RH144219 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: RH144219

Symbol: RH144219
Previously known as: AW525709; 
RGD ID: 5029285
Expected Size: 160 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.22029,923,658 - 29,923,818 (+)MAPPERmRatBN7.2
Rnor_6.02031,597,925 - 31,598,084NCBIRnor6.0
Rnor_5.02033,394,668 - 33,394,827UniSTSRnor5.0
RGSC_v3.42029,348,378 - 29,348,537UniSTSRGSC3.4
Celera2031,347,693 - 31,347,852UniSTS
Cytogenetic Map20q11UniSTS
Is Marker For: Genes:   Col13a1  


Annotation


References - curated
# Reference Title Reference Citation
1. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer CCAGATCCCTGAACTTGGAA
Reverse Primer GAGCTAGCGTGGCTAGAGGA
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
1595704Col13a1collagen type XIII alpha 1 chain202978396529924116Rat

Nucleotide Sequences
RefSeq Transcripts NM_001109172 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
GenBank Nucleotide BC162018 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
6893685Bw111Body weight QTL 1112.70.004body mass (VT:0001259)body weight (CMO:0000012)20132578807Rat
7411668Foco32Food consumption QTL 3280.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)20136600972Rat
7411652Foco24Food consumption QTL 240.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)201175751554435887Rat
9590252Scort12Serum corticosterone level QTL 1220.460.001blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)20136600972Rat
1331747Hrtrt16Heart rate QTL 163.163heart pumping trait (VT:2000009)heart rate (CMO:0000002)202520973454435887Rat
9590092Insglur9Insulin/glucose ratio QTL 918.380.001blood insulin amount (VT:0001560)calculated plasma insulin level (CMO:0002170)201175751554435887Rat
1598816Memor12Memory QTL 122.4exploratory behavior trait (VT:0010471)average horizontal distance between subject and target during voluntary locomotion in an experimental apparatus (CMO:0002674)20260683647606836Rat
1598869Memor6Memory QTL 63.1exploratory behavior trait (VT:0010471)total horizontal distance resulting from voluntary locomotion in an experimental apparatus (CMO:0001443)202924438854435887Rat
2303578Gluco50Glucose level QTL 502blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)202510672254435887Rat
2303626Vencon10Ventilatory control QTL 100.001respiration trait (VT:0001943)respiration rate (CMO:0000289)201919072154435887Rat
2305926Iddm37Insulin dependent diabetes mellitus QTL 376blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)20152784246527842Rat
2317880Alcrsp25Alcohol response QTL 252.3response to alcohol trait (VT:0010489)duration of loss of righting reflex (CMO:0002289)201769755054435887Rat
4889610Pancm3Pancreatic morphology QTL 33.750.001pancreas mass (VT:0010144)pancreas wet weight (CMO:0000626)201761783247606836Rat
2303587Bw93Body weight QTL 9313body mass (VT:0001259)body weight (CMO:0000012)202510672254435887Rat
1641915Colcr9Colorectal carcinoma resistance QTL 92.970.0024intestine integrity trait (VT:0010554)benign colorectal tumor number (CMO:0001795)20153065546530655Rat
2300188Bmd68Bone mineral density QTL 686.40.0001femur mineral mass (VT:0010011)volumetric bone mineral density (CMO:0001553)202510672254435887Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 499431 UniSTS
UniSTS 233464 UniSTS