BI292991 Marker Search Result - Rat Genome Database

Advanced Search (OLGA)

General

Marker: BI292991

Symbol:

BI292991

Previously known as:

RGD ID:

5030129

Expected Size:

167 (bp)

Position

Rat Assembly	Chr	Position (strand)	Source	JBrowse
mRatBN7.2	2	232,513,351 - 232,513,518 (+)	MAPPER	mRatBN7.2
Rnor_6.0	2	249,460,385 - 249,460,551	NCBI	Rnor6.0
Rnor_5.0	2	267,997,538 - 267,997,704	UniSTS	Rnor5.0
RGSC_v3.4	2	241,650,779 - 241,650,945	UniSTS	RGSC3.4
Celera	2	224,521,972 - 224,522,138	UniSTS
RH 3.4 Map	2	1582.0	UniSTS

Annotation

References - curated

#	Reference Title	Reference Citation
1.	UniSTS Pipeline	RGD automated pipelines

Strains and Sequence

Sequence


Forward Primer	GATGCTTTCTTTGTGACTTGCG
Reverse Primer	TGAACAGAATGGGAACTGAGGA

Region

Nucleotide Sequences


GenBank Nucleotide	CH473952	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	CM000232	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles

QTLs in Region (mRatBN7.2)

The following QTLs overlap with this region.

RGD ID	Symbol	Name	LOD	P Value	Trait	Sub Trait	Chr	Start	Stop	Species
631563	Hcuc3	Hepatic copper content QTL 3	3.87		liver copper amount (VT:0003065)	liver copper weight to liver dry weight ratio (CMO:0001512)	2	229059610	249053267	Rat
1331767	Hrtrt12	Heart rate QTL 12	3.373		heart pumping trait (VT:2000009)	heart rate (CMO:0000002)	2	218414747	240841241	Rat
1598813	Memor9	Memory QTL 9	2.7		exploratory behavior trait (VT:0010471)	average horizontal distance between subject and target during voluntary locomotion in an experimental apparatus (CMO:0002674)	2	199341726	234244620	Rat
8693697	Alc36	Alcohol consumption QTL 36	2	0.592	drinking behavior trait (VT:0001422)	calculated ethanol drink intake rate (CMO:0001615)	2	217139753	236660713	Rat
1298075	Scl17	Serum cholesterol level QTL 17	3.4		blood cholesterol amount (VT:0000180)	plasma total cholesterol level (CMO:0000585)	2	211744537	249053267	Rat
2293833	Kiddil8	Kidney dilation QTL 8	2.9		kidney pelvis morphology trait (VT:0004194)	hydronephrosis severity score (CMO:0001208)	2	219753301	247136170	Rat
1598835	Anxrr18	Anxiety related response QTL 18	2.98		body movement coordination trait (VT:0005424)	number of rearing movements in an experimental apparatus (CMO:0001752)	2	200990457	245990457	Rat
2298479	Eau5	Experimental allergic uveoretinitis QTL 5		0.0021	uvea integrity trait (VT:0010551)	experimental autoimmune uveitis score (CMO:0001504)	2	202446871	237938339	Rat
1300126	Bp175	Blood pressure QTL 175	3.46		arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	2	214226044	247136170	Rat
7207490	Bss111	Bone structure and strength QTL 111	6.4		femur morphology trait (VT:0000559)	femur midshaft cortical cross-sectional area (CMO:0001663)	2	211744537	249053267	Rat
7207484	Bss108	Bone structure and strength QTL 108	5.3		femur strength trait (VT:0010010)	femur total energy absorbed before break (CMO:0001677)	2	211744537	249053267	Rat
2313073	Bmd75	Bone mineral density QTL 75	4.1	0.0001	tibia mineral mass (VT:1000283)	total volumetric bone mineral density (CMO:0001728)	2	215377404	237938339	Rat
8693622	Alc26	Alcohol consumption QTL 26	2.4	0.667	drinking behavior trait (VT:0001422)	calculated ethanol drink intake rate (CMO:0001615)	2	221136523	241305619	Rat
7411555	Bw132	Body weight QTL 132		0.001	body mass (VT:0001259)	body weight gain (CMO:0000420)	2	223389739	249053267	Rat
61366	Iddm3	Insulin dependent diabetes mellitus QTL 3	4.7		blood glucose amount (VT:0000188)	blood glucose level (CMO:0000046)	2	189599258	234599258	Rat
61398	Bp50	Blood pressure QTL 50	4.4		arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	2	189599258	234599258	Rat
9587428	Epfw6	Epididymal fat weight QTL 6	7.47	0.001	epididymal fat pad mass (VT:0010421)	epididymal fat pad weight to body weight ratio (CMO:0000658)	2	223389739	249053267	Rat
2293844	Kiddil7	Kidney dilation QTL 7	3.5		kidney pelvis morphology trait (VT:0004194)	hydronephrosis severity score (CMO:0001208)	2	219753301	247136170	Rat
7207482	Bss107	Bone structure and strength QTL 107	7		femur strength trait (VT:0010010)	femur ultimate force (CMO:0001675)	2	211744537	249053267	Rat
1641891	Alcrsp17	Alcohol response QTL 17			response to alcohol trait (VT:0010489)	duration of loss of righting reflex (CMO:0002289)	2	149559561	249053267	Rat
1549836	Bss2	Bone structure and strength QTL 2	7.5		femur strength trait (VT:0010010)	femur midshaft polar moment of inertia (CMO:0001669)	2	211744537	249053267	Rat
2317752	Glom23	Glomerulus QTL 23	3.6		urine protein amount (VT:0005160)	urine protein level (CMO:0000591)	2	193452645	245889826	Rat
724534	Uae6	Urinary albumin excretion QTL 6	10		urine albumin amount (VT:0002871)	urine albumin level (CMO:0000130)	2	78665619	249053267	Rat
2317885	Alcrsp28	Alcohol response QTL 28	2.1	0.63	response to alcohol trait (VT:0010489)	duration of loss of righting reflex (CMO:0002289)	2	212828222	249053267	Rat

Additional Information

Gene Annotator (Functional Annotation) unavailable	Gene Annotator (Annotation Distribution) unavailable	Variant Visualizer (Genomic Variants) unavailble Variant Visualizer (Genomic Variants) unavailable
Gene Annotator (Functional Annotation)	Gene Annotator (Annotation Distribution)	Variant Visualizer (Genomic Variants)

InterViewer (Protein-Protein Interactions) unavailable	Gviewer (Genome Viewer) unavailable	Variant Visualizer (Damaging Variants) unavailble Variant Visualizer (Damaging Variants) unavailable
InterViewer (Protein-Protein Interactions)	GViewer (Genome Viewer)	Variant Visualizer (Damaging Variants)

Gene Annotator (Annotation Comparison) unavailable	OLGA (Gene List Generator) unavailable
Gene Annotator (Annotation Comparison)	OLGA (Gene List Generator)	Excel (Download)

MOET (Multi-Ontology Enrichement) unavailable	GOLF (Gene-Ortholog Location Finder) unavailable
MOET (Multi-Ontology Enrichement)	GOLF (Gene-Ortholog Location Finder)

Create Name:

Description:

Send us a Message

Marker: BI292991