BI277538 Marker Search Result - Rat Genome Database
Submit Data |  Help |  Video Tutorials |  News |  Publications |  FTP Download |  REST API |  Citing RGD |  Contact   

Marker: BI277538

Symbol: BI277538
Also known as:
RGD ID: 5029649
Expected Size: 183 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
Rnor_6.0655,706,624 - 55,706,925NCBIRnor6.0
Rnor_6.0699,984,365 - 99,984,547NCBIRnor6.0
Rnor_5.0665,321,005 - 65,321,306UniSTSRnor5.0
Rnor_5.06109,378,949 - 109,379,131UniSTSRnor5.0
RGSC_v3.4699,528,751 - 99,528,933UniSTSRGSC3.4
RGSC_v3.4654,941,318 - 54,941,619UniSTSRGSC3.4
Celera652,090,030 - 52,090,333UniSTS
Celera694,055,031 - 94,055,213UniSTS
RH 3.4 Map6669.3UniSTS
Cytogenetic Map6q24UniSTS
Cytogenetic Map6q16UniSTS
Is Marker For: Genes:   Max   Lrrc72  


Annotation


References - curated
1. RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer ATGGAATCAACACCGACTGAGA
Reverse Primer CTTCCTCCTGTCCTGGAATTGT
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
1560395Lrrc72leucine rich repeat containing 7265569426955757234Rat
7517562LOC102546494protein max-like65570681455708395Rat
11382383LOC10835133240S ribosomal protein S26-like65575792355758270Rat
628877Sostdc1sclerostin domain containing 165581282055816994Rat
1359368CrppaCDP-L-ribitol pyrophosphorylase A65588013656159466Rat
9299213LOC103692610coiled-coil-helix-coiled-coil-helix domain-containing protein 2, mitochondrial pseudogene65606878456071595Rat
7693349LOC102546794uncharacterized LOC10254679465621627656219734Rat
11479069LOC108351226uncharacterized LOC10835122665640039556411242Rat
2324155LOC100362703heterogeneous nuclear ribonucleoprotein A1-like65646981356504273Rat
3079Meox2mesenchyme homeobox 265662576856689195Rat
1589986Vom2r49vomeronasal 2 receptor, 4965673289156775529Rat
1312038Agmoalkylglycerol monooxygenase65684685957193918Rat
11398630LOC108351227uncharacterized LOC10835122765721938057257946Rat
11518989LOC108351363uncharacterized LOC10835136365725896757263048Rat
1563613RGD1563613similar to 40S ribosomal protein S2565739617857396594Rat
2488Dgkbdiacylglycerol kinase, beta65751635158277385Rat
7669283LOC102549779actin, cytoplasmic 2-like65759695257598103Rat
9263034LOC103692620thyroid hormone receptor-associated protein 3 pseudogene65770752757711961Rat
1589430LOC680646similar to 40S ribosomal protein S265838770358389016Rat
2323883LOC100362896prostatic binding protein-like65841915658419713Rat
1312007Etv1ETS variant transcription factor 165846721558558640Rat
2323695LOC100362999hsc70-interacting protein-like65929989659301508Rat
1305611Smarce1lSWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily e, member 1-like65936683259368178Rat
7629082LOC102548656igE-binding protein-like65950501359506572Rat
1560073RGD1560073similar to ribosomal protein S1065953104259531582Rat
1588231LOC680735similar to 60S ribosomal protein L17 (L23) (Amino acid starvation-induced protein) (ASI)65966234959662893Rat
1588211LOC680755similar to B-cell receptor-associated protein 3765985009959852546Rat
2152Arl4aADP-ribosylation factor like GTPase 4A65994592659950586Rat
7630539LOC102551566uncharacterized LOC10255156665995078759958981Rat
735034Scinscinderin65997537560055075Rat
9259024LOC103692615uncharacterized LOC10369261566005446960065855Rat
1587073Lsmem1leucine-rich single-pass membrane protein 166011407760124297Rat
2867Ifrd1interferon-related developmental regulator 166013202560151354Rat
7633421LOC102551830uncharacterized LOC10255183066017887060180424Rat
1583856Zfp277zinc finger protein 27766024620960374388Rat
1561724Dock4dedicator of cytokinesis 466037483960782648Rat
9385702LOC103692616uncharacterized LOC10369261666042650560438016Rat
9392136LOC103692617transcription elongation factor B polypeptide 1 pseudogene66081840660818701Rat
2323665Immp2linner mitochondrial membrane peptidase subunit 266095835161859457Rat
2323872LOC100359421histone H3.3B-like66098867860989919Rat
7500279LOC102552766uncharacterized LOC10255276666103638861072441Rat
9346795LOC103692618uncharacterized LOC10369261866122470861227667Rat
71066Lrrn3leucine rich repeat neuronal 366137432861405195Rat
1589745Ndufa10l1NADH dehydrogenase (ubiquinone) 1 alpha subcomplex 10-like 166279695162798384Rat
11364132LOC108351333endogenous retrovirus group K member 8 Pol protein-like66331871763321091Rat
9072809LOC103692621oligosaccharyltransferase complex subunit OSTC pseudogene66333861163360873Rat
11403672LOC108351228uncharacterized LOC10835122866342982963439081Rat
7544796LOC102553990uncharacterized LOC10255399066412039964152399Rat
3070Dnajb9DnaJ heat shock protein family (Hsp40) member B966416591364170122Rat
9352471LOC103692619uncharacterized LOC10369261966417581464224796Rat
9440656LOC103692622uncharacterized LOC10369262266417582164178828Rat
1583553LOC681138similar to DnaJ (Hsp40) homolog, subfamily B, member 666419297264194110Rat
1311444Pnpla8patatin-like phospholipase domain containing 866422487064288465Rat
3209Nrcamneuronal cell adhesion molecule66429784364867408Rat
6490794LOC100911744ninein-like66458706664625636Rat
11460919LOC108348084dnaJ homolog subfamily C member 17-like66464616964648793Rat
9281538LOC103692623M-phase phosphoprotein 6 pseudogene66464879164650188Rat
6490132LOC100911871coiled-coil domain-containing protein 85C-like66472906164738925Rat
6489645LOC100911922alpha-enolase-like66477097764772670Rat
1598017LOC681255similar to G patch domain containing 4 protein isoform 266496894864969982Rat
11407073LOC108351229transformer-2 protein homolog alpha pseudogene66500672065008654Rat
1598278LOC366611similar to Alpha-enolase (2-phospho-D-glycerate hydro-lyase) (Non-neural enolase) (NNE) (Enolase 1)66501265965014352Rat
1583855LOC298990hypothetical LOC29899066503123665032931Rat
1306117Stxbp6syntaxin binding protein 666508648365319527Rat
9397046LOC103692624uncharacterized LOC10369262466526989165273188Rat
9256166LOC103692625uncharacterized LOC10369262566560277365606082Rat
7593102LOC102555380uncharacterized LOC10255538066570522065722682Rat
7652149LOC102555435uncharacterized LOC10255543566574496665751008Rat
9294132LOC103692626uncharacterized LOC10369262666576651565770191Rat
9317184LOC103692627uncharacterized LOC10369262766577145765778037Rat
11450428LOC108351230uncharacterized LOC10835123066577935265787252Rat
621345Nova1NOVA alternative splicing regulator 166696012667085836Rat
7725900LOC102556158uncharacterized LOC10255615866824934368268080Rat
1598277LOC366613similar to Importin alpha-2 subunit (Karyopherin alpha-2 subunit) (SRP1-alpha) (RAG cohort protein 1) (Pendulin) (Pore targeting complex 58 kDa subunit) (PTAC58) (Importin alpha P1)66867292768674901Rat
7693265LOC102556377uncharacterized LOC10255637766871687368725462Rat
1334065Olr873-psolfactory receptor pseudogene 87366949762969498282Rat
2320031LOC100364934Leydig cell tumor 10 kDa protein-like66961929569619628Rat
2323500LOC100359740D-3-phosphoglycerate dehydrogenase-like66993708369938327Rat
7543646LOC102546336uncharacterized LOC10254633666993976269945424Rat
1559629RGD1559629similar to H+ ATP synthase66995012969951013Rat
2619Foxg1forkhead box G166997122769974037Rat
7619249LOC102546421uncharacterized LOC10254642166997556069994251Rat
7627887LOC102546496uncharacterized LOC10254649667021653970220854Rat
9219694LOC103692628uncharacterized LOC10369262867025830470343196Rat
6486816LOC100912520leydig cell tumor 10 kDa protein homolog67027622770276560Rat
1583294LOC685003similar to Leydig cell tumor 10 kDa protein67028946470289797Rat
9146736LOC103692629uncharacterized LOC10369262967096200770964521Rat
620964Prkd1protein kinase D167103501771349531Rat
11491233LOC108351231uncharacterized LOC10835123167167529871703445Rat
9182264LOC103692630uncharacterized LOC10369263067171201571733152Rat
7728058LOC102557478uncharacterized LOC10255747867173394471853649Rat
1310263G2e3G2/M-phase specific E3 ubiquitin protein ligase67209214872123878Rat
9079291LOC103692631uncharacterized LOC10369263167211317672114855Rat
619828Scfd1sec1 family domain containing 167212440872202703Rat
1587060LOC680823similar to Ubiquitin-conjugating enzyme E2 I (Ubiquitin-protein ligase I) (Ubiquitin carrier protein I) (SUMO-1-protein ligase) (SUMO-1-conjugating enzyme) (Ubiquitin-conjugating enzyme UbcE2A)67213301972133964Rat
7607530LOC102551044uncharacterized LOC10255104467218794872230834Rat
2323296LOC100359846hypothetical LOC10035984667226530672266267Rat
11497096LOC108351233uncharacterized LOC10835123367227091172359999Rat
9174726LOC103692632ADP-ribosylation factor-like protein 1 pseudogene67228870072290899Rat
11405764LOC108351234uncharacterized LOC10835123467231334072313928Rat
1308536Cochcochlin67235970272373710Rat
621827Strn3striatin 367237636072462676Rat
9229379LOC103692633uncharacterized LOC10369263367240361072409447Rat
1311990Ap4s1adaptor related protein complex 4 subunit sigma 167246197772502717Rat
1561653Hectd1HECT domain E3 ubiquitin protein ligase 167250965872596285Rat
1561116Heatr5aHEAT repeat containing 5A67264865472750202Rat
11421308LOC108351334vegetative cell wall protein gp1-like67274962172750307Rat
1309138Dtd2D-aminoacyl-tRNA deacylase 267278122972786835Rat
1306830Gpr33G protein-coupled receptor 3367280484372805848Rat
1307232Nubplnucleotide binding protein-like67289175873147837Rat
11440663LOC108351235tensin-2 pseudogene67293103972935120Rat
7536596LOC102552216tensin-like C1 domain-containing phosphatase-like67293141472932801Rat
1595110LOC685338similar to longevity assurance homolog 567319538973196416Rat
9358597LOC103692634uncharacterized LOC10369263467322460573225974Rat
9095294LOC103692641dynein assembly factor 3, axonemal homolog67334484273358025Rat
1308507Arhgap5Rho GTPase activating protein 567334512973408304Rat
7670615LOC102547541uncharacterized LOC10254754167344418873445547Rat
69412Akap6A-kinase anchoring protein 667355311173991992Rat
7709127LOC102547662uncharacterized LOC10254766267404979474058457Rat
9155261LOC103692635neuronal PAS domain-containing protein 3-like67408199574326992Rat
1307181Npas3neuronal PAS domain protein 367408199574913025Rat
7629096LOC102547735uncharacterized LOC10254773567424076474278309Rat
71019Egln3egl-9 family hypoxia-inducible factor 367505032975075795Rat
7578757LOC102547890uncharacterized LOC10254789067522423975228553Rat
1559672Timm23btranslocase of inner mitochondrial membrane 23 homolog B67524390375245018Rat
2322683LOC100360166expressed sequence AU019823-like67527260275296139Rat
9129693LOC103692636uncharacterized LOC10369263667530411075313715Rat
2323006Rps10l1ribosomal protein S10-like 167542971575430282Rat
1559724RGD1559724similar to 40S ribosomal protein S1967546985675470385Rat
1565821Sptssaserine palmitoyltransferase, small subunit A67554013275551545Rat
1309624EappE2F-associated phosphoprotein67556189875589274Rat
9142254LOC103692637uncharacterized LOC10369263767556614375566572Rat
7646071LOC102548253centrin-4-like67557259475576632Rat
7561334LOC102548522uncharacterized LOC10254852267562133775626216Rat
1304647Snx6sorting nexin 667562692775670172Rat
7646365LOC102548461uncharacterized LOC10254846167567016775698555Rat
9167354LOC103695296glyceraldehyde-3-phosphate dehydrogenase pseudogene67573253575733572Rat
1306982Cfl2cofilin 267575914075763185Rat
1306199Baz1abromodomain adjacent to zinc finger domain, 1A67579322375873854Rat
11491526LOC108351236uncharacterized LOC10835123667589827775925689Rat
1304624RGD1304624similar to RIKEN cDNA 2700097O0967594588975996483Rat
9462711LOC103692638uncharacterized LOC10369263867597925975983680Rat
621390Srp54asignal recognition particle 54A67599662976035768Rat
2323636Fam177a1family with sequence similarity 177, member A167604108076055912Rat
1309207Ppp2r3cprotein phosphatase 2, regulatory subunit B'', gamma67605658576079755Rat
1305089Prorpprotein only RNase P catalytic subunit67607988076171298Rat
61849Psma6proteasome 20S subunit alpha 667617446076205429Rat
11466682LOC108351237uncharacterized LOC10835123767625877476267492Rat
3171NfkbiaNFKB inhibitor alpha67626722776270457Rat
7665513LOC102548803uncharacterized LOC10254880367631698676324744Rat
1359133Aldoart2aldolase 1 A retrogene 267634936276351052Rat
1306949Insm2INSM transcriptional repressor 267638068176386240Rat
620642Ralgapa1Ral GTPase activating protein catalytic subunit alpha 167638697176661530Rat
2325062LOC100359668ferritin light chain 267665203376652975Rat
4888535Mir3593microRNA 359367666179976661889Rat
7744426LOC102546497uncharacterized LOC10254649767666942176675289Rat
6495833LOC100910898breast cancer metastasis-suppressor 1-like protein-like67667539976708260Rat
1306006Brms1lBRMS1 like transcriptional repressor67667539976708261Rat
1306006Brms1lBRMS1 like transcriptional repressor67674324376753950Rat
1586694LOC686002similar to 60S ribosomal protein L767689732576898062Rat
1598274LOC366626similar to glyceraldehyde-3-phosphate dehydrogenase67692690076927883Rat
1598273LOC366627similar to L-lactate dehydrogenase A chain (LDH-A) (LDH muscle subunit) (LDH-M)67695726277022322Rat
11480668LOC108351335L-lactate dehydrogenase A chain pseudogene67702530277028368Rat
7624949LOC102551143uncharacterized LOC10255114367713247477192691Rat
11370304LOC108351238uncharacterized LOC10835123867713945977152814Rat
1306310MbipMAP3K12 binding inhibitory protein 167722643977243696Rat
11475273LOC108351239uncharacterized LOC10835123967729787677319305Rat
7751922LOC102551688uncharacterized LOC10255168867730541677330219Rat
6489654LOC100911923uncharacterized LOC10091192367737577677416950Rat
3866Nkx2-1NK2 homeobox 167741809677423383Rat
7748644LOC102552092uncharacterized LOC10255209267742153177432756Rat
7545272LOC102554545transcription factor BTF3-like67745450777457164Rat
1598272LOC366628similar to peptidase (mitochondrial processing) beta67745720877464425Rat
1310629Nkx2-8NK2 homeobox 867750688277508585Rat
2321461LOC100360797ribosomal protein L15-like67753846077539090Rat
1560838Pax9paired box 967760770577624453Rat
621444Slc25a21solute carrier family 25 member 2167762438478121339Rat
7624969LOC102554460GDP-Man:Man(3)GlcNAc(2)-PP-Dol alpha-1,2-mannosyltransferase-like67768011677682012Rat
11452082LOC108351240uncharacterized LOC10835124067773526377751536Rat
9107639LOC103692639uncharacterized LOC10369263967787622577907779Rat
7647113LOC102552151uncharacterized LOC10255215167811300078116143Rat
1359636LOC314140ribose-phosphate pyrophosphokinase I -like67817276278181608Rat
6504372Mipol1mirror-image polydactyly 167817284278506232Rat
2807Foxa1forkhead box A167851657978549669Rat
7572136LOC102553136uncharacterized LOC10255313667851756678519493Rat
1560556Ttc6tetratricopeptide repeat domain 667856745378779151Rat
9258221LOC103692640transcription elongation factor B polypeptide 1 pseudogene67858601778586918Rat
1598271LOC366632similar to 40S ribosomal protein S667870702578707814Rat
1587663LOC688516similar to L-lactate dehydrogenase A chain (LDH-A) (LDH muscle subunit) (LDH-M)67914904279150323Rat
3762Sstr1somatostatin receptor 167925291479258611Rat
1306232Clec14aC-type lectin domain containing 14A67930330179306443Rat
7532141LOC102553397uncharacterized LOC10255339767932805079332268Rat
1586499LOC688601similar to Ras-GTPase-activating protein binding protein 1 (ATP-dependent DNA helicase VIII) (GAP SH3-domain binding protein 1) (G3BP-1) (HDH-VIII)67972029079722231Rat
1586488LOC688612similar to DEAD (Asp-Glu-Ala-Asp) box polypeptide 21a67983039279831841Rat
1586460LOC688640similar to muscle protein68468000863780009453Rat
1586428LOC688672similar to eukaryotic translation initiation factor 4A, isoform 168002260480023901Rat
1309103Sec23aSec23 homolog A, COPII coat complex component68005974280107340Rat
7621655LOC102553646uncharacterized LOC10255364668006763680069401Rat
620842Gemin2gem (nuclear organelle) associated protein 268010875180122382Rat
1588546Cyp51a1-ps1cytochrome P450, family 51, subfamily a, polypeptide 1, pseudogene 168012664980128800Rat
1309325Trappc6btrafficking protein particle complex subunit 6B68014212680153216Rat
1597086Pnnpinin, desmosome associated protein68015936480167677Rat
6488546Mia2MIA SH3 domain ER export factor 268018872180286918Rat
1307543Fbxo33F-box protein 3368030229180334536Rat
9159722LOC103695309glyceraldehyde-3-phosphate dehydrogenase pseudogene68045706780458094Rat
1563850RGD1563850similar to Aldo-keto reductase family 1, member B868105234681065479Rat
1598269LOC366640similar to Multifunctional protein ADE268116496081166383Rat
1598344LOC299084similar to proliferating cell nuclear antigen68126889881270707Rat
1598268LOC366641similar to 5-nucleotidase, cytosolic II68135114581356699Rat
11455066LOC108351364uncharacterized LOC10835136468161593381624492Rat
9176028LOC103692646peptidyl-prolyl cis-trans isomerase A-like68188991681920637Rat
1582962LOC688945hypothetical protein LOC68894568238885682389558Rat
1582948LOC688959similar to SEC13-like 168243217182433129Rat
1582931LOC688976similar to poly(rC) binding protein 268271939182720338Rat
6501490LOC100909786serologically defined colon cancer antigen 3 homolog68290840082910283Rat
2322884LOC100360061mCG18732-like68298230282984185Rat
1309357Lrfn5leucine rich repeat and fibronectin type III domain containing 568308259383438601Rat
1560665Timm17al1translocase of inner mitochondrial membrane 17a-like 168325200783253099Rat
1597397Cct6a-ps11chaperonin containing Tcp1, subunit 6A (zeta 1), pseudogene 1168407319884118640Rat
2319091LOC100361989mCG49489-like68419268284193402Rat
2322517LOC100360233hypothetical LOC10036023368425527484255719Rat
11425406LOC108351365uncharacterized LOC10835136568429336584293924Rat
2322466LOC100360285hypothetical LOC10036028568431978084321073Rat
1598266LOC366647similar to Glyceraldehyde-3-phosphate dehydrogenase (GAPDH)68439812384479275Rat
7664078LOC102546645uncharacterized LOC10254664568556131485575238Rat
9442963LOC103692642uncharacterized LOC10369264268561354485620699Rat
9242302LOC103692643uncharacterized LOC10369264368601990786023276Rat
1597505LOC687780similar to Finkel-Biskis-Reilly murine sarcoma virusubiquitously expressed68613118986131699Rat
1561721Fscbfibrous sheath CABYR binding protein68622026086223052Rat
11387951LOC108351366peptidyl-prolyl cis-trans isomerase A-like68650409286504626Rat
1596109LOC689195similar to TAF5-like RNA polymerase II p300/CBP-associated factor-associated factor 65 kDa subunit 5L (PCAF-associated factor 65 beta) (PAF65-beta)68655533786557218Rat
11485839LOC108351241uncharacterized LOC10835124168662464286650805Rat
1307621RGD1307621hypothetical LOC31416868665119686659371Rat
1311326Klhl28kelch-like family member 2868668082686713370Rat
1310474Togaram1TOG array regulator of axonemal microtubules 168671358886780134Rat
1308702Prpf39pre-mRNA processing factor 3968678579386810806Rat
1304992Fkbp3FKBP prolyl isomerase 368681086586822115Rat
1307897FancmFA complementation group M68682319586877067Rat
1594757Mis18bp1MIS18 binding protein 168687910686925209Rat
2321710LOC100360647ubiquitin-like protein fubi and ribosomal protein S30-like68692166886922178Rat
1593470LOC689394similar to family with sequence similarity 51, member A1 homolog68796567187966477Rat
1592352LOC689408similar to H2A histone family, member V isoform 168801385788014500Rat
11509237LOC108351242uncharacterized LOC10835124268802006788141656Rat
9438747LOC103695298uncharacterized LOC10369529868808763788090171Rat
11488287LOC108351243uncharacterized LOC10835124368814190388158823Rat
1305913Rpl10lribosomal protein L10-like68823127388232549Rat
11461866LOC108351244uncharacterized LOC10835124468831177888315120Rat
735131Mdga2MAM domain containing glycosylphosphatidylinositol anchor 268844262089292454Rat
9389933LOC103692644uncharacterized LOC10369264468855465488559326Rat
11461820LOC108351351glyceraldehyde-3-phosphate dehydrogenase-like68857489488575856Rat
9378291LOC103692647transcription termination factor, mitochondrial-like68876898788783801Rat
9333302LOC103692645glyceraldehyde-3-phosphate dehydrogenase pseudogene68911646189122117Rat
11357177LOC108351352uncharacterized LOC10835135268917473489176054Rat
11519508LOC108351245uncharacterized LOC10835124568933729389338613Rat
6495886LOC100910913non-histone chromosomal protein HMG-14-like68944285589524519Rat
11460921LOC108351246uncharacterized LOC10835124668956846789691393Rat
1592266LOC689496similar to 60S ribosomal protein L1168993265989940211Rat
6495308LOC100911036pumilio domain-containing protein KIAA0020-like69068841190689054Rat
2318430LOC100365755hypothetical LOC10036575569069399690695099Rat
11423685LOC108351247uncharacterized LOC10835124769072606790754652Rat
2318168LOC100362420DNA segment, Chr 19, Brigham & Womens Genetics 1357 expressed-like69096011490960757Rat
1591088LOC689539similar to Delta-aminolevulinic acid dehydratase (Porphobilinogen synthase) (ALADH)69096569990966802Rat
2324062LOC100362796cDNA sequence BC048679-like69107164191095627Rat
1559639RGD1559639similar to ribosomal protein L10a69111369591123932Rat
6494851LOC100911182UPF0767 protein C1orf212 homolog69111786091118922Rat
11516559LOC108351367uncharacterized LOC10835136769114976191151618Rat
6493757LOC100911256ninein-like69120775091273661Rat
1308005RGD1308005similar to RIKEN cDNA 9630033F20 gene69132848291332403Rat
1598265LOC366655similar to hypothetical protein69138480591385457Rat
6487673LOC10091230340S ribosomal protein S8-like69143845191439056Rat
3596Rps29ribosomal protein S2969145533391456709Rat
8157638Rn7sl1RNA component of signal recognition particle 7SL169145691291457210Rat
1589026Lrr1leucine rich repeat protein 169146320591472308Rat
620098Mgat2alpha-1,6-mannosyl-glycoprotein 2-beta-N-acetylglucosaminyltransferase69147669891479187Rat
1310311Dnaaf2dynein, axonemal, assembly factor 269148143991490189Rat
1311962Pole2DNA polymerase epsilon 2, accessory subunit69149434891532355Rat
1308211Klhdc1kelch domain containing 169153238091584112Rat
7644584LOC102547663transcription factor BTF3-like69158053991581434Rat
1306504Klhdc2kelch domain containing 269159544391630479Rat
2315525Nemfnuclear export mediator factor69161102191676394Rat
7625906LOC102550586uncharacterized LOC10255058669163096991637245Rat
621279Arf6ADP-ribosylation factor 669169710991698257Rat
11392605LOC108351248uncharacterized LOC10835124869177951191781821Rat
7564407LOC102548030uncharacterized LOC10254803069178241791791069Rat
7658903LOC102548223uncharacterized LOC10254822369179333791795375Rat
9297912LOC103692648uncharacterized LOC10369264869180317291804083Rat
9347219LOC103692649uncharacterized LOC10369264969186749691874297Rat
7565188Vcpkmtvalosin containing protein lysine methyltransferase69188034291884336Rat
620435Sos2SOS Ras/Rho guanine nucleotide exchange factor 269188529292008059Rat
2320876Acp1-ps1acid phosphatase 1, soluble, pseudogene 169190725091908626Rat
9299214LOC103692654chloride intracellular channel protein 4 pseudogene69198645891990747Rat
9272272LOC103692650uncharacterized LOC10369265069200839092011255Rat
1306250L2hgdhL-2-hydroxyglutarate dehydrogenase69201656092057643Rat
1359208Dmac2ldistal membrane arm assembly component 2 like69205778292076022Rat
1305080Cdkl1cyclin dependent kinase like 169207624792123108Rat
7625633LOC102548655uncharacterized LOC10254865569209585992098231Rat
1562028Map4k5mitogen-activated protein kinase kinase kinase kinase 569213624292229578Rat
1359232Atl1atlastin GTPase 169222976492370428Rat
1307253Sav1salvador family WW domain containing protein 169237647092398678Rat
7740966LOC102548804heterogeneous nuclear ribonucleoprotein R-like69238033592382478Rat
1597025LOC500665similar to SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily e, member 169242051192422678Rat
1306492Ninninein69242341292527776Rat
1303145Abhd12babhydrolase domain containing 12B69256897592596327Rat
620687Pyglglycogen phosphorylase L69259775992643734Rat
621540Trim9tripartite motif-containing 969266002692760036Rat
7653006LOC102549102uncharacterized LOC10254910269276010392791896Rat
7637319LOC102548972uncharacterized LOC10254897269279190192795817Rat
1586354LOC689946similar to sorting nexin 769283456292838989Rat
7513588LOC102551922uncharacterized LOC10255192269285958592864054Rat
1308455Tmx1thioredoxin-related transmembrane protein 169286412392875141Rat
7741692LOC102552060uncharacterized LOC10255206069306933693070592Rat
727810Frmd6FERM domain containing 669328138293358888Rat
1306515Actr10actin related protein 1069338545793411605Rat
6576126Trnak-cuutransfer RNA lysine (anticodon CUU)69341755093417622Rat
11391162Trnak-cuu9transfer RNA lysine (anticodon CUU) 969341755093417622Rat
7574462LOC102552313uncharacterized LOC10255231369341755093422827Rat
61844Psma3proteasome 20S subunit alpha 369342302993444223Rat
7648446LOC102552179uncharacterized LOC10255217969344584793461551Rat
1307442Arid4aAT-rich interaction domain 4A69346171393532901Rat
7504311LOC102552632uncharacterized LOC10255263269353456693537955Rat
1586305Tomm20ltranslocase of outer mitochondrial membrane 20 like69353837793549533Rat
621656Timm9translocase of inner mitochondrial membrane 969354948493562314Rat
1585176LOC690035similar to Protein KIAA058669356277593667857Rat
1564008Dact1dishevelled-binding antagonist of beta-catenin 169374044093751003Rat
1559545RGD1559545similar to ATPase inhibitory factor 169378933993790725Rat
11499331LOC10835124960S ribosomal protein L15-like69385254493853169Rat
11500716LOC108351250uncharacterized LOC10835125069387619293877690Rat
9345042LOC103692651uncharacterized LOC10369265169413661994142653Rat
9238151LOC103692652uncharacterized LOC10369265269417235794176561Rat
7499250LOC102553691spermatogenesis-associated protein 31C2-like69419565194202501Rat
7709349LOC102553798uncharacterized LOC10255379869426292294277266Rat
7512636LOC102553860uncharacterized LOC10255386069432205794336405Rat
9084011LOC10369265340S ribosomal protein SA pseudogene69432763194329820Rat
3373Ppm1aprotein phosphatase, Mg2+/Mn2+ dependent, 1A69443365894484979Rat
11454361LOC108351251uncharacterized LOC10835125169448432694509675Rat
1305119Daam1dishevelled associated activator of morphogenesis 169460667594739026Rat
11434949LOC108351252uncharacterized LOC10835125269473726794748557Rat
727844Gpr135G protein-coupled receptor 13569481697694818349Rat
1305721L3hypdhtrans-L-3-hydroxyproline dehydratase69482411294834908Rat
11457500LOC10835125360S ribosomal protein L9 pseudogene69483506394835666Rat
1308917JkampJNK1/MAPK8-associated membrane protein69483584594849784Rat
1560894Ccdc175coiled-coil domain containing 17569484991094933175Rat
620986Rtn1reticulon 169495101695177477Rat
9270261LOC103692655peptidyl-prolyl cis-trans isomerase D pseudogene69500488695006571Rat
11472163LOC10835125460S ribosomal protein L36a-like69519854295198987Rat
1565716Lrrc9leucine rich repeat containing 969520513195290848Rat
7695433LOC102549502uncharacterized LOC10254950269529194395356700Rat
1582892Pcnx4pecanex 469531486795452631Rat
9423282LOC103690069pecanex-like protein 469531491195452632Rat
1582892Pcnx4pecanex 469535333495360686Rat
2321168LOC100364391dehydrogenase/reductase (SDR family) member 7-like69538770995393069Rat
1308036Dhrs7l1dehydrogenase/reductase (SDR family) member 7-like 169538770995502845Rat
1565002Dhrs7dehydrogenase/reductase 769552257795541393Rat
1598264LOC366666similar to Ubiquitin-conjugating enzyme E2 E3 (Ubiquitin-protein ligase E3) (Ubiquitin carrier protein E3) (Ubiquitin-conjugating enzyme E2-23 kDa) (UbcM2)69554588095546499Rat
2319136LOC100361944hypothetical protein LOC10036194469555874195559037Rat
7521150LOC102549812serum response factor homolog A-like69556954895602610Rat
1559456Six6os1Six6 opposite strand transcript 169576171895797314Rat
11493498LOC108351256uncharacterized LOC10835125669581148195816638Rat
1310497Six6SIX homeobox 669581674995821729Rat
11360540LOC10835125560S ribosomal protein L35a pseudogene69582646795826929Rat
1597353LOC690335similar to 60S ribosomal protein L23a69588979895890332Rat
11515855LOC108351257uncharacterized LOC10835125769591280095922365Rat
620906Six1SIX homeobox 169592906095934296Rat
1597303LOC690390similar to ribosomal protein L3169597298195973470Rat
1306726Six4SIX homeobox 469598486895999709Rat
628874Mnat1MNAT1 component of CDK activating kinase69599534196153331Rat
7641929LOC102550141geranylgeranyl transferase type-2 subunit beta-like69609118996094512Rat
1306567Trmt5tRNA methyltransferase 569616457996171680Rat
1310330Slc38a6solute carrier family 38, member 669617175696241512Rat
1582926LOC688981similar to 60S ribosomal protein L26 (Silica-induced gene 20 protein) (SIG-20)69620203996204610Rat
7583083LOC10255704360S ribosomal protein L26-like69625836696261008Rat
7563444LOC102550345uncharacterized LOC10255034569633997696343944Rat
11356259LOC108351368uncharacterized LOC10835136869635231996359864Rat
1308732Tmem30btransmembrane protein 30B69643960796442682Rat
621888Prkchprotein kinase C, eta69647924396677368Rat
11460843LOC10835132060S ribosomal protein L7a pseudogene69663489496649260Rat
11421494LOC108351258uncharacterized LOC10835125869678175796786086Rat
61928Hif1ahypoxia inducible factor 1 subunit alpha69681086896856303Rat
7587838LOC102550558uncharacterized LOC10255055869683044896858807Rat
1304671Snapc1small nuclear RNA activating complex, polypeptide 169687167596893422Rat
7643655LOC102550623transmembrane protein 183-like69687487996876602Rat
1564654Syt16synaptotagmin 1669707630497199856Rat
7735797LOC102550910uncharacterized LOC10255091069710801897132746Rat
11407250LOC108351259uncharacterized LOC10835125969720893597215591Rat
7582340LOC102551114uncharacterized LOC10255111469721562297227226Rat
11506221LOC108351369uncharacterized LOC10835136969742743497429296Rat
7625884LOC102551447nesprin-2-like69745496797458285Rat
621417Kcnh5potassium voltage-gated channel subfamily H member 569787283198157087Rat
11404871LOC10835126060S ribosomal protein L7a-like69790767897908471Rat
1310528Rhojras homolog family member J69828436198367122Rat
1359264Gphb5glycoprotein hormone subunit beta 569838050098383049Rat
1305657Ppp2r5eprotein phosphatase 2 regulatory subunit B', epsilon69841797498567016Rat
11440282LOC10835126160S ribosomal protein L31 pseudogene69844963498452433Rat
1307393Wdr89WD repeat domain 8969859945698631512Rat
7577344LOC102555381cytochrome c oxidase subunit 7B, mitochondrial-like69866798698668809Rat
727829Sgpp1sphingosine-1-phosphate phosphatase 169867532498696492Rat
1305248Syne2spectrin repeat containing nuclear envelope protein 269888426999153551Rat
2582Esr2estrogen receptor 269916395399214711Rat
1560347Tex21testis expressed 2169923665399274350Rat
7712380LOC10255580360S ribosomal protein L11-like69924955299250063Rat
708531Mthfd1methylenetetrahydrofolate dehydrogenase, cyclohydrolase and formyltetrahydrofolate synthetase 169928285099350367Rat
7517255LOC102555894uncharacterized LOC10255589469929998899302287Rat
620829Akap5A-kinase anchoring protein 569935650999361909Rat
735076Zbtb25zinc finger and BTB domain containing 2569937641599400834Rat
1303095Zbtb1zinc finger and BTB domain containing 169940177599425739Rat
11491035LOC108351262uncharacterized LOC10835126269942180699428501Rat
9089876LOC103692661uncharacterized LOC10369266169942770499428335Rat
620664Hspa2heat shock protein family A (Hsp70) member 269943357599436288Rat
1309051Ppp1r36protein phosphatase 1, regulatory subunit 3669944375399464143Rat
7661508LOC102556012uncharacterized LOC10255601269946839099475218Rat
7715470LOC102556069uncharacterized LOC10255606969952684999530370Rat
1562381RGD1562381similar to ribosomal protein S1769957573399576213Rat
1308089Plekhg3pleckstrin homology and RhoGEF domain containing G369961299399655753Rat
1303243Sptbspectrin, beta, erythrocytic69965714499783189Rat
7750347LOC102546457uncharacterized LOC10254645769980591299811363Rat
1305116Churc1churchill domain containing 169981743999831574Rat
727780Gpx2glutathione peroxidase 269983996099843245Rat
735172Rab15RAB15, member RAS oncogene family69984595299870320Rat
9137814LOC103692663uncharacterized LOC10369266369984989799850780Rat
7663745LOC102546646uncharacterized LOC10254664669987398099877413Rat
11476601LOC108348171uncharacterized LOC10834817169988116399883937Rat
620119Fntbfarnesyltransferase, CAAX box, beta69988395999966988Rat
7624374LOC102546566uncharacterized LOC10254656669994703199947839Rat
621101MaxMYC associated factor X699984260100011460Rat

Nucleotide Sequences
GenBank Nucleotide BC099778 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ212266 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (Rnor_6.0)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
2301972Bp325Blood pressure QTL 3254.8arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)6175623393Rat
1354664Slep2Serum leptin concentration QTL 24.49blood leptin amount (VT:0005667)serum leptin level (CMO:0000780)6112039375023446Rat
1576309Emca7Estrogen-induced mammary cancer QTL 74mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)62537030111715717Rat
1578665Bss16Bone structure and strength QTL 164.4femur morphology trait (VT:0000559)bone trabecular cross-sectional area (CMO:0002311)6616172276002731Rat
1578668Bmd14Bone mineral density QTL 143.8femur mineral mass (VT:0010011)total volumetric bone mineral density (CMO:0001728)6616172276002731Rat
4145119Mcs25Mammary carcinoma susceptibility QTL 250.0001mammary gland integrity trait (VT:0010552)ratio of deaths to total study population during a period of time (CMO:0001023)67009971115379601Rat
1300164Rf15Renal function QTL 153.12renal blood flow trait (VT:2000006)absolute change in renal blood flow rate (CMO:0001168)61312295857516539Rat
10401812Kidm54Kidney mass QTL 54kidney mass (VT:0002707)both kidneys wet weight (CMO:0000085)61681010761810107Rat
10401800Kidm49Kidney mass QTL 49kidney mass (VT:0002707)both kidneys wet weight (CMO:0000085)61681010761810107Rat
8552910Pigfal5Plasma insulin-like growth factor 1 level QTL 54.3blood insulin-like growth factor amount (VT:0010479)plasma insulin-like growth factor 1 level (CMO:0001299)61941788764417887Rat
1641898Colcr4Colorectal carcinoma resistance QTL43.710.0007intestine integrity trait (VT:0010554)well differentiated malignant colorectal tumor surface area measurement (CMO:0002077)62151530265784818Rat
2293839Kiddil2Kidney dilation QTL 24.8kidney pelvis morphology trait (VT:0004194)hydronephrosis severity score (CMO:0001208)62204285484763421Rat
2293841Kiddil4Kidney dilation QTL 44.4kidney pelvis morphology trait (VT:0004194)hydronephrosis severity score (CMO:0001208)62204285484763421Rat
1300143Rf14Renal function QTL 142.92renal blood flow trait (VT:2000006)absolute change in renal blood flow rate (CMO:0001168)63436743680490628Rat
1331779Rf38Renal function QTL 382.876kidney blood vessel physiology trait (VT:0100012)absolute change in renal vascular resistance (CMO:0001900)63499565675623393Rat
634318Bw118Body weight QTL 1183.55abdominal fat pad mass (VT:1000711)abdominal fat pad weight (CMO:0000088)63626028860606186Rat
6893340Cm77Cardiac mass QTL 770.260.57heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)63626028884763275Rat
1354632Scl29Serum cholesterol level QTL 293.74blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)63760898075023446Rat
634307Bp141Blood pressure QTL 1414arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)63810630883106308Rat
70199Coreg1Compensatory renal growth QTL 111.8kidney mass (VT:0002707)compensatory renal growth score (CMO:0001894)63819641260606431Rat
9590290Uminl2Urine mineral level QTL 23.960.001urine mineral amount (VT:0015086)urine electrolyte level (CMO:0000593)64167904686679046Rat
9590306Scort18Serum corticosterone level QTL 182.880.001blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)64167904686679046Rat
9590140Scort4Serum corticosterone level QTL 414.490.001blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)64167904686679046Rat
634330Pia16Pristane induced arthritis QTL 163.9joint integrity trait (VT:0010548)arthritic paw count (CMO:0001460)648432758108268790Rat
4889848Pur25Proteinuria QTL 25140.003total urine protein amount (VT:0000032)urine total protein excretion rate (CMO:0000756)65980306594001333Rat
1558641Cm47Cardiac mass QTL 472.90.001heart mass (VT:0007028)heart wet weight (CMO:0000069)660606431108154445Rat
6893332Cm74Cardiac mass QTL 740.40.64heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)660606431108154445Rat
70176Mcsm1Mammary carcinoma susceptibility modifier QTL 1mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)662263348107263348Rat
12801471Schws9Schwannoma susceptibility QTL 9nervous system integrity trait (VT:0010566)percentage of study population developing trigeminal nerve neurilemmomas during a period of time (CMO:0002017)666129520111129520Rat
2293088Iddm28Insulin dependent diabetes mellitus QTL 285.21blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)66622261275023308Rat
731173Uae22Urinary albumin excretion QTL 2210.1urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)668781170147991367Rat
2290393Uae37Urinary albumin excretion QTL 370.0001urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)668781170147991367Rat
1641904Alcrsp4Alcohol response QTL 4response to alcohol trait (VT:0010489)duration of loss of righting reflex (CMO:0002289)671206251116206251Rat
1300075Glom7Glomerulus QTL 75.60.0000002kidney glomerulus morphology trait (VT:0005325)count of superficial glomeruli not directly contacting the kidney surface (CMO:0001002)675449871120449871Rat
1331789Rf37Renal function QTL 373.224kidney blood vessel physiology trait (VT:0100012)absolute change in renal vascular resistance (CMO:0001900)675623277120276465Rat
70196BpQTLcluster7Blood pressure QTL cluster 76.82arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)675623277120623277Rat
724536Uae7Urinary albumin excretion QTL 73.5urine albumin amount (VT:0002871)urine albumin level (CMO:0000130)675623277136143011Rat
1331799Bp211Blood pressure QTL 2113.66407arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)675623277136426962Rat
2301964Bp323Blood pressure QTL 3234.3arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)67562339384763275Rat
1581550Pur8Proteinuria QTL 8total urine protein amount (VT:0000032)urine total protein excretion rate (CMO:0000756)675623393136142742Rat
1581563Uae33Urinary albumin excretion QTL 33urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)675623393136142742Rat
724524Uae2Urinary albumin excretion QTL 22.70.0005urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)676902247114203334Rat
2293837Kiddil1Kidney dilation QTL 13.7kidney pelvis morphology trait (VT:0004194)hydronephrosis severity score (CMO:0001208)684763275108464097Rat
2293842Kiddil3Kidney dilation QTL 34.3kidney pelvis morphology trait (VT:0004194)hydronephrosis severity score (CMO:0001208)684763275108464097Rat
737827Hcar11Hepatocarcinoma resistance QTL 114.4liver integrity trait (VT:0010547)liver tumorous lesion number (CMO:0001068)686422697115379601Rat
1576302Schws4Schwannoma susceptibility QTL 40.0078nervous system integrity trait (VT:0010566)percentage of study population developing trigeminal nerve neurilemmomas during a period of time (CMO:0002017)687418448111129520Rat
738034Anxrr5Anxiety related response QTL 55.9exploratory behavior trait (VT:0010471)percentage of entries into a discrete space in an experimental apparatus (CMO:0000961)688507712133507712Rat
724513Uae14Urinary albumin excretion QTL 146.5urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)688996335139410483Rat
10054138Gmadr3Adrenal mass QTL 33.680.00045adrenal gland mass (VT:0010420)both adrenal glands wet weight (CMO:0000164)689631358134631358Rat
10054123Srcrt6Stress Responsive Cort QTL 62.50.0043blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)689631358134631358Rat
1300076Glom8Glomerulus QTL 870.000000009kidney glomerulus morphology trait (VT:0005325)count of superficial glomeruli directly contacting the kidney surface (CMO:0001001)691703409136703409Rat
2303624Vencon5Ventilatory control QTL 54.45respiration trait (VT:0001943)minute ventilation (VE) (CMO:0000132)692879510137879510Rat
1331722Thshl1Thyroid stimulating hormone level QTL 111.70.0001blood thyroid-stimulating hormone amount (VT:0005119)serum thyroid stimulating hormone level (CMO:0001248)693706176111134673Rat
1331725Bp212Blood pressure QTL 2123.52475arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)697949772133849286Rat
12801411Schws8Schwannoma susceptibility QTL 8nervous system integrity trait (VT:0010566)percentage of study population developing trigeminal nerve neurilemmomas during a period of time (CMO:0002017)699273921144273921Rat
61414Pia3Pristane induced arthritis QTL 34.5joint integrity trait (VT:0010548)post-insult time to onset of experimental arthritis (CMO:0001450)699273921144792678Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 298963 UniSTS
  60661 UniSTS
UniSTS 243787 UniSTS