BI278117 Marker Search Result - Rat Genome Database
Submit Data |  Help |  Video Tutorials |  News |  Publications |  FTP Download |  REST API |  Citing RGD |  Contact   

Marker: BI278117

Symbol: BI278117
Also known as:
RGD ID: 5029775
Expected Size: 210 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
Rnor_6.02222,913,701 - 222,913,910NCBIRnor6.0
Rnor_6.0320,676,578 - 20,676,787NCBIRnor6.0
Rnor_5.0325,925,649 - 25,925,858UniSTSRnor5.0
Rnor_5.02240,958,742 - 240,958,951UniSTSRnor5.0
RGSC_v3.4499,873,030 - 99,873,239UniSTSRGSC3.4
RH 3.4 Map4589.3UniSTS


Annotation


References - curated
1. RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer GGTGAGTGCATCAGCCAGAATA
Reverse Primer CTCCTCTGAGGCAATTCAAGGT
 

Region

Nucleotide Sequences
GenBank Nucleotide CH474210 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  JH614038 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (Rnor_6.0)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
631679Cm10Cardiac mass QTL 107.340.0001heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)3125786001Rat
70202Alc19Alcohol consumption QTL 192.5drinking behavior trait (VT:0001422)ethanol intake volume to total fluid intake volume ratio (CMO:0001591)3128136884Rat
631545Bp85Blood pressure QTL 853.1arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)3128500807Rat
61468Bp15Blood pressure QTL 154.4blood pressure trait (VT:0000183)pulse pressure (CMO:0000292)3128500807Rat
61468Bp15Blood pressure QTL 154.4blood pressure trait (VT:0000183)systolic blood pressure (CMO:0000004)3128500807Rat
61468Bp15Blood pressure QTL 154.4blood pressure trait (VT:0000183)diastolic blood pressure (CMO:0000005)3128500807Rat
631831Alc8Alcohol consumption QTL 82.7consumption behavior trait (VT:0002069)calculated ethanol drink intake rate (CMO:0001615)3132972944Rat
4889966Bss95Bone structure and strength QTL 954.4tibia area (VT:1000281)tibia-fibula cross-sectional area (CMO:0001718)3137891710Rat
2312664Scl62Serum cholesterol level QTL 620.05blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)3139773425Rat
2290452Scl56Serum cholesterol level QTL 562.26blood cholesterol amount (VT:0000180)plasma total cholesterol level (CMO:0000585)3195176874Rat
1298526Arunc3Aerobic running capacity QTL 32.2exercise endurance trait (VT:0002332)maximum distance run on treadmill (CMO:0001406)3263142133477544Rat
10401810Kidm53Kidney mass QTL 53kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)3263142148562146Rat
70203Gcr2Gastric cancer resistance QTL 22.6stomach morphology trait (VT:0000470)stomach tumor susceptibility score (CMO:0002043)3328592928136884Rat
1358357Srcrtb1Stress Responsive Cort Basal QTL 16.360.002blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)3328592928136884Rat
8693641Alc30Alcohol consumption QTL 3020.739drinking behavior trait (VT:0001422)calculated ethanol drink intake rate (CMO:0001615)3565463925105730Rat
1558654Bw56Body weight QTL 564.50.0000171body mass (VT:0001259)body weight (CMO:0000012)3600074834394365Rat
6893355Bw101Body weight QTL 1010.40.38body mass (VT:0001259)body weight (CMO:0000012)3600074834394365Rat
6893363Bw105Body weight QTL 1052.60.0036body mass (VT:0001259)body weight (CMO:0000012)3600074834394365Rat
70191BpQTLcluster4Blood pressure QTL cluster 43arterial blood pressure trait (VT:2000000)absolute change in systolic blood pressure (CMO:0000607)3600074851687917Rat
70191BpQTLcluster4Blood pressure QTL cluster 43arterial blood pressure trait (VT:2000000)absolute change in mean arterial blood pressure (CMO:0000533)3600074851687917Rat
1558647Cm46Cardiac mass QTL 465.40.0000055heart mass (VT:0007028)heart wet weight (CMO:0000069)3600086634394121Rat
1558650Cm48Cardiac mass QTL 4840.0001heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)3600086634394121Rat
1558657Cm43Cardiac mass QTL 436.60.0000000293heart mass (VT:0007028)heart wet weight (CMO:0000069)3600086634394121Rat
1358905Hrtrt17Heart rate QTL 175.90.000014heart pumping trait (VT:2000009)heart rate (CMO:0000002)31009408193415837Rat
2298542Neuinf11Neuroinflammation QTL 113.9nervous system integrity trait (VT:0010566)spinal cord complement component 1, q subcomponent, B chain mRNA level (CMO:0002126)31011931879772001Rat
1358885Bp251Blood pressure QTL 2513.8arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)310639528127023997Rat
1358888Bp264Blood pressure QTL 2644.43arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)310639528127023997Rat
634306Bp140Blood pressure QTL 1403.30.0013arterial blood pressure trait (VT:2000000)body weight (CMO:0000012)31312691436600143Rat
634306Bp140Blood pressure QTL 1403.30.0013arterial blood pressure trait (VT:2000000)body weight (CMO:0000012)31312691436600143Rat
634306Bp140Blood pressure QTL 1403.30.0013arterial blood pressure trait (VT:2000000)heart rate (CMO:0000002)31312691436600143Rat
634306Bp140Blood pressure QTL 1403.30.0013arterial blood pressure trait (VT:2000000)heart rate (CMO:0000002)31312691436600143Rat
634306Bp140Blood pressure QTL 1403.30.0013arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)31312691436600143Rat
634306Bp140Blood pressure QTL 1403.30.0013arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)31312691436600143Rat
634306Bp140Blood pressure QTL 1403.30.0013arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)31312691436600143Rat
634306Bp140Blood pressure QTL 1403.30.0013arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)31312691436600143Rat
631568Bp92Blood pressure QTL 922.20.005arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)31312691441510346Rat
2325840Bp345Blood pressure QTL 3450.001arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)31409041129084626Rat
731172Bp151Blood pressure QTL 1510.04arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)31409041148562146Rat
12879849Bw180Body weight QTL 1800.037body mass (VT:0001259)body weight (CMO:0000012)31409041148562146Rat
12879850Cm91Cardiac mass QTL 910.001heart mass (VT:0007028)heart wet weight to body weight ratio (CMO:0002408)31409041148562146Rat
12879851Cm92Cardiac mass QTL 920.001heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)31409041148562146Rat
12879852Cm93Cardiac mass QTL 930.001heart right ventricle mass (VT:0007033)heart right ventricle weight to body weight ratio (CMO:0000914)31409041148562146Rat
12879853Am5Aortic mass QTL 50.001aorta mass (VT:0002845)aorta weight to aorta length to body weight ratio (CMO:0002722)31409041148562146Rat
12879854Kidm63Kidney mass QTL 630.001kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)31409041148562146Rat
631676Cm8Cardiac mass QTL 87.030.0001aorta mass (VT:0002845)aorta weight (CMO:0000076)31802366463023664Rat
631203Gluco14Glucose level QTL 140.0001blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)2221880206235570970Rat
61458Bp10Blood pressure QTL 103.42arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)2204003742231132207Rat
61469Bp16Blood pressure QTL 165.64arterial blood pressure trait (VT:2000000)blood pressure measurement (CMO:0000003)2184730446229730446Rat
70162Bp63Blood pressure QTL 635.64arterial blood pressure trait (VT:2000000)blood pressure measurement (CMO:0000003)2184730446229730446Rat
724568Uae13Urinary albumin excretion QTL 134.4urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)2149114878225501939Rat
1331734Bp204Blood pressure QTL 2043.61192arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)2181990297240020001Rat
1331745Bp203Blood pressure QTL 2034.377arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)2204585642235290110Rat
1298083Bp158Blood pressure QTL 1582.62arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)2204003742231132207Rat
1331794Bp202Blood pressure QTL 2023.66819arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)2147122993240020001Rat
1331805Cm29Cardiac mass QTL 293.50746heart mass (VT:0007028)heart wet weight (CMO:0000069)2147122993240020001Rat
2307174Activ3Activity QTL 34.830.000058locomotor behavior trait (VT:0001392)number of entries into a discrete space in an experimental apparatus (CMO:0000960)2183984665228984665Rat
1581499Esta2Estrogen-induced thymic atrophy QTL 2thymus mass (VT:0004954)thymus wet weight (CMO:0000855)2204585642243689611Rat
738013Alc15Alcohol consumption QTL 154.10.00022consumption behavior trait (VT:0002069)ethanol drink intake rate to body weight ratio (CMO:0001616)2199380312244380312Rat
631507Bp105Blood pressure QTL 1050.001arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)2116075644228737869Rat
1302789Stl26Serum triglyceride level QTL 263.10.0035blood triglyceride amount (VT:0002644)plasma triglyceride level (CMO:0000548)2218957047240977220Rat
1641891Alcrsp17Alcohol response QTL 17response to alcohol trait (VT:0010489)duration of loss of righting reflex (CMO:0002289)2155965557254121739Rat
1641925Alcrsp2Alcohol response QTL 2response to alcohol trait (VT:0010489)duration of loss of righting reflex (CMO:0002289)2155965557237742948Rat
1598813Memor9Memory QTL 92.7exploratory behavior trait (VT:0010471)average horizontal distance in proximity to the target during voluntary locomotion in an experimental apparatus (CMO:0002674)2214870793251212353Rat
1598835Anxrr18Anxiety related response QTL 182.98body movement coordination trait (VT:0005424)number of rearing movements in an experimental apparatus (CMO:0001752)2217743855262743855Rat
1598838Bp290Blood pressure QTL 2901.9arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)2181522444226522444Rat
2301408Kidm36Kidney mass QTL 360.002kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)2205583921243562243Rat
2298479Eau5Experimental allergic uveoretinitis QTL 50.0021uvea integrity trait (VT:0010551)experimental autoimmune uveitis score (CMO:0001504)2217498545254132424Rat
2300189Bmd48Bone mineral density QTL 485.80.0001femur mineral mass (VT:0010011)volumetric bone mineral density (CMO:0001553)2194378622239378622Rat
634308Sach6Saccharin preference QTL 64.9taste sensitivity trait (VT:0001986)saccharin intake volume to total fluid intake volume ratio (CMO:0001601)2116075644228737869Rat
1358356Srcrt1Stress Responsive Cort QTL13.66blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)2175403337239166203Rat
1578648Bss11Bone structure and strength QTL 114.7femur morphology trait (VT:0000559)femoral neck cortical cross-sectional area (CMO:0001702)2118446646227707979Rat
1354622Kidm16Kidney mass QTL 163kidney mass (VT:0002707)left kidney wet weight (CMO:0000083)283819608239166203Rat
1354648Bp239Blood pressure QTL 2390.001arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)266828236243550655Rat
1354649Kidm17Kidney mass QTL 172.9kidney mass (VT:0002707)calculated kidney weight (CMO:0000160)283819608243901375Rat
2299161Iddm33Insulin dependent diabetes mellitus QTL 332.98blood glucose amount (VT:0000188)age at onset/diagnosis of type 1 diabetes mellitus (CMO:0001140)2221488355254121739Rat
1359022Ppulsi1Prepulse inhibition QTL 13.63prepulse inhibition trait (VT:0003088)acoustic startle response measurement (CMO:0001519)2142053350228984665Rat
1554319Bmd2Bone mineral density QTL 213.40.0001lumbar vertebra area (VT:0010570)lumbar vertebra cross-sectional area (CMO:0001689)2118446793228582621Rat
2306901Bp337Blood pressure QTL 3370.01arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)2177680772243901375Rat
1359031Bp275Blood pressure QTL 275arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)2200453324236318668Rat
1359031Bp275Blood pressure QTL 275arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)2200453324236318668Rat
2317752Glom23Glomerulus QTL 233.6urine protein amount (VT:0005160)urine protein level (CMO:0000591)2208594330263179188Rat
2293084Iddm26Insulin dependent diabetes mellitus QTL 262.9blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)2188838511228984665Rat
61366Iddm3Insulin dependent diabetes mellitus QTL 34.7blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)2204585642249585642Rat
61398Bp50Blood pressure QTL 504.4arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)2204585642249585642Rat
61417Cia10Collagen induced arthritis QTL 103.4joint integrity trait (VT:0010548)experimental arthritis severity measurement (CMO:0001459)2194998627239998627Rat
8694435Bw166Body weight QTL 16614.080.001retroperitoneal fat pad mass (VT:0010430)retroperitoneal fat pad weight to body weight ratio (CMO:0000635)2197253963242253963Rat
9589044Scfw1Subcutaneous fat weight QTL 15.80.001subcutaneous adipose mass (VT:1000472)abdominal subcutaneous fat pad weight (CMO:0002069)2197253963242253963Rat
8694383Bw158Body weight QTL 1587.690.001body lean mass (VT:0010483)lean tissue morphological measurement (CMO:0002184)2197253963242253963Rat
8662843Vetf9Vascular elastic tissue fragility QTL 92.05thoracic aorta molecular composition trait (VT:0010568)aorta wall extracellular elastin dry weight to aorta wall extracellular collagen weight ratio (CMO:0002003)2169852670243026643Rat
8662832Vetf7Vascular elastic tissue fragility QTL 73.5aorta elastin amount (VT:0003905)aorta wall extracellular elastin dry weight to aorta wall dry weight ratio (CMO:0002002)283754907237610852Rat
8694194Abfw1Abdominal fat weight QTL 111.70.001visceral adipose mass (VT:0010063)abdominal fat pad weight to body weight ratio (CMO:0000095)2197253963242253963Rat
10755499Bp389Blood pressure QTL 3892.61arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)216679272245624402Rat


Additional Information

Database Acc Id Source(s)
UniGene Rn.152180 UniSTS
UniSTS 244241 UniSTS