70.001blood LDL cholesterol amount (VT:0000181)blood low density lipoprotein cholesterol level (CMO:0000053)32419245527494778Rat
10450808Scl72Serum cholesterol level QTL 724.40.001blood LDL cholesterol amount (VT:0000181)blood low density lipoprotein cholesterol level (CMO:0000053)32419245527494778Rat
1298073Cm13Cardiac mass QTL 132.5heart mass (VT:0007028)heart wet weight (CMO:0000069)32501391138192233Rat
631832Sach1Saccharin preference QTL 12.70.02consumption behavior trait (VT:0002069)calculated saccharin drink intake volume (CMO:0001600)32749462144188411Rat
2313049Bss72Bone structure and strength QTL 722.60.0001tibia area (VT:1000281)tibia midshaft cross-sectional area (CMO:0001717)32749462150302886Rat
2313076Bss74Bone structure and strength QTL 7420.0001tibia strength trait (VT:1000284)tibia total energy absorbed before break (CMO:0001736)32749462150302886Rat
2313079Bss73Bone structure and strength QTL 731.5tibia size trait (VT:0100001)tibia midshaft cross-sectional area (CMO:0001717)32749462150302886Rat
2313093Bmd77Bone mineral density QTL 772.20.0001tibia mineral mass (VT:1000283)cortical volumetric bone mineral density (CMO:0001730)32749462150302886Rat
2313101Bmd76Bone mineral density QTL 763.60.0001tibia mineral mass (VT:1000283)total volumetric bone mineral density (CMO:0001728)32749462150302886Rat
2302055Pia30Pristane induced arthritis QTL 303.50.001blood autoantibody amount (VT:0003725)serum immunoglobulin M-type rheumatoid factor level relative to an arbitrary reference serum (CMO:0002111)32793691972936919Rat
9590286Uminl1Urine mineral level QTL 13.50.001urine mineral amount (VT:0015086)urine electrolyte level (CMO:0000593)32824968773249687Rat
8694196Abfw2Abdominal fat weight QTL 216.580.001visceral adipose mass (VT:0010063)abdominal fat pad weight to body weight ratio (CMO:0000095)32824968773249687Rat
8694386Bw159Body weight QTL 1594.520.001body lean mass (VT:0010483)lean tissue morphological measurement (CMO:0002184)32824968773249687Rat
8552950Pigfal12Plasma insulin-like growth factor 1 level QTL 127.3blood insulin-like growth factor amount (VT:0010479)plasma insulin-like growth factor 1 level (CMO:0001299)32824968773249687Rat
9590136Scort3Serum corticosterone level QTL 323.370.001blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)32824968773249687Rat
2303593Gluco46Glucose level QTL 463blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)32846857173468571Rat
1354590Despr11Despair related QTL 110.000031locomotor behavior trait (VT:0001392)amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)32846857173468571Rat
737818Hcar12Hepatocarcinoma resistance QTL 122.6liver integrity trait (VT:0010547)volume of individual liver tumorous lesion (CMO:0001078)329463235118376539Rat
61419Cia11Collagen induced arthritis QTL 115.6joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)33035677398535386Rat
61356Bp37Blood pressure QTL 373blood pressure trait (VT:0000183)systolic blood pressure (CMO:0000004)33068464275684642Rat
631647Bp122Blood pressure QTL 1226.2arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)33068464275684642Rat
70216Cm14Cardiac mass QTL 142.1heart mass (VT:0007028)heart wet weight (CMO:0000069)331172320163586636Rat
11565451Bw177Body weight QTL 1770.002body mass (VT:0001259)body weight (CMO:0000012)33142640370668733Rat
11565452Kidm57Kidney mass QTL 570.001kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)33142640370668733Rat
12879866Cm94Cardiac mass QTL 940.001heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)33142640370668733Rat
12879867Cm95Cardiac mass QTL 950.047heart right ventricle mass (VT:0007033)heart right ventricle weight to body weight ratio (CMO:0000914)33142640370668733Rat
12879868Am6Aortic mass QTL 60.001aorta mass (VT:0002845)aorta weight to aorta length to body weight ratio (CMO:0002722)33142640370668733Rat
2301400Cm68Cardiac mass QTL 680.001heart mass (VT:0007028)heart wet weight to body weight ratio (CMO:0002408)33142640370668733Rat
1300169Bp177Blood pressure QTL 1772.96arterial blood pressure trait (VT:2000000)blood pressure time series experimental set point of the baroreceptor response (CMO:0002593)33370334761017857Rat
1354589Bw31Body weight QTL 313.3body mass (VT:0001259)body weight (CMO:0000012)33370334778196190Rat
1354604Bw36Body weight QTL 362.9body mass (VT:0001259)body weight (CMO:0000012)333703347104104347Rat
10450852Stl33Serum triglyceride level QTL 333.40.05blood LDL triglyceride amount (VT:0010699)blood lipoprotein triglyceride level (CMO:0002685)33819223350749747Rat
10450816Scl75Serum cholesterol level QTL 754.40.001blood LDL cholesterol amount (VT:0000181)blood low density lipoprotein cholesterol level (CMO:0000053)33819223350749747Rat
10450813Scl74Serum cholesterol level QTL 745.80.001blood LDL cholesterol amount (VT:0000181)blood low density lipoprotein cholesterol level (CMO:0000053)33819223350749747Rat
1358362Srcrt2Stress Responsive Cort QTL 22.78blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)338192233133483320Rat
738019Anxrr10Anxiety related response QTL 103.9exploratory behavior trait (VT:0010471)number of entries into a discrete space in an experimental apparatus (CMO:0000960)33851780383517803Rat
4889975Bmd81Bone mineral density QTL 814.3tibia mineral mass (VT:1000283)total volumetric bone mineral density (CMO:0001728)33871036550302886Rat
634317Bw117Body weight QTL 1173.58abdominal fat pad mass (VT:1000711)abdominal fat pad weight to body weight ratio (CMO:0000095)33945463753296578Rat
2302276Bw82Body weight QTL 824.32body mass (VT:0001259)body weight (CMO:0000012)33945463762951183Rat
1331777Bw24Body weight QTL 243.503body mass (VT:0001259)body weight (CMO:0000012)33945463789115240Rat
1331795Rf30Renal function QTL 303.708urine potassium amount (VT:0010539)urine potassium level (CMO:0000128)33945463789115240Rat
1354597Kidm13Kidney mass QTL 132.9kidney mass (VT:0002707)right kidney wet weight (CMO:0000082)341874578104104347Rat
2301970Bw81Body weight QTL 815.19body mass (VT:0001259)body weight (CMO:0000012)341874578155617519Rat
2301971Cm71Cardiac mass QTL 714.63heart left ventricle mass (VT:0007031)heart left ventricle weight (CMO:0000776)341874578155617519Rat
1300178Hrtrt4Heart rate QTL 43.74heart pumping trait (VT:2000009)heart rate (CMO:0000002)34382736490905114Rat
1581503Cm58Cardiac mass QTL 582.70.05heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)343827364121056321Rat
1559282Emca5Estrogen-induced mammary cancer QTL 53.9mammary gland integrity trait (VT:0010552)percentage of study population developing mammary tumors during a period of time (CMO:0000948)343827364169034231Rat
2292591Esta4Estrogen-induced thymic atrophy QTL 4thymus mass (VT:0004954)thymus wet weight (CMO:0000855)347233211147415807Rat
1358186Ept2Estrogen-induced pituitary tumorigenesis QTL 28.3pituitary gland mass (VT:0010496)pituitary gland wet weight (CMO:0000853)347233430110362260Rat
2292613Ept16Estrogen-induced pituitary tumorigenesis QTL 168.3pituitary gland mass (VT:0010496)pituitary gland wet weight (CMO:0000853)347233430110362260Rat
631665Bw8Body weight QTL 85.5body mass (VT:0001259)body weight (CMO:0000012)350437042119183768Rat
724523Tsu1Thymus enlargement suppressive QTL 13.84thymus mass (VT:0004954)thymus weight to body weight ratio (CMO:0000612)350437504115638231Rat
1582249Bw77Body weight QTL 773.20.0025epididymal fat pad mass (VT:0010421)epididymal fat pad weight to body weight ratio (CMO:0000658)35318459364655484Rat
1582218Bw74Body weight QTL 743.90.0021body mass (VT:0001259)body weight (CMO:0000012)353184593115665732Rat
1582238Bw68Body weight QTL 683.20.0064body mass (VT:0001259)body weight (CMO:0000012)353184593115665732Rat
1582239Epfw1Epididymal fat weight QTL 14.50.0006epididymal fat pad mass (VT:0010421)epididymal fat pad weight to body weight ratio (CMO:0000658)353184593115665732Rat
61377Edpm3Estrogen-dependent pituitary mass QTL 37.050.038pituitary gland mass (VT:0010496)pituitary gland wet weight (CMO:0000853)35318469289878207Rat
731180Bp152Blood pressure QTL 1520.03arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)35378111291609953Rat
731180Bp152Blood pressure QTL 1520.03arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)35378111291609953Rat
731180Bp152Blood pressure QTL 1520.03arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)35378111291609953Rat
1581568Rf53Renal function QTL 53total urine protein amount (VT:0000032)urine protein excretion rate to body weight ratio (CMO:0001099)356395968161299569Rat
8662816Vetf4Vascular elastic tissue fragility QTL 44renal artery integrity trait (VT:0010642)number of ruptures of the internal elastic lamina of the renal arteries (CMO:0002563)359242096157323038Rat
1300111Rf12Renal function QTL 123.78renal blood flow trait (VT:2000006)absolute change in renal blood flow rate (CMO:0001168)361017749121056321Rat
631200Cm25Cardiac mass QTL 254.80.0001heart left ventricle mass (VT:0007031)heart left ventricle wet weight (CMO:0000071)36113434889115068Rat
1582210Bw71Body weight QTL 713.30.0012body mass (VT:0001259)body weight (CMO:0000012)364655305115665732Rat
1582221Kidm30Kidney mass QTL 303.50.0008kidney mass (VT:0002707)both kidneys wet weight (CMO:0000085)364655305115665732Rat
12879848Bw181Body weght QTL 1810.015body mass (VT:0001259)body weight (CMO:0000012)370348525121056321Rat
2301414Kidm37Kidney mass QTL 370.001kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)370653097121056321Rat
1600376Arunc5Aerobic running capacity QTL 50.21exercise endurance trait (VT:0002332)maximum distance run on treadmill (CMO:0001406)373376539118376539Rat
1581546Pur13Proteinuria QTL 132.930.0335total urine protein amount (VT:0000032)urine protein excretion rate (CMO:0000759)378196190146592722Rat
2302273Gluco35Glucose level QTL 355.30.001blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)380800231114297550Rat
2303118Mamtr7Mammary tumor resistance QTL 70.003mammary gland integrity trait (VT:0010552)mammary tumor growth rate (CMO:0000344)109658275104670812Rat
631268Cia21Collagen induced arthritis QTL 213.1joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1014487011104060283Rat
2316949Gluco60Glucose level QTL 603.7blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)1014487011107057807Rat
61354Pia10Pristane induced arthritis QTL 100.01joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1023444813104060283Rat
631267Cia20Collagen induced arthritis QTL 203.2joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1023444813104060283Rat
61325Aia5Adjuvant induced arthritis QTL 50.01joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1023444813104060283Rat
1331791Cm31Cardiac mass QTL 313.84606heart mass (VT:0007028)heart wet weight (CMO:0000069)1029299504107211142Rat
631269Cia22Collagen induced arthritis QTL 228.9joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1040035094104060283Rat
631270Cia23Collagen induced arthritis QTL 233.9joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1040035094104060283Rat
1298078Stresp5Stress response QTL 52.990.00025blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)1042045676104670812Rat
61387Bp1Blood pressure QTL 15.1arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)1051770177107211142Rat
61387Bp1Blood pressure QTL 15.1arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1051770177107211142Rat
70171Cari1Carrageenan-induced inflammation QTL 14.90.0005hypodermis integrity trait (VT:0010550)inflammatory exudate volume (CMO:0001429)1053797385107211142Rat
2293698Bss43Bone structure and strength QTL 435.330.0001lumbar vertebra size trait (VT:0010518)lumbar vertebra cross-sectional area (CMO:0001689)1059209888104209888Rat
2313103Bss80Bone structure and strength QTL 8020.0001tibia strength trait (VT:1000284)tibia midshaft endosteal cross-sectional area (CMO:0001716)1062057807107057807Rat
2313105Bss79Bone structure and strength QTL 791.80.0001tibia size trait (VT:0100001)tibia midshaft cross-sectional area (CMO:0001717)1062057807107057807Rat
61449Ciaa2CIA Autoantibody QTL 27.1blood autoantibody amount (VT:0003725)calculated serum anti-type 2 collagen antibody titer (CMO:0001279)1063221094107211142Rat
2317029Aia19Adjuvant induced arthritis QTL 192.98joint integrity trait (VT:0010548)left rear ankle joint diameter (CMO:0002149)1066978955107211142Rat
2317039Aia6Adjuvant induced arthritis QTL 64.31joint integrity trait (VT:0010548)right rear ankle joint diameter (CMO:0002150)1066978955107211142Rat
10450498Bp384Blood pressure QTL 3840.002arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)1067750049107211142Rat
1642980Bp300Blood pressure QTL 300arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1068383129107211142Rat
61396Bp9Blood pressure QTL 94.80.0001arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1068420376107211142Rat
2300172Bmd57Bone mineral density QTL 579.80.0001femur mineral mass (VT:0010011)volumetric bone mineral density (CMO:0001553)1069738412107211142Rat
2293646Bss25Bone structure and strength QTL 2510.960.0001femur morphology trait (VT:0000559)femur cross-sectional area (CMO:0001661)1069738412107211142Rat
2293663Bss33Bone structure and strength QTL 339.340.0001femur strength trait (VT:0010010)femur midshaft polar moment of inertia (CMO:0001669)1069738412107211142Rat
6893366Bw106Body weight QTL 1060.30.47body mass (VT:0001259)body weight (CMO:0000012)1070199100107211142Rat
70193Mcs7Mammary carcinoma susceptibility QTL 72.38mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)1072224939107211142Rat
2298548Neuinf7Neuroinflammation QTL 73.4nervous system integrity trait (VT:0010566)spinal cord RT1-B protein level (CMO:0002132)1072224939107211142Rat
2292438Bp311Blood pressure QTL 311arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)1076246085107211142Rat
1302404Cia27Collagen induced arthritis QTL 272.60.0045joint integrity trait (VT:0010548)experimental arthritis severity measurement (CMO:0001459)1076452683107211142Rat
4889492Pancm2Pancreatic morphology QTL 23.2pancreatic beta cell morphology trait (VT:0005217)ratio of insulin-positive cell area to total area of splenic region of pancreas (CMO:0001814)1076748906107211142Rat
2303589Bw87Body weight QTL 872body mass (VT:0001259)body weight (CMO:0000012)1081285008107211142Rat
2317754Glom25Glomerulus QTL 253.5urine protein amount (VT:0005160)urine protein level (CMO:0000591)1082685200107211142Rat
1600367Mcs15Mammary carcinoma susceptibility QTL 154.5mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)1085565469103884409Rat
631538Oia5Oil induced arthritis QTL 5joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1087055121107211142Rat
61363Oia3Oil induced arthritis QTL 30.001joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1087307617107211142Rat
634320Niddm49Non-insulin dependent diabetes mellitus QTL 494.41blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)1088539139107211142Rat
12880395Cm109Cardiac mass QTL 1090.001heart right ventricle mass (VT:0007033)heart right ventricle weight to body weight ratio (CMO:0000914)1090404397107211142Rat
12880396Am13Aortic mass QTL 130.001aorta mass (VT:0002845)aorta weight to aorta length to body weight ratio (CMO:0002722)1090404397107211142Rat
12880398Kidm67Kidney mass QTL 670.001kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)1090404397107211142Rat
12880384Cm107Cardiac mass QTL 1070.001heart mass (VT:0007028)heart wet weight to body weight ratio (CMO:0002408)90404397107211142Rat
12880385Cm108Cardiac mass QTL 1080.001heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)90404397107211142Rat
1579915Bp280Blood pressure QTL 2800.001arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)1090404397107211142Rat
1300137Bp186Blood pressure QTL 1863.57arterial blood pressure trait (VT:2000000)blood pressure time series experimental set point of the baroreceptor response (CMO:0002593)1090627439107057807Rat
724530Bp149Blood pressure QTL 1490.0001arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)1090627439107211142Rat
1558652Bw57Body weight QTL 574.20.0008body mass (VT:0001259)body weight (CMO:0000012)1090910316107211142Rat
61436Cia5Collagen induced arthritis QTL 54.9joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1091228102104060283Rat
1354641Bvd2Brain ventricular dilatation QTL 26.360.001brain ventricle morphology trait (VT:0000822)hydrocephalus severity score (CMO:0001881)1093223816107057807Rat
10450493Bp382Blood pressure QTL 3820.002arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)1094759759107211142Rat
2292436Bp310Blood pressure QTL 310arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)1094759759107211142Rat
1576307Cia28Collagen induced arthritis QTL 28joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1096120911104060283Rat
1576313Pia25Pristane induced arthritis QTL 25joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1096120911104060283Rat
1578663Bss18Bone structure and strength QTL 183.6femur width (VT:1000666)femoral neck width (CMO:0001695)1096703043107057807Rat
1578672Bmd16Bone mineral density QTL 166.2femur mineral mass (VT:0010011)cortical volumetric bone mineral density (CMO:0001730)1096703043107057807Rat
631539Oia6Oil induced arthritis QTL 6joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1097010147104670812Rat


Additional Information

Database Acc Id Source(s)
UniSTS 111835 UniSTS